Теги: magazine   magazine science  

Год: 2024

Текст
                    
EDI TO R I A L Stop arguing and cut emissions T Jay Apt is at the Tepper School of Business and Department of Engineering and Public Policy, Carnegie Mellon University, Pittsburgh, PA, USA. apt@cmu.edu y “…a mixed technology portfolio… offers the most feasible route forward…” M. Granger Morgan is in the Departments of Engineering and Public Policy and of Electrical and Computer Engineering, Carnegie Mellon University, Pittsburgh, PA, USA. gm5d@ andrew.cmu.edu y g y , 10.1126/science.adn9176 SCIENCE science.org g sonable way requires careful lifecycle accounting, but one should avoid prescriptive standards. As well, the US should avoid mandates that impose high short-term costs. For example, as carbon dioxide (CO2) emissions from electricity fall, switching home heating to heat pumps becomes an attractive way to reduce emissions. Some are now insisting that new homes not use natural gas. However, on very cold days, even the best of today’s heat pumps must switch on electric resistance heat. Occasionally using a small amount of natural gas in hybrid heat pumps, whose expected life is only a couple of decades, would help avoid huge short-term investments in further upgrading already stressed electricity distribution systems while avoiding longer-term lock-in. Rather than a ban on any use of gas, it would be far better to implement a performance standard that sets a steadily diminishing upper bound on emissions from new heating systems. The Clean Heat Standards that Colorado and Vermont are considering are modest steps in this direction. The US should also continue to ramp up investment in affordable low-GHG technologies for electricity and industrial processes while not forbidding the use of specific fuels if emissions can be controlled. The biggest reason that the US electricity system emits only about half as much CO2 as it did in 2005, while generating 7% more power, is that a lot of new natural gas plants have been built and older, dirtier coal plants retired. Almost none of these gas plants are equipped with CCS technology, but many should be. Norway has had CCS at commercial scale for almost 30 years. Because the US has no price on CO2, it has been slower to adopt this technology, but the 2022 tax incentives may unleash US innovation. The US should also safely extend the life of as many existing nuclear plants as possible. However, unless the nuclear industry and regulators can achieve substantial cost improvements, building new nuclear plants in the US will not be economically viable. Let’s not allow the perfect to become the enemy of the good in responding to the climate emergency. A full portfolio of low-carbon technology is the best way to do that while minimizing the risks of impeding the adoption of even better solutions as they become viable and affordable in the future. –M. Granger Morgan and Jay Apt p he expert and policy communities have invested enormous effort in debating what greenhouse gas (GHG) emissions target to aim for, or which decarbonization policies and technologies should be mandated or banned. Because multiple trajectories can achieve similar targets and timelines, some scenario analysis is useful. However, with many players involved, it will be impossible to remain on anyone’s optimal trajectory. As one of the world’s largest contributors to the climate crisis, the US should stop arguing about perfect solutions and get on with reducing emissions in ways that are feasible and affordable. Renewables have made good progress in the US but still produce only 21% of electric power. Arguments that the US should ban all electricity that is not made by wind or solar, or that the only acceptable way to make hydrogen is by using renewable electricity to split water, are costly and delay action, when cost and time are among our greatest challenges. Given the urgency of the climate problem, everyone should be focused on reducing the concentration of GHGs in the atmosphere as rapidly as possible, using a broad portfolio of affordable and achievable strategies. In the long term, everyone needs to stop burning all fossil fuels. In the near term, multiple models show that a mixed technology portfolio, which includes some natural gas plants outfitted with carbon capture and sequestration (CCS), offers the most feasible route forward for the US. We disagree with those who argue that doing this is simply a smokescreen to protect the fossil fuel industry. That said, we strongly caution against those who champion natural gas as “a bridge to the future” without simultaneously prioritizing the creation of the bridge abutment at the far end. Beyond this there are three things the US should be doing. For a start, because the country appears unable to implement a nationwide price on carbon or a cap and trade regime, national performance standards that become tighter over time should be specified for each major category of emissions. Industry and users can then innovate to meet or perhaps even exceed the standards. The US has done this for control of conventional pollution and for automobile fuel economy; California has done it for lighting. Rather than mandating specific solutions, the same approach should be adopted for many other activities. Doing this in a rea- 1 MARCH 2024 • VOL 383 ISSUE 6686 933
NEWS IN BRIEF We warn about a risk of ‘scienticide,’ the systematic destruction of Argentine science and technology. “ ” Argentina’s Federal Science and Technology Roundtable, criticizing research budget cuts and layoffs of science administrators under the new president, libertarian Javier Milei. Edited by Jeffrey Brainard PLANETARY SCIENCE Early end for private Moon lander | The governing body of the U.S. National Science Foundation (NSF) plans to recommend changes in the agency’s grantsmaking process that it hopes will prompt reviewers to pay more attention to a project’s potential benefits for society. Since 1997, NSF has asked outside reviewers to rate proposals based on both intellectual merit and “broader impacts,” or how a project could address societal needs, such as public health and economic development. But persistent concerns that many reviewers give short shrift to these potential effects prompted the presidentially appointed National Science Board in 2022 to name a committee to reexamine the two metrics. Last week, the panel’s chair, Stephen Willard, gave the board a sneak peek at its report, due in May. One recommendation would clarify the intent of the broader impacts criterion by changing its name to “societal benefits.” The committee may also suggest reviewers provide a separate score for that category. L E G A L A F FA I R S 934 1 MARCH 2024 • VOL 383 ISSUE 6686 | Courts in Sweden and Spain have rejected demands by a mysterious Polish company that scientists who participated in its COVID-19 webinars pay it tens of thousands of euros for “debate fees”—charges the scientists called illegitimate. The company, Villa Europa, asked researchers to sign licensing agreements after the webinars, which contained long clauses on the final page mentioning charges for participation. The company then billed the researchers for as much as €80,000. Last month, a Swedish appeals court announced it had dismissed claims by the company against the three scientists; the decision cited “remarkable and troubling circumstances” about the claims and ordered it to pay about €68,000 to partially cover their legal fees. The dismissal followed a similar one in 2023 by a court in Madrid, which backed a Spanish researcher’s challenge. This month, a court in Berlin is set to hear another such request, from a German scientist. science.org SCIENCE , FUNDING y | Governments need to step up oversight of research on microbes that could cause a pandemic, says a report this week from the Bulletin of the Atomic Scientists. Its Pathogens Project, a 28-member independent task force, examined risks of an accidental or deliberate release from a lab studying “potential pandemic pathogens” such as SARS-CoV, SARS-CoV-2, H5N1 avian influenza, and related viruses. Researchers should consider using safer approaches for such studies and weigh public health benefits against risks, says the report, which also calls for international rules on biosafety, mandatory reporting of lab accidents, and more research on lab risks. The report stands out because the panel included experts from around the world, says co-chair David Relman, a microbiologist at Stanford University. It comes as U.S. officials are considering new rules for research, known as gain-of-function studies, that can make dangerous pathogens riskier. P U B L I C H E A LT H y g Courts quash webinar bills y NSF to seek ‘societal benefits’ g Call for safer pathogen labs p T he first private spacecraft to land on the Moon was expected to shut down from a lack of power several days ahead of schedule, as Science went to press. On 22 February, Intuitive Machines’s Odysseus lander, built with $118 million from NASA, became the first U.S. spacecraft (pictured during descent) since 1972 to touch down there, near the lunar south pole. Measuring 4.3 meters tall, Odysseus tipped on its side, which reduced the light reaching its solar panels and blocked several antennas, limiting the operation of its scientific instruments. The lander’s power supply dwindled, and it is unlikely to survive the frigid, 2-week lunar night. Still, NASA hailed the mission as a successful start to its Commercial Lunar Payload Services program, which aims to pay companies for low-cost access to the Moon.
India genomes illuminate past BIG GIFT A professor emeritus of pediatrics at the Albert Einstein College of Medicine has donated $1 billion to the school. Ruth Gottesman, who inherited a fortune from her husband, a Wall Street financier, stipulated that the college use the gift, one of the largest to any U.S. educational institution, to provide future students free tuition. At Einstein, Gottesman developed treatment methods for learning disabilities. SCIENCE science.org 1 MARCH 2024 • VOL 383 ISSUE 6686 935 , IN FOCUS Researchers last week reported finding more than 100 marine species that may be new to science deep underwater off the coast of Chile. Using a robot, they took images of the sponges, amphipods, urchins, crustaceans, and corals (pictured) dwelling on four previously unmapped seamounts. The region is protected by Chile as marine parks, which may help explain the biodiversity. The scientists’ continuing research cruise is funded by the Schmidt Ocean Institute. MEASLES FREEDOM Public health specialists criticized Florida’s surgeon general for telling parents of unvaccinated students whose elementary school had a measles outbreak they are free to keep the potentially exposed children in class. The stand by Joseph Ladapo contradicts guidance from the federal government that calls for such students to remain home for 3 weeks. y NATURE LAW SURVIVES The European Parliament this week narrowly approved the Nature Restoration Law, which sets targets to restore ecosystems. Last year, lawmakers gave preliminary approval, but the measure—a central piece of EU leaders’ green agenda—was softened after right-of-center parties criticized it as unfairly burdening farmers. y g PHOTO: ROV SUBASTIAN/SCHMIDT OCEAN INSTITUTE GENOMES AND RACE An uproar broke out on X (formerly Twitter) after Nature published a paper last week about a massive U.S. research effort, the All of Us project, that is studying links between genes and health in people across the country. Critics said a key figure, which depicts patterns of relatedness among nearly 250,000 study volunteers whose genomes were sequenced, could mislead some readers into thinking that humans fall into distinct races defined by genetics. y | A pilot program will pay reviewers to check important published papers and preprints in psychology. Reviewers will receive up to 3500 Swiss francs (nearly $4000) depending on the RESEARCH INTEGRITY | More than one in 10 graduate students and postdocs in the health sciences at Harvard University experiences food insecurity, a study has found. Researchers surveyed 1745 early-career researchers in 2023, finding that 17% of graduate students and 13% of postdocs consume food of inadequate quality or quantity because of a lack of money or other resources. Rates were even higher —approximately 25%—among graduate students who identified their race as other than white or Asian and those who were the first in their family to attend college. The authors of the study, published last week in JAMA Network Open and one of the first of its kind, urged other institutions to gather similar information and collectively develop policy interventions. COMMUNITY ANTARCTIC FLU Spanish researchers provided the first confirmation that a highly pathogenic strain of avian influenza has reached mainland Antarctica. Tests showed that two dead skuas found on 24 February near Argentina’s Primavera research station were infected with an H5 bird flu strain. A government press release didn’t say it was the H5N1 strain, but that seems likely. H5N1, previously found on islands in the Antarctic region, has killed millions of wild birds and poultry worldwide since 2021 and poses a threat to Antarctica’s dense penguin colonies. g Wanted: scientific bounty hunters Harvard researchers face hunger IN OTHER NEWS p | The largest genome analysis of contemporary populations living in India has revealed new details about South Asia’s ancient genetic history. Indians’ genomes contain a striking percentage of known Neanderthal and Denisovan genes, researchers reported in a preprint last week, based on an analysis of 2762 genomes from across India. Whereas individual Indians derive 1% to 2% of their ancestry from these archaic ancestors—a rate similar to those of Europeans and East Asians—the subcontinent’s populations together hold a greater diversity of these genes than seen in any other population, comprising about 50% of all Neanderthal genes known to have passed into modern humans and 20% of known Denisovan genes. The study also backed up previous work suggesting modern Indians derive primarily from three ancestral groups: Iranian farmers, South Asian hunter-gatherers, and Eurasian Steppe pastoralists. A N T H R O P O L O GY severity of any errors uncovered. Authors must consent in advance; they, too, will receive compensation if they cooperate and their work proves reliable. The program, Estimating the Reliability and Robustness of Research, is funded by the University of Bern and modeled after payments by software companies to programmers who find flaws in code. Backers say scientific authors and reviewers lack incentives to identify errors in the literature.
NE WS IN DEP TH p REPRODUCTIVE HEALTH g Alabama IVF ruling may halt uterus transplants Scientists fear wider research impacts if other states label frozen embryos “children” T science.org SCIENCE , 1 MARCH 2024 • VOL 383 ISSUE 6686 y 936 A doctor removes frozen embryos created during in vitro fertilization from a liquid nitrogen tank. they are implanted in the uterus and a viable pregnancy can be detected—the impacts on would-be parents in Alabama were immediate. Many IVF procedures have been halted in a state where, in 2021, more than 1600 rounds of IVF treatment were completed, resulting in more than 400 babies. But it also stands to affect UAB’s uterus transplant program, led by immunologist and transplant surgeon Paige Porrett, which aims to help those who were born with defective or absent uteruses or had hysterectomies bear children. For patients to qualify for a transplant, they must first have embryos frozen for implantation—an impossibility at UAB since last week, when the university paused such IVF procedures. “Thanks to the Supreme Court ruling on Friday everything is at a full stop,” Elizabeth Goldman, a UAB transplant patient, wrote on Facebook. Goldman was born without a uterus and received a uterus transplant at UAB in 2022 after banking frozen embryos; she gave birth to a daughter in November 2023 and had been scheduled to have another embryo transferred in the coming months. “I’m on a timeline with uterus transplant and this just makes things way more complicated.” UAB, which has touted the transplant program, declined to answer questions about it or to make Porrett, who heads the program, available for an interview. Porrett herself did not respond to an emailed interview request. y g he Supreme Court of Alabama’s 16 February ruling declaring frozen embryos at fertility clinics to be people has upended patient care there. The state’s two leading private in vitro fertilization providers as well as the University of Alabama at Birmingham (UAB) paused all IVF procedures last week while officials assess the legal risks of continuing to create and store embryos and impregnate patients. But the impacts extend beyond wouldbe parents, to research. A uterus transplant program in which women conceive by IVF— one of only four in the country—is located at UAB, and its leader is also co–principal investigator on a related project studying uterine immune cells. If other states follow Alabama’s lead, other research, including efforts to improve IVF outcomes and probe developmental biology, could be imperiled around the country. “There’s research that is being done not just on uterus transplants, but on IVF, on eggs, and on embryos,” says Kate O’Neill, a reproductive medicine physician who directs the Uterus Transplant Program at the University of Pennsylvania (UPenn). Such studies, she says, “are going to advance science, and if this spreads, [they] would be very difficult to do.” In its 8-1 decision, the Alabama Supreme Court overturned a lower court decision denying three couples the ability to recover punitive damages for the accidental loss of their frozen embryos. They sued a fertility clinic—the Center for Reproductive Medicine—and an affiliated medical center in Mobile because their embryos, created through IVF, were dropped on the floor and rendered unviable. The lower court had held that frozen embryos were not children under a 150-year-old law that allows parents of a dead child to bring civil suits. The state Supreme Court, however, declared “the law applies to all unborn children, regardless of their location.” And although the future of the ruling in Alabama is still uncertain—one state lawmaker, for instance, is working on a bill to clarify that embryos are not “people” until y By Meredith Wadman
N E WS Experiments suggest chemical reaction rates explain how proteins came to be built from left-handed building blocks By Robert F. Service T here’s a bias at the heart of life, and its origin is an enduring mystery. Nearly all the amino acid building blocks of proteins today exist in mirror-image forms, like right- and left-handed gloves. But life only uses left-handed ones, even though both forms should have been equally abundant during the planet’s early days and can readily link up in the lab. Something must have tipped the balance toward lefties in the primordial soup and preserved the bias ever since. Now, a trio of U.S. researchers proposes a novel explanation. This week in Nature, they report that by monitoring the formation on one mirror-image form and not the other. Several explanations have been advanced in recent decades for life’s chirality, as the bias toward a particular handedness is known. For example, meteorites, which could have seeded an early Earth, have been shown to harbor amino acids with an abundance of left-handed chirality, perhaps because their contents were exposed to polarized light. Or magnetic fields on early Earth could have given a twist to early biomolecules (Science, 16 June 2023, p. 1094). But even if some external force imparted an initial bias, what propagated it? One clue comes from recent work by Matthew Powner, an origin of life chemist at University College London, and his col- y y g rates of amino acid pairs, called dipeptides, they’ve found multiple mechanisms that ultimately promote dipeptides whose two members share the same handedness. “It’s quite convincing,” says Gerald Joyce, a pioneering origin of life chemist and president of the Salk Institute for Biological Studies who was not involved with the study. Researchers next hope to learn whether the same mechanisms skew larger peptides and proteins toward left-handedness—and whether it can explain the opposite bias in RNA and DNA, whose bases have sugars that are inevitably right-handed. If so, the new mechanisms could explain how life itself took leagues. Over the past 5 years, Powner’s group has discovered a set of sulfur-based molecules that likely would have been present on early Earth and shown how they readily link individual amino acids to amino acid precursors, called aminonitriles, forming dipeptides. Because these reactions take place in water and work with all the amino acids found in living organisms, they offer a plausible route to how the first proteins may have formed. Powner’s team didn’t check whether its sulfur-based catalysts had a chiral bias. That’s where Donna Blackmond, an origin of life chemist at Scripps Research, 1 MARCH 2024 • VOL 383 ISSUE 6686 937 , Biased chemical reactions within the primordial soup on early Earth may have led to amino acid pairs that are fully left-handed (right) even though some with mixed handedness (left) were initially made faster. y SCIENCE science.org New origin of life theory may explain biomolecular handedness g Porrett and O’Neill are co–principal investigators on a research effort attached to a similar transplant program at UPenn: a $1.9 million U.S. National Institutes of Health project to study key pregnancy-sustaining immune cells in the transplanted uteruses. They aim to document the tissue origins of uterine natural killer cells, which are critical to successful implantation of the embryo in the uterus. By taking biopsies of the endometrium, or uterine lining, from those who have received uterus transplants, O’Neill says, the team is probing where in the body the cells originate. “Understanding this will make huge impacts outside of uterus transplants, in pregnancy in general,” and potentially in transplantation of other organs. Other avenues of experimental work— for instance, comparing culture mediums in fertility clinic labs to see whether one produces better embryo survival rates than another—will be affected in Alabama, says Michael Allemand, a reproductive endocrinologist at Alabama Fertility Specialists, an IVF clinic that has paused all treatments. “No one in the state can do that kind of work including the university practices if they can’t do IVF.” Outside Alabama, other research relies on frozen embryos, donated from IVF clinics with patient consent. Such studies have illuminated how chromosomal abnormalities arise during the very earliest days of embryonic development and how such abnormalities are strongly associated with IVF embryos ceasing to develop and then dying in lab dishes. In other work, scientists have compared the genetics of cells in the outer layer of IVF embryos, which are often biopsied for genetic testing before the embryos are implanted, with cells from the rest of the embryo. The comparison showed that in 90 out of 93 embryos, the outer cells accurately mirrored chromosomal abnormalities in the rest of the cells. Such research could be at risk if other states explicitly declare frozen embryos to be people. “It will be very tempting for states that have very strong antiabortion leanings to try to do copycat legislation … or litigation,” says Susan Crockin, an expert in reproductive technology law at Georgetown University Law Center. She notes that several states—including Missouri, Arkansas, Kentucky, and Oklahoma—already have statutes that define life as beginning at fertilization. “And so you’ve already got the stepping stones if you want to argue that frozen embryos or [any] embryos should be swooped into any protections for living people.” j BIOCHEMISTRY p ILLUSTRATION: N. BURGESS/SCIENCE Kristia Rumbley of Alabama holds her youngest child, born via IVF. She has frozen two more embryos.
NE WS | I N D E P T H Proposal would combat warming by drying the stratosphere Seeding clouds above the western Pacific would keep water vapor, a greenhouse gas, out of the atmosphere’s rooftop By Paul Voosen y , science.org SCIENCE y g G iven the alarm about rising levels of carbon dioxide and methane, it’s easy to forget that plain old water vapor is a major greenhouse gas, too. It can linger for years in the stratosphere, for example, absorbing heat from the surface and re-emitting it back down. According to one study, a possible jump in stratospheric water during the 1990s may have boosted global warming by up to 30% during that time. But what if you could stop water from getting there in the first place? That’s the idea behind a new geoengineering technique, proposed this week in Science Advances. By targeting rising, moist air and seeding it with cloud-forming particles right before it crosses into the stratosphere, geoengineers could cool the world with an intervention far more delicate than other schemes. Drying the stratosphere might take as little as 2 kilograms of material a week, says Shuka Schwarz, the study’s lead author and a research physicist at the Chemical Sciences Lab of the National Oceanic and Atmospheric Administration (NOAA). “That’s an amount of material that helps open the mind to imagine a whole bunch of possibilities.” “Intentional stratospheric dehydration,” as it’s called, could only cool the climate moder- ately, offsetting roughly 1.4% of the warming caused by increased carbon dioxide over the past few hundred years. But for geoengineers who have talked about cooling the planet by loading the stratosphere with thousands of tons of reflective particles, “it’s clearly a new idea,” says Ulrike Lohmann, an atmospheric physicist at ETH Zürich. “This is something that could work.” The scheme relies on a key fact: Only a few places in the world are hot enough to generate the powerful updrafts needed to lift air into the stratosphere, which begins between 9 and 17 kilometers above the surface, depending on latitude. The most important of these portals is found above the western equatorial Pacific Ocean, in a region roughly the size of Australia. Along its upward journey, much of the water condenses into clouds and rains out of the air. But in the past decade, NASA used a high altitude, jet-powered drone to study the cold layers just below the stratosphere and found plenty of air masses moist enough to form clouds, but lacking in particles that would allow the moisture to condense into ice crystals and ultimately rain. “It’s a question of chance, whether they get to this coldest spot on their journey and there’s enough cloud nuclei left to do anything,” Schwarz says. The NASA studies also found that this moisture y 1 MARCH 2024 • VOL 383 ISSUE 6686 GEOENGINEERING g 938 Condensation nuclei help moist updrafts form towering storm clouds. p and her colleagues Min Deng and Jinhan Yu grabbed the baton. They tested two of Powner’s sulfur compounds to see whether the catalysts were sensitive to chirality as they formed dipeptides. They were, but not in the way Blackmond had expected. The catalysts created about four times as many “heterochiral” dipeptides—those pairing a left-handed amino acid (L) with a right-handed (D) one—as fully chiral products. “We thought it was bad news,” Blackmond says, because it suggested that even if amino acids on early Earth started with a bias, it would have been scrambled as proteins formed. But as Blackmond and her colleagues looked more deeply, the news got better. In a series of experiments, the Scripps researchers started with skewed proportions of L and D amino acids—for example, 60% Ls and 40% Ds. The L,D and D,L heterochiral dipeptides formed most quickly, and as they did they pulled equal numbers of L and D amino acids out of the mix. Because of the baseline bias, eventually a predominance of Ls remained in the pool of unreacted amino acids, raising the likelihood of forming fully lefthanded dipeptides. “It’s like a domino effect,” Powner says. The first heterochiral reaction eventually encourages more homochirals to form. “And it’s a general process that works with all amino acids,” Powner says. Joyce adds: “It’s just math.” Follow-up experiments suggested a second bias that amplifies the effect. The team found that heterochiral dipeptides precipitate out of a solution more quickly than homochiral ones, speeding the way to a relative abundance of either homochiral L,L or D,D pairs, depending the starting mix. Just why this precipitation bias occurs isn’t yet clear, Blackmond says. However, Joyce says, together with the other effect, “it beautifully fits the [experimental] data.” Blackmond adds: “The wrong answer turned out to be the right answer to get us to homochirality.” For now, this push toward a particular handedness has only been shown with dipeptides. But Blackmond says preliminary work suggests the same biasing process unfolds when the sulfur catalysts stitch short peptides together into longer peptide chains. Joyce thinks it’s possible that the same sort of math may also help explain how life’s genetic molecules gained their handedness. “This could happen with all kinds of other things, like RNA,” he says. Perhaps it was just a statistical coin flip that caused an original bias toward building blocks of one handedness to form, Joyce says. “But once that coin flipped it caused other coins to flip.” j
A dramatic shortage of the oral vaccine may ease in the years ahead as more companies enter the market By Pratik Pawar T y g he world has run out of cholera vaccines—just when the deadly disease is on a rampage not seen in many years. Fifteen countries are currently reporting active outbreaks, with more than 40,900 cases and 775 deaths reported in January alone. But all available doses of oral cholera vaccines in the global stockpile have been allocated until mid-March, Philippe Barboza, cholera team lead at the World Health Organization (WHO), said on 23 February. He said there is now “no buffer for unforeseen outbreaks or preventive campaigns.” The catastrophic shortage is a result not just of a surge in cases, but also of an overdependence on a single vaccine manufacturer, EuBiologics in Seoul, South Korea, whose production capacity is limited. “Unfortunately, there is no short-term solution to increase vaccine production,” says Daniela Garone, international medical coordinator at Doctors Without Borders (MSF). But hope is on the horizon. EuBiologics is working to ramp up production of a simplified vaccine, and companies in South Africa and India are preparing to enter the market as well. The shortage “will lessen in 2024 and should be substantially addressed by 2025,” says Julia Lynch, director of the cholera program at the International Vaccine Institute (IVI), also in Seoul; by 2026 or 2027, it could even be a “crowded market,” she predicts. Cholera, caused by the Vibrio cholerae bacterium, causes terrible diarrhea, with the body flushing out as much as 1 liter of fluid per hour. Left untreated, it can kill in less than a day. Many public health experts attribute the current surge, which began in late 2022, at least partially to climate change. Extreme weather events in Pakistan, Malawi, and Mozambique have destroyed health and sanitation infrastructure, allowing the bacterium to thrive. Armed conflict and displacement of people in the Democratic Republic of the Congo and Yemen have also led to outbreaks. The two-dose oral cholera vaccine, developed by IVI based on earlier research in Vietnam, contains several strains of inactivated V. cholerae bacteria, along with a part of the toxin secreted by the bacterium, which boosts the immune response. Two doses given 2 weeks apart can offer robust protection for at least 3 years, and, when deployed early enough, can prevent outbreaks from ballooning. The global stockpile of the vaccine, established in 2012, is managed by an Inter- y y , PHOTO: NYASHA MUKAPIKO/EFE VIA ZUMA PRESS World’s cholera vaccine stash is empty—but relief is on its way g SCIENCE science.org GLOBAL HEALTH p was concentrated: Just 1% of the air parcels explored accounted for half of the water that could end up in the stratosphere. In a simple model, the team simulated injecting bismuth triiodide, a nontoxic compound that has been used in lab studies of ice nucleation, into the 1% areas most ripe for water harvesting. In an optimistic scenario, just 2 kilograms a week of seeds 10 nanometers in diameter would be enough to convert those moist air parcels into clouds, they found. Such an amount could be sprayed by balloons or drones, with no airplane needed. Daniel Cziczo, an atmospheric chemist at Purdue University, says the idea is interesting but could pose risks. If the seeds failed to form clouds in the right place and spread elsewhere, they could speed the formation of the wrong kinds of clouds: thin, wispy cirrus clouds, which reflect little sunlight but absorb infrared heat from the surface, Cziczo says. “You’re basically exploring a technique that could have a warming effect and not a cooling effect.” Mark Schoeberl, an atmospheric scientist at the Science and Technology Corporation who previously identified the stratospheric gateway in the Pacific, agrees with the need for further study. “You want to avoid unintended consequences and make a cleareyed assessment of implementation cost.” The technique likely won’t be effective all year round, he adds, because most water reaches the stratosphere during the Asian monsoon seasons. And just how much a reduction in stratospheric water would cool the surface is uncertain, he says. Schwarz sat on the idea for a while, wary of the controversy that surrounds all proposals for tinkering with the planet to offset humancaused warming. But now that the U.S. Congress has mandated that NOAA study solar geoengineering, “the stigma around considering climate intervention is abating a bit,” he says. “Two years ago, I for one would have really hesitated to consider these possibilities.” The openness is spreading. For example, the European Union is now supporting research into geoengineering governance. Switzerland last week called on the United Nations to support research in the area. And Lohmann’s group last week won a grant from the Simons Foundation to study another intervention: thinning heat-trapping clouds above polar regions to mitigate warming. “Things have changed on the science agenda,” Lohmann says. She says climate scientists have reservations about exploring these schemes but feel there is no choice. Emission cuts simply haven’t happened fast enough, and carbon dioxide cannot yet be sucked out of the air cheaply. “It’s clear we’re looking for something else,” she says. “It’s our failure as humans to avoid this.” j A woman receives a dose of the oral cholera vaccine at a clinic in Kuwadzana, Zimbabwe, on 29 January. 1 MARCH 2024 • VOL 383 ISSUE 6686 939
NE WS | I N D E P T H national Coordinating Group on Vaccine Provision made up of experts from WHO, UNICEF, MSF, and the International Federation of Red Cross and Red Crescent Societies. It can rapidly send vaccine to countries in need. The number of doses available for shipment reached 36 million in 2023 (see graphic, below) and could be close to 50 million this year. But all will be needed to fight ongoing outbreaks, and the shortage has forced some difficult choices. In late 2022, the coordinating group announced it would stop giving people second doses; even a single dose, studies have found, can provide substantial protection against cholera for a few years at least. The stockpile group must also choose where to send the scarce doses, and how to distribute them on the ground. UNICEF, one of the partners managing the 35 30 25 20 15 Count as of 22 February Februaryy 10 0 2016 2018 2020 2022 2024 1 MARCH 2024 • VOL 383 ISSUE 6686 science.org SCIENCE , 940 Pratik Pawar is a science journalist in Bengaluru, India. P igs, cattle, and other livestock with edited genes are still far from most dinner plates, but a U.K. company has taken a big step toward the supermarket by engineering several commercial breeds of pigs to be resistant to a virus that devastates the swine industry. The firm, Genus plc, hopes that by year’s end the U.S. Food and Drug Administration (FDA) will formally approve the pigs for widespread human consumption, a first for a gene-edited animal. Alison Van Eenennaam, an animal geneticist at the University of California, Davis, is cheering the news. “There’s no point having a pig getting sick and dying if there’s an approach to genetically prevent it from doing so,” she says, adding that this benefits farmers, the pigs, and, ultimately, the consumer. But Van Eenennaam laments the regulatory hoops the company is having to jump through. FDA views the DNA change made by the genome editor CRISPR as an “investigational new drug” that requires multiple submissions from Genus to establish the altered gene’s safety, heritability, and ability to protect against the virus. “You’re talking about a very, very expensive regulatory pathway,” she says. It is unnecessary, she argues, because unlike genetically modified organisms, which sometimes have DNA from other species added, the gene editing involved the pigs’ own DNA, creating changes that could happen naturally. The gene edit made by Genus outwits a virus that kills nearly all the suckling pigs it infects and weakens older ones as well. The virus, which causes a condition called porcine reproductive and respiratory syndrome (PRRS), has spread worldwide and costs the pork industry an estimated $2.7 billion annually. Eight years ago, a y stockpile, says the aim is “to allocate supply in the most impactful manner.” In the case of Zimbabwe, for example, the 2.3 million doses approved in late January were prioritized for use in the capital city Harare and in Buhera district, the outbreak’s epicenter, even though cholera has occurred in 63 of the country’s 64 districts. To boost supply, EuBiologics has simplified its original vaccine, with funding from the Bill & Melinda Gates Foundation. The new formulation, Euvichol-S, contains two strains of the inactivated V. cholerae bacteria instead of five, and the recipe drops a heat inactivation step. That makes the vaccine easier to produce and about 20% cheaper. This will further expand EuBiologics production capacity by 38%, to about 52 million doses annually, according to a De- By Jon Cohen y g 5 United States and other countries may soon approve virus-proof pigs y Doses approved for shipping (millions) 40 Meat from gene-edited pigs could hit the market g As cholera outbreaks have surged, the number of cholera vaccine doses approved for shipment to outbreak areas has grown rapidly, depleting the global stockpile. Close to 50 million doses are expected to ship this year. AGRICULTURE p A surge in demand cember 2023 press release from IVI, which has supported the development. A phase 3 trial in Nepal in 2022 showed the simplified version protects as well as the original. Euvichol-S is currently under review for “prequalification,” a seal of approval from WHO that the company expects to come through in April, says EuBiologics Director Rachel Park. Then Gavi, the Vaccine Alliance will procure the vaccine at roughly $1.5 per dose to replenish the stockpile. EuBiologics is also building a new facility that could expand its production capacity to 90 million doses annually. To end the reliance on a single manufacturer, IVI in 2022 began to help Biovac, a South African company, set up a facility to produce the simplified vaccine. Biovac tells Science it plans to start clinical trials in 2025 and hopes to produce 30 million vaccine doses annually in 5 or 6 years. Biovac has been encouraged by a so-called advanced market commitment from Gavi, a pledge to buy many vaccine doses at established prices. So is the Indian manufacturer Biological E, which plans to produce IVI’s simplified vaccine. Another Indian biotechnology company, Bharat Biotech, is working on its own lowcost cholera vaccine, Hillchol. Bharat has said little about its progress and did not respond to questions, but a phase 3 trial—at various locations in India—finished in early 2023, Lynch says. Manufacturers in China, Vietnam, and Bangladesh also make cholera vaccines, but their products have not been prequalified by WHO. IVI is developing an injectable conjugate vaccine, in which an antigen from V. cholerae is attached to a protein carrier. Such conjugated vaccines are known to induce a stronger T cell immune response, generally leading to better and longer lasting protection. They could be used to immunize infants, for whom the oral vaccine is not licensed, through routine vaccination programs. They may also offer better protection for young children, in whom the oral vaccine is “least efficacious,” Lynch says. IVI just finished phase 1 trails for a conjugate vaccine in adults and is seeking funds for phase 2 studies in choleraendemic regions. All of that is good news for cholera control—but scientists and public health workers keep stressing that the real solution to preventing cholera is clean drinking water and better sanitation and hygiene. That is a tall order, however, says Abi Kebra Belaye, an MSF coordinator working in Zimbabwe—so for the foreseeable future, “we are pushing for more vaccines.” j
By Elisabeth Pain S 1 MARCH 2024 • VOL 383 ISSUE 6686 941 , cientists in France are reeling after the government announced last week a €904 million cut to this year’s budget for research and higher education. The cut is part of a broader €10 billion savings package, which the government says is necessary for the country to limit its deficit in the face of dwindling economic growth since the budget was passed in December 2023. But scientists say the research sector is bearing a disproportionate share of the pain. Under the planned cut—which represents a 2.8% reduction in this year’s higher education and research budget—funding for national research organizations such as CNRS and the National Research Agency, which funds competitive research, will be reduced by €383 million across all disciplines. Universities are set to lose €80 million for teaching and research, and funding for student support measures will be reduced by €125 million. The higher education and research ministry has reassured scientists that public institutions would continue to receive funding for their routine operations and that staff salaries for researchers and existing commitments for student support will be preserved. And despite the cuts, a spokesperson says the ministry’s budget is still higher than in 2023. Nonetheless, the move “comes as a surprise,” says Valérie Masson-Delmotte, a climate scientist from the Pierre-Simon Laplace Institute, who worries the budget cuts will reduce opportunities for early-career scientists in particular. In a statement on 26 February, France Universités, which represents all universities in France, expressed “deep concern” about the impact of the cuts. Initiatives to protect the environment and curb climate change are also facing a €2.2 billion reduction. Despite the environmental crisis, climate policy and funding for research and education “are used as mere budgetary adjustment variables by our leaders,” says Julien Gossa, a political scientist at the University of Strasbourg. “This leaves us very little hope.” j y PHOTO: GENUS Research and education to lose almost €1 billion y g SCIENCE science.org Budget cuts alarm French scientists y Pigs that were gene edited to make them resistant to a deadly virus look and taste like normal swine. EUROPE g sugar, and Revivicor aims to sell meat from GalSafe pigs to this specialized market. FDA more recently gave less formal endorsements to five pigs that had been CRISPR-edited by a Washington State University team and a line of cattle edited by Acceligen Inc. to have short hair to better withstand heat. But neither received full approval for human consumption or is being produced at a commercial scale: The pigs received an “investigational food use authorization,” which took 2 years and more than $200,000 to obtain, and two short-haired cattle and their future offspring were given a “low risk determination” for marketing. In both cases, the introduced changes occur naturally in the animals. The CD163 modification used to protect against PRRS could well occur naturally but has never been observed in pigs, creating higher hurdles for FDA clearance, says Clint Nesbitt, a molecular biologist who oversees regulatory affairs at Genus. As a result, he says, “We have to go through the full, complete review system at FDA. There are no shortcuts for us.” Still, he says, Genus has made “good progress” with the agency. The challenging U.S. regulatory environment for gene-edited food animals was on the agenda of a National Academies workshop this week. Other countries are less restrictive. Regulators in Colombia in October 2023 indicated that because the Genus pigs do not involve transgenics, they will treat the swine the same as conventionally bred animals. The firm is also seeking approval in China, the largest consumer of pork. Nesbitt says it will take time for producers to breed them into their herds. “Nowhere on the planet is it going to be a light switch, where suddenly everybody’s got the edited pigs,” he says. “It’s going to be much more like a dimmer switch. … And we still have to have a lot of conversations about market acceptance.” j p team led by Randall Prather at the University of Missouri reported it could make pigs resistant to PRRS by using CRISPR to disable a receptor, CD163, on pig cells that the virus uses to establish an infection. Now, Genus has translated “proof-ofconcept work to a commercial scale,” it reports in the February issue of The CRISPR Journal. Scientists at the company used CRISPR to modify early embryos in four lines of pigs that are used in commercial production of pork. By implanting the edited embryos into females, then breeding the progeny, they created lines with both their copies of the CD163 gene disabled. Rodolphe Barrangou, a food scientist at North Carolina State University who is also editor-in-chief of The CRISPR Journal, says the study is the “end of the beginning” of bringing gene-edited livestock to the wide market because so many farmers will likely want PRRS-resistant pigs. “It’s not just a nice study in a nice model,” Barrangou says. “It’s actually doing it in the real world.” Vaccines exist for PRRS but they lack the 100% protection seen with the gene edit. Prather, whose university holds patents on this modification and has a licensing agreement with Genus, says the CRISPR edit has benefits beyond reducing financial losses in the pork industry. The virus, he says, threatens food security and creates “psychological and emotional issues” for producers that have to euthanize the sick pigs. “CD163edited pigs are a solution.” FDA has so far formally approved two genetically modified food animals, but neither is widely consumed. One is a salmon that has a gene from another fish species and grows faster, but consumer concerns have limited sales. The second, known as the GalSafe pig and made by Revivicor, had DNA inserted to cripple a gene for a sugar molecule on the surface of its cells. Some people have mild to severe allergic reactions to this
NE WS FEATURES p g y y g TAKING THE STAND For scientists, going to court as an expert witness brings risks and rewards y , L ate last year, the sound of scientific argument echoed through a New York City courtroom packed with legal and financial experts. Studies from top epidemiology journals flashed onto large screens, as lawyers debated their statistical power and whether their conclusions rested on “cherry-picked” data. Billions of dollars were at stake. The scientists themselves were absent, and attorneys argued on their behalf. But the crucial issue was whether some of the scientists would be allowed to appear at a future trial, where they would tell jurors that children had developed autism 942 1 MARCH 2024 • VOL 383 ISSUE 6686 By Dan Charles or attention-deficit/hyperactivity disorder (ADHD) as a result of exposure to the painkiller acetaminophen, often sold as Tylenol, while still in the womb. Five researchers from Columbia University, the Baylor College of Medicine, the Albert Einstein College of Medicine, and other prominent institutions had submitted reports arguing that acetaminophen’s links to autism and ADHD are real. They’d been paid by lawyers for the plaintiffs, who included parents alleging their children had been harmed by the painkiller. But, “These scientists are not professional witnesses,” plaintiffs’ attorney Ashley Keller told the court as he displayed their faces on a screen. “They care deeply about public health.” The opposing side had its own scientists—an additional half-dozen of them, with equally illustrious academic credentials, paid by companies that make or sell acetaminophen. U.S. District Judge Denise Cote played the role of all-powerful peer reviewer. She had to decide whether the plaintiffs’ expert opinions were based on “reliable principles and methods,” and thus admissible in court. It was a pivotal issue; if Cote ruled against admitting the experts for the plaintiffs, their case could collapse. As the hearing science.org SCIENCE
N E WS FOR MANY academics, life as an expert witness begins with a lawyer’s recruiting pitch, often unexpected and sometimes unwelcome. Brent Wisner, a lawyer in Los Angeles who often sues pharmaceutical or chemical companies, says about half of the scientists he recruits ultimately turn him down. That was Beate Ritz’s initial impulse. When approached to testify against the makers of glyphosate—on the side opposite Mucci—the University of California (UC), Los Angeles epidemiologist says her first reaction was, “No, I don’t want to do this. I have enough to do.” “Attorneys, by their nature, want to polarize things. … And in my experience, y.” things are sort of gray.” y g THOSE WHO SAY yes to becoming an expert 1 MARCH 2024 • VOL 383 ISSUE 6686 943 , witness describe a mix of motives. Cristian Tomasetti, a mathematician at the City of Hope Cancer Center, saw testifying on behalf of Bayer in the glyphosate case “as another way to help change how cancer causation is understood.” Tomasetti’s research suggests cancer is caused not just by genetic or environmental factors, but also by mutations that occur randomly. Fombonne says he ultimately decided to take the stand in defense of vaccine safety for the sake of public health. He saw vaccination rates declining because of unfounded concerns that vaccines caused autism. In some cases, serving as an expert witness can be professionally rewarding, says Christopher Higgins, an environmental engineer at the Colorado School of Mines who has testified about the sources of con- y Eric Fombonne, a specialist on autism at Oregon Health & Science University, also initially resisted requests, more than a decade ago, to testify against claims that vaccines cause autism. “I had no experience with litigation. And I’m a bit more reserved as a person,” he says. Frequently, there’s a fear that “you’ll be seen as selling out,” Swan says. “It’s not looked on very favorably by a lot of people” in the scientific community. And some expert witnesses run into problems with their employers, especially if their testimony draws the ire of powerful political or business interests (see sidebar, p. 945). Some scientists also worry taking sides in litigation will force them to present onesided interpretations of the evidence. “The more you study and construct arguments and think through your arguments, it reinforces the position you’ve taken,” says David Eastmond, an environmental scientist who recently retired from UC Riverside. Eastmond worked briefly as an expert witness, but found the adversarial process uncomfortable. “Attorneys, by their nature, want to polarize things, so that things become more black and white. And in my experience, things are sort of gray,” Eastmond says. y David Eastmond, environmental scientistt Social pressures can also come into play, says David Sedlak, an environmental engineer at UC Berkeley. “You hang out with the lawyers for many hours. You’re having meals and socializing with them. You’re part of that team. Your human nature is, you’re going to want to please them, by telling them what they want to hear.” Sedlak tells colleagues who are considering work as expert witnesses to keep some distance from their legal team, for the sake of their reputations. “Your job is not to spin the facts,” he tells them. Lawyers care most about how facts fit their legal arguments, he says, but “for scientists, the facts are important, and that’s the end of the story.” For some scientists, the rewards simply aren’t worth the risks. Jane Hoppin, an epidemiologist at North Carolina State University who studies the health effects of chemical exposures, doesn’t work for litigants because it might prevent her from serving on government advisory panels. “If you take money from anybody besides the university or the federal government, basically you can’t play” because of concerns about conflicts of interest, she says. In other cases, scientists disagree with the legal arguments they’ve been asked to support. Hugh Taylor of the Yale School of Medicine is the co-author of a “call for precautionary action” on acetaminophen use during pregnancy. But he turned down invitations to work with the lawyers suing companies that sell the drug. The evidence so far is a “warning,” he says, “but to accuse somebody of doing something wrong, that we can sue them over it, I think is wrong. I don’t think the level of evidence ever rose to that.” g SCIENCE science.org I wasn’t going to say this, who was going to say this?” p a prompt decision. closed, Cote promised p academic firepower brandished in The academ 2023 federal court hearthat 7 December Decem unusually impressive. But sciing was unu regular guest in U.S. courtrooms. ence is a regu Hydrologists and toxicologists testify routinely about tthe sources and consequences of groundwater groundwat contamination. Structural engineers assign blame for collapsed buildings. In criminal cases, scientists explain DNA evidence, or the limitations of prosecutorial tools such as fingerprints or eyewitness identification. Lawyers often hire technical specialists from consulting firms who have made a career out of serving as an expert witness. But when the stakes are high, and the science is crucial—as in the acetaminophen case—they often prefer to bring in university professors. It’s an unusual, and often taxing, role for most academics, and Science set out to learn what it is like, interviewing both scientists and the lawyers who hire and question them. Academics who have served as expert witnesses say the experience comes with a complicated mix of rewards and risks. The work sometimes involves depositions and trials that can last days, weeks, or months. Cross-examinations can be hostile and challenging. The work can be lucrative: Some experts in the acetaminophen case charged more than $600 per hour. But it is haunted by the specter of science for hire, of expertise distorted by the lure of easy money. And those accusations, researchers say, can be emotionally bruising and, potentially, professionally damaging. “It was a tough experience,” says Lorelei Mucci, an epidemiologist at Harvard University’s T.H. Chan School of Public Health (HSPH) who 6 years ago testified on behalf of the company Monsanto, now owned by Bayer. The firm was fighting claims that its weed killer glyphosate, also called Roundup, causes non-Hodgkin lymphoma. Facing hostile questioning on the witness stand, Mucci says, “was really one of the most challenging things I’ve experienced in my professional life.” Still, some researchers feel an obligation to share their expertise within the justice system. “It was absolutely an ethical responsibility,” says epidemiologist Shanna Swan of the Icahn School of Medicine at Mount Sinai, who was among the first to recognize the harmful effects of diethylstilbestrol (DES), a synthetic hormone once commonly prescribed during pregnancy. She decided to testify in cases against DES manufacturers, she says, because “if
NE WS | F E AT U R E S THERE ARE TRIALS where science speaks with a single voice. Charles Weaver, an expert on human memory at Baylor University, often takes the stand to explain that the memories of eyewitnesses are fallible. He’s usually the only academic scientist testifying. “There’s really an emerged consensus” in this field, Weaver says. “There’s really not another side” that’s supported by data. Even if the science isn’t clear cut, there’s usually a dominant scientific view on one side, says Andrew Jurs, an expert on legal evidence at Drake University’s Law School. “Then the other side has to get an outlier.” Cases in which top scientists end up clashing are “unusual,” he says. In those exceptional, but often important, cases, the opposing experts sometimes reflect existing debates in the scientific community. Ritz says, for instance, that epidemiologists who specialize in the genetic causes of cancer are disinclined to attribute it to environmental exposures. They often testify for the companies in cases involving exposure to chemicals. The opposite is true for experts like Ritz, who focus on environmental factors and tend to testify for plaintiffs in those cases. On the whole, though, Swan says the dominant culture of science tends to discourage researchers from taking the side of plaintiffs, because their claims are somescience.org SCIENCE , Mucci charged $350 per hour; Ritz, like several experts for the plaintiffs, earned $500 an hour for reviewing documents and preparing, but $5000 per day when testifying at trial. Both spent hundreds of hours on the case, testifying in both federal and state courts. They had plenty of company. Scientists from Boston University, the City of Hope Cancer Center, UC Berkeley, Michigan State University, Columbia University, and McMaster University ended up testifying for and against the claim that glyphosate causes non-Hodgkin lymphoma. Neither Ritz nor Mucci had worked as expert witnesses before, and they had little inkling of what awaited them. Academic life does prepare a scientist for some aspects of litigation. “We’re used to having our science attacked,” says Jamie DeWitt, director of the Environmental Health Sciences Center at Oregon State University, and an experienced expert witness in cases involving per- and polyfluoroalkyl substances, long-lasting chemicals used to make nonstick coatings and stain-resistant fabrics. In litigation, though, the hostility is overt, and questions quickly move past data and methods to focus on a scientist’s motives and biases. “What they’re trying to do is show that you are a shoddy scientist,” Ritz says. “And that is really hard to take. You have to have a very good sense of yourself, in order to not feel denigrated as a professional.” y 1 MARCH 2024 • VOL 383 ISSUE 6686 Beate Ritz, University of California, Los Angeles y g 944 “If they get really mad at you because they cannot trip you up on the science, they try to paint you as a hack.” y lions of dollars hung in the balance, Ritz and Mucci ended up on opposite sides. Ritz ultimately agreed to work with the plaintiffs who were suing Bayer, whereas Mucci worked with the company. Each says encounters with their respective lawyers helped allay their fears. As Ritz describes it, the plaintiffs’ lawyer “was very respectful and said, ‘We would never tell a scientist what to say. That’s the worst thing you can do.’” Mucci, for her part, says she came to believe Bayer’s lawyer “of course was working for the company, but I felt that I could trust what he was telling me. And that he valued the fact that I would approach things independently.” Both reviewed the scientific literature on glyphosate before agreeing to take on the case. Ritz found clear evidence of a link between glyphosate and non-Hodgkin lymphoma, whereas Mucci came to believe the opposite. Ritz relied on an array of “case-control” studies that compared people who’d devel- For Mucci, the stress reached its peak while being cross-examined by Wisner, the lawyer for the plaintiff. “I came at her pretty hard,” Wisner recalls. “Because I thought she was the most important witness for the defendants.” “It felt very adversarial,” Mucci says. “I tried to focus on my breathing, focus on the science, and tried to disassociate from what felt like a lot of anger being thrown at me. But it was very hard.” Wisner says Mucci’s discomfort was visible. “She came across as scared,” he says. “She kind of fell apart.” Mucci also failed to convince the jury, which in that trial decided that glyphosate had caused the plaintiff ’s cancer and awarded hundreds of millions of dollars in damages. “I really took it personally,” Mucci says. “I felt that I had failed.” She also faced attacks outside the courtroom. Activists sent out postcards carrying her photograph, condemning her for testifying on behalf of Bayer. Mucci got one, and so did colleagues at HSPH. The glyphosate litigation continues. In 19 trials held so far, Bayer has prevailed in 10 of them, and the plaintiffs have won nine times. g IN THE GLYPHOSATE litigation, in which bil- oped the lymphoma with those who had not. The studies showed the people with cancer were more likely to report exposure to glyphosate than those in the control group. Mucci, in contrast, gave more credence to a large “prospective cohort” study that has monitored the health of tens of thousands of agricultural workers and pesticide applicators for more than 20 years, and has found no association between glyphosate exposure and cancer. Each dismissed the other’s preferred studies as flawed. p taminants in water. “It’s a great way to see the real-world implications of your work,” he says. He adds that in academic life, intellectual debates happen “in bits and pieces,” sandwiched between meetings and rewriting papers. But, “When you get into a deposition, it’s a full-on, 8-hour—I don’t want to say battle of wits, but you have to be paying attention. Having to be on your feet, thinking, is, for me, quite intellectually stimulating. That’s kind of the fun part.” Plus, “The money is good,” Higgins says. “Sometimes it becomes, like, man, I really could do this full time if I wanted to.” The thought passes quickly, though. “I really do enjoy being a professor.” A few hired experts, such as geochemist Avner Vengosh at Duke University, have worked for free in order to show they aren’t just scientific hired guns. Vengosh did, however, accept research funding from environmental groups who successfully sued the Tennessee Valley Authority (TVA) over groundwater pollution near one of the its coal ash ponds. He used the money for studies that uncovered evidence that contamination came from the TVA site. Vengosh published his findings in a peer-reviewed journal. “So when the trial happened and I took the stand, basically I used the paper,” Vengosh says. “I was looking at them and saying, ‘Hey, it’s not me. … That’s the science talking to you.’ I think it was very powerful.”
A witness, then a target O ILLUSTRATION: A. MASTIN/SCIENCE , 945 y 1 MARCH 2024 • VOL 383 ISSUE 6686 y g hearing, Cote opened the proceedings by noting that a key federal rule on expert testimony “has been revised recently to emphasize the court’s gatekeeping role.” The revised rule, which took effect in December 2023, states that judges must be persuaded by a “preponderance of evidence” that an expert’s testimony is based on reliable scientific methods. Otherwise, the testimony should be excluded. IN THE ACETAMINOPHEN Cote embraced that test. She posed detailed questions to Keller, the plaintiffs’ lawyer, as she presented studies showing evidence for an acetaminophen-autism link. When Keller accused the sellers of acetaminophen of trying to “keep pregnant women in the dark” about potential dangers of their product, Cote interrupted and told Keller to stick to facts. “Disinformation is a big issue in our society,” she admonished him. As he left the courtroom after the hearing, Keller looked a little shell-shocked. “I think it’s time for tequila,” he said, to no one in particular. His worries were well placed. Cote took less than 2 weeks to reject the scientific case that the plaintiffs’ experts had laid out. “Their analyses have not served to enlighten but to obfuscate the weakness of the evidence on which they purport to rely,” she wrote. Her decision put an abrupt end to the case, unless it’s appealed and overturned. For now, those scientists will not be appearing in court. j y SCIENCE science.org Both Ritz and Mucci say they’d be willing to work as expert witnesses again. Ritz, in fact, is currently working with attorneys who are exploring a lawsuit targeting the herbicide paraquat, which has been implicated as a cause of Parkinson’s disease. But Ritz recently advised a younger colleague to reject work as an expert witness in a different case. “I warned him,” she says. “I said, ‘You’re too young to get your name tainted.’ Because if they get really mad at you because they cannot trip you up on the science, they try to paint you as a hack.” The colleague decided not to do it. g times hard to prove. “If you’re going out and saying, ‘This causes that’—that’s a pretty hard thing to say in science,” Swan says. “It’s easier to say that more research is needed. There are lots of safe things you can say that nobody would object to.” Personal sympathies and professional loyalties can steer experts to one side or the other. Swan, for example, notes she spent the first 18 years of her career working for California’s health department. “That really instilled in me, ‘How do I protect people’s health?’” As a result, Swan says she’s predisposed to work for plaintiffs who claim harm, rather than companies accused of causing it. Mucci, for her part, says it was the epidemiological data, not the client, that convinced her to work for the company. “It was, for me personally, kind of a tough thing initially to say, ‘I’m working for Monsanto,’” she says. Some acquaintances, she says, “definitely thought that I was on the wrong side.” Professionally, though, she hasn’t felt any negative repercussions. Since the trial, she was promoted to full professor. Carpenter wasn’t worried by the request. “I thought, if they’re just trying to see if it’s r really true that I don’t accept money myself, it’ll take them about half a day to figure that out. I gave them all my invoices,” he recalls. For months, however, Carpenter remained in limbo. Finally, early in 2023, he told his story to a reporter for an Albany newspaper, and the ensuing front-page story got immediate results. A state legislator demanded an explanation from UA, and Ian Rosenblum, senior vice chancellor of the State University of New York system, summoned Carpenter and university officials to his office. Ac According to Carpenter, Rosenblum “basically said, ‘You will resolve this, and you’re not going home until you do.’” On 21 February 2023, 9 months after Carpenter was barred from campus, university officials told him he could go back to work. There was no further disciplinary action. Carpenter did agree to sign an agreement laying out “safeguards” to prevent his work as an expert witness from interfering with his academic responsibilities. Describing the experience, Carpenter sounds unperturbed. And in a statement, university officials declared “our full commitment to unfettered academic freedom.” But a report by the University Senate, which represents faculty members, condemned UA’s actions. “The community at large needs expert testimonies from reputable researchers,” it wrote, adding that the university’s behavior “plays directly into the hands of the external entities that would profit from silencing them.” —D.C. p e Unin 27 May 2022, administrators at the avid versity at Albany (UA) summoned David ’s Carpenter, director of the university’s Institute for Health and the Environment, to an unscheduled meeting. They told Carpenter he was the target of a disciplinary investigation, and offered him the option to resign. Carpenter refused. They then told him he would be on barred from campus while the investigation continued. University officials didn’t explain what prompted the investigation, and they still penter refuse to comment on the case. But Carpenter s work as says the investigation was triggered by his cademics, joinan expert witness—illustrating that for academics, ing litigation comes with risks. For the past 2 decades, Carpenter has testified frequently on behalf of plaintiffs who have sued companies such as Monsanto, now owned by Bayer, for exposing them to polychlorinated biphenyls, carcinogenic compounds once widely used in industrial and consumer products. “I was on the debating team in high school, and I loved it,” Carpenter says. His background made him “feel pretty confident in myself,” and able to hold his own in the courtroom. Three months before Carpenter met with university administrators, he learned that a law firm representing Bayer had filed a request for copies of financial records relating to his work as an expert witness. Carpenter often tells jurors that he’s not doing it for the money. The payments go instead to his staff or graduate students. In a typical year, his witness gigs bring in about $200,000 for his research program.
I NS I GHTS and AMPA receptor (AMPAR) accumulation at synapses. Importantly, SynGAP has been recognized as a substrate for calcium/ NEUROSCIENCE calmodulin–dependent protein kinase type II (CAMKII), which is the central signaling kinase in several forms of synaptic plasticity, including LTP. Phosphorylation of SynGAP by CAMKII enhances its enzymatic activity and reduces its affinity for PSD95. Consequently, neuronal activity causing calcium influx through NMDARs, as occurs during LTP induction, leads to dispersion of Synmemory as well as neuronal development (9, By Daniel Choquet1,2 GAP from the postsynaptic density (PSD) 10). These multiple roles have led to conflict(1, 11), which is a protein-dense region at ing theories about the function of SynGAP. he synaptic Ras/Rap guanosine trithe postsynaptic membrane where PSD95, SynGAP influences excitatory synaptic phosphatase (GTPase)–activating proNMDAR, and AMPAR accumulate in front of transmission through N-methyl-D-aspartate tein (SynGAP) plays substantial, albeit neurotransmitter release sites (12). (NMDA) receptors by modulating the mistill elusive, roles in synaptic function The exact mechanism responsible for togen-activated protein kinase (MAPK)–ex(1). SynGAP has attracted considerable AMPAR recruitment at synapses during LTP tracellular signal-regulated kinase (ERK) attention owing to its pivotal role in remains elusive but involves diffusion trapsignaling pathway (8). The GAP domain of modulating excitatory glutamatergic synapping of surface AMPARs at synapses and SynGAP stimulates the GTPase activity of tic transmission and neuronal development increased AMPAR exocytosis (12). Activitysmall GTPases, such as RAS and RAP. Howand because loss-of-function mutations in the dependent trapping of AMPARs at synapses ever, RAS and RAP have opposing roles in SYNGAP1 gene account for up to 1% of genethas been proposed to arise from CAMKIIsynaptic function, blurring the understandically based intellectual disabilities. SynGAP induced phosphorylation of transmembrane ing of the role of the GAP domain (1). comprises two primary functional domains: AMPAR regulatory proteins (TARPs) and Long-term potentiation (LTP), a form the GAP domain and the C-terminal domain their consequent increased binding to PSD95 of synaptic plasticity that is a core cellular (CTD). The GAP domain negatively regu(12). This finding, together with the activitymechanism for learning and memory, inlates small G protein signaling, which may dependent dispersal of SynGAP, has been volves NMDA receptor (NMDAR) activation be crucial for activity-dependent changes in integrated into the “slot hypothesis” synaptic strength, whereas the CTD (13) of synaptic plasticity, in which binds to postsynaptic density protein the PSD harbors binding sites (slots) 95 (PSD95), but the functional conseSynGAP in synaptic potentiation for AMPAR (presumably PSD95) quences of this are unclear. On page Wild-type SynGAP that are in part occupied by SynGAP 963 of this issue, Araki et al. (2) reIn resting basal conditions, part of the PSD95 “slots” in the postsynaptic when the synapse is at rest. The Synveal that contrary to common belief, density are occupied by SynGAP. This prevents accumulation of AMPAR and GAP-PSD95 complex undergoes liqGAP domain activity is dispensable inhibits RAS activity, limiting synapse growth from actin polymerization. Upon strong synaptic stimulation, SynGAP is dispersed, allowing diffusion uid-liquid phase separation, which for many SynGAP functions and that trapping of AMPAR and relief of RAS inhibition, which results in synapse is necessary for its synaptic localthe CTD is important for the plaspotentiation and growth. ization (14). Upon neuronal activity ticity of synaptic transmission. This and CAMKII-dependent phosphorysuggests that potential therapeutics Basal Potentiated lation of TARPs and SynGAP, some targeting the GAP domain should be TARP slots are freed, allowing for diffusion reconsidered. trapping of AMPARs and increased Discovered in 1998 (3, 4), SynGAP AMPAR Active RAS synaptic transmission (1, 13). This is expressed in neurons and localized PSD95 Actin hypothesis has mixed acceptance; at excitatory synapses. It has various Inactive RAS on the one hand, the GAP function structural isoforms resulting from SynGAP of SynGAP has been proposed to be different promoter usage and alterinstrumental for AMPAR exocytosis, native splicing (5–7). These isoforms whereas on the other hand, TARPpotentially contribute differently to GAP-deficient SynGAP* g8 phosphorylation is proposed to SYNGAP1-associated cognitive disWhen GAP activity of SynGAP is blocked (SynGAP*), synapses are larger in basal conditions owing to alleviation of RAS inhibition but are not functionally disrupt PSD95 phase separation, orders. Loss-of-function mutations potentiated because SynGAP* still binds PSD95. Upon neuronal activity, leading to reduced AMPAR clusterin the SYNGAP1 gene, which arise SynGAP* disperses, resulting in diffusion trapping of AMPAR and functional ing (15). This conflicts with the idea de novo, are associated with intelsynaptic potentiation. of TARP-g8 mediating AMPAR diflectual disability, autism, and epiBasal (potentiated size) Potentiated fusion trapping at synapses in an lepsy, owing to haploinsufficiency (1). activity-dependent manner. The resulting disruption of SynGAP The study of Araki et al. chalfunction impairs normal synaptic lenges existing ideas about SynGAP’s plasticity (8), affecting learning and function and provides support for 1Interdisciplinary Institute for Neuroscience, the slot hypothesis. The authors elGAP-deficient SynGAP* University of Bordeaux, CNRS, UMR 5297, egantly show, using in vitro and in F-33000 Bordeaux, France. 2Bordeaux Imaging vivo approaches in mice, that expresCenter, University of Bordeaux, CNRS, INSERM, AMPAR, AMPA receptor; PSD95, postsynaptic density protein 95; SynGAP, synaptic Ras/Rap sion of a SynGAP mutant devoid of US4, UAR 3420, F-33000 Bordeaux, France. guanosine triphosphatase (GTPase)–activating protein; TARP, transmembrane AMPAR regulatory protein. Email: daniel.choquet@u-bordeaux.fr GAP function (SynGAP*) can sustain PERSPECTIVES Shifting rules in a brain disorder The mode of action of a synaptic protein is challenged y g y , science.org SCIENCE y 1 MARCH 2024 • VOL 383 ISSUE 6686 g 950 p T
By Lauren Sumner-Rooney T D.C. receives support from European Research Council (ERC) grant Dyn-Syn-Mem. 10.1126/science.adn8707 SCIENCE science.org Leibniz Institute for Evolution and Biodiversity Research, Museum für Naturkunde, Berlin, Germany. Email: lauren. sumner-rooney@mfn.berlin 1 MARCH 2024 • VOL 383 ISSUE 6686 951 , AC KN OWL EDG M ENTS y he extent to which evolution is predictable is a frequent flashpoint for debate. Do organisms simply stumble around the adaptive landscape, or are they “channeled” along certain paths or trajectories? The emergence of convergent traits, whereby the same phenotypes evolve from different origins, spotlights this question. However, it is notoriously difficult to answer, particularly at macroevolutionary scales. On page 983 of this issue, Varney et al. (1) characterize “critical junctions” as the moments in evolutionary time when the trajectory toward one of several observed phenotypes is set, using the visual systems of chitons, a class of benthic marine mollusk. Their findings highlight an apparently crucial prerequisite to vision and a fundamental divide that appears to predate the evolution of either eyes or eyespots, which implicates a strong role for path dependence in the origin of complex traits over geological timescales. The general body plan and ecology of chitons have remained relatively stable for more than 300 million years, but they still exhibit a broad range of adaptations and modifications. Some chitons have visual systems comprising dozens, hundreds, or even up to hundreds of thousands of units that are spread across the surface of the dorsal shell plates in a network that expands continuously over the life span of the animal (2, 3). These visual units can take one of two forms in different species: shell eyes, which have an aragonite lens covering a retina that is capable of resolving images (4–6), or eyespots, which are smaller, more numerous, and generally lack a distinct lens (7, 8). Whether the eyespots (individually or as a network) are capable of image formation remains unclear, but they mediate defensive responses to shadows and the alignment of the body with darker areas of their environment (8). Unlike most molluscan shells, chiton valves are stuffed with nerves, which thread through them in dense networks of channels. At the surface sit tiny sensory organs called aesthetes, which have been implicated in chemo-, mechano-, and pho- toreception (9–12). These aesthetes are thought to be a precursor for the evolution of the more elaborate eyespots and shell eyes, through both enlargement and the addition of components that confer new functional abilities, such as pigmentation and lenses. Previous work suggested that eyespots represent an intermediate step between aesthetes and shell eyes (8). Although this at first appears to be a parsimonious explanation in line with theoretical expectations for eye evolution (13), the phylogenetic distribution and composition of the eyes and eyespots do not lend strong support to this stepwise hypothesis. Evidence presented by Varney et al. further demonstrates multiple, separate, and recent origins of eyes and eyespots (14), raising the fascinating question, Why do some lineages evolve eyes and others eyespots? Varney et al. explored two characteristics of the aesthete networks: aesthete density at the shell surface and the number of slits in the anteriormost shell valve, where efferent nerves coalesce and connect to the visceral nervous system. They found that although increased aesthete density always predated or co-occurred with the elaboration of aesthetes to visual organs, this was true for both shell eyes and eyespots. However, the number of slits in the anterior valves was consistently higher in lineages that lead to the simpler eyespots than in those that lead to eyes. In a reconstructed evolutionary history (phylomorphospace), the pathways to the two visual systems appear clearly separated, highlighting increased slit numbers as an empirical example of a critical junction in their evolutionary path (see the figure). These results are intriguing. The insertion slits represent the connection of the shell pore network to the surrounding body, and their complexity may be related to signal organization and efficiency. One tempting possibility is that the increase in insertion slits provides capacity for directionality or even spatial resolution across the network of eyespots, even if eyespots cannot achieve this individually. An increased number of slits could reflect more potential sites of projection from these nerves to the chiton medullary cords, possibly providing a basis for the preservation of coarse spatial information in very rough analogy to the in- y g 9. 10. 11. 12. 13. 14. 15. T. R. Gamache et al., J. Neurosci. 40, 1596 (2020). Y. Araki et al., Science 383, eadk1291 (2024). J. H. Kim et al., Neuron 20, 683 (1998). H. J. Chen et al., Neuron 20, 895 (1998). Y. Araki et al., eLife 9, e56273 (2020). M. Kilinc et al., eLife 11, e75707 (2022). A. C. McMahon et al., Nat. Commun. 3, 900 (2012). G. Rumbaugh et al., Proc. Natl. Acad. Sci. U.S.A. 103, 4344 (2006). J. P. Clement et al., Cell 151, 709 (2012). M. Birtele et al., Nat. Neurosci. 26, 2090 (2023). Y. Araki et al., Neuron 85, 173 (2015). L. Groc, D. Choquet, Science 368, eaay4631 (2020). W. G. Walkup IV et al., eLife 5, e16813 (2016). M. Zeng et al., Cell 166, 1163 (2016). M. Zeng et al., Neuron 104, 529 (2019). Key traits set the course of de novo visual system evolution in marine mollusks y 1. 2. 3. 4. 5. 6. 7. 8. Critical junctions in evolution g RE F ER E NC ES AND NOTES EVOLUTION p normal activity-dependent synaptic dispersal, AMPAR recruitment at synapses, LTP, and learning—even in homozygous mouse Syngap1* mutants (see the figure). This finding contrasts with the lethal phenotype observed when Syngap1 is deleted in mice. Notably, Araki et al. observed that SynGAP* does not support activity-dependent spine enlargement. On the contrary, the basal spine size in rat neurons expressing SynGAP* or in homozygous Syngap1* mice is enlarged, but the spontaneous synaptic current amplitude remains unchanged. This supports the idea that the GAP activity may be important for changes in spine size but does not affect AMPAR content in synapses. This is also important because spine size is commonly used as a surrogate measure of synapse strength. Indeed, structural synaptic plasticity is often confounded with functional synaptic plasticity. The study of Araki et al. is another example of the dissociation between functional and structural synaptic plasticity. It is fascinating that the authors discovered five carriers of GAP-disabling SYNGAP1 mutations that were not associated with any diagnosed neurological or cognitive disorder. Altogether, this probably calls for reevaluation of the understanding of SynGAP in synaptic plasticity and cognition. These findings shift the focus from the enzymatic activity of SynGAP to its structural properties and interactions at the PSD. There are also implications for developing treatments for SYNGAP1 mutation–associated disorders. Future therapies might need to focus on preserving SynGAP’s structural functions rather than solely targeting its GAP activity. Conversely, the role of SynGAP in early neuronal development (10) indicates that SYNGAP1 mutation–associated brain disorders may also arise through nonsynaptic mechanisms. Thus, the roles of SynGAP need to be deciphered by using tools that can acutely regulate its functions to distinguish its involvement in neuronal development and synaptic function. j
I NS I GHTS | P E R S P E C T I V E S why chitons evolve vision at all; given the overlap of the eyeless chiton morphospace with that of both visual system types, the observed fates are accessible rather than inevitable. These outstanding questions do not diminish but rather emphasize the potential impact of identifying critical junctions in directing future research on the evolution of complex traits. The findings of Varney et al. represent a promising step toward understanding the enigmatic visual systems of these understudied organisms and consolidate chitons as an important evolutionary model. j R E F E R E N C ES A N D N OT ES L.S.-R. receives support from the Deutsche Forschungsgemeinschaft Emmy Noether Programme (SU1336/1-1). 10.1126/science.ado1700 In chiton shells, the number of insertion slits, where efferent nerves coalesce and connect to the visceral nervous system, acts as a critical junction in the evolution of either eyes or eyespots. Chiton lineages that evolved visual systems exhibit a higher density of sensory organs called aesthetes, but the type of visual system (eyespots or shell eyes) that evolved was constrained by the number of slits on the anteriormost shell valve. Critical junction Shell valve Girdle Insertion slit Eyespot Aesthete Posterior 952 1 MARCH 2024 • VOL 383 ISSUE 6686 Increased slit number science.org SCIENCE , Eye Anterior T he biological activity of a living cell is reflected in the dissipation of heat to its surroundings. However, quantifying heat and cellular activity at the nanoscale has been a challenge (1). The recent development of stochastic thermodynamics (2) has brought access to measuring the energetics and efficiency of microscopic systems, such as cells, through a combination of stochastic theory and high-resolution experimental techniques. On page 971 of this issue, Di Terlizzi et al. (3) report a thermodynamic constraint applicable to nonequilibrium, stationary fluctuations and apply it to determining the heat dissipated by living cells at the nanoscale. Their analysis reveals nonuniform heat dissipation along the equatorial cell contour of red blood cells. The approach may lead to more accurate measurements and a deeper understanding of energy efficiency in living matter, from single cells to whole organisms. The distinction between the motion of living (active) and dead (passive) matter at the microscale is at the core of the genesis of statistical mechanics. Having examined the motion of pollen grains under the microscope, botanist Robert Brown concluded that their lively, zigzag-like motion was not attributable to biological processes (4). His observations triggered Einstein’s microscopic theory describing the statistics of Brownian motion, which is now considered one of the building blocks of statistical mechanics. Most active systems, however, do not move like Brownian particles. For example, the bacterium Escherichia coli exhibits the socalled run-and-tumble motion in which periods of ballistic-like motion alternate with sudden changes in direction of motion (5). Similarly, differentiated living cells are often not optimized to swim like bacteria but execute specific functions, such as metabolism, that result in nonBrownian fluctuating motion. A hallmark of cells with metabolic activity is the consumption of chemical fuel resources, such y Prerequisite Increased aesthete density By Édgar Roldán y g Eyes or eyespots? Nonequilibrium fluctuations reveal nonuniform heat dissipation in living cells y AC K N OW L E D G M E N TS Thermodynamic probes of life g 1. R. M. Varney et al., Science 383, 983 (2024). 2. D. R. Chappell, D. I. Speiser, D. J. Eernisse, A. C. N. Kingston, in Distributed Vision: From Simple Sensors to Sophisticated Combination Eyes, Springer Series in Vision Research, E. Buschbeck, M. Bok, Eds. (Springer, 2023), pp. 147–167. 3. J. D. Sigwart, L. Sumner-Rooney, Biol. Bull. 240, 23 (2021). 4. D. I. Speiser, D. J. Eernisse, S. Johnsen, Curr. Biol. 21, 665 (2011). 5. L. Li et al., Science 350, 952 (2015). 6. N. T. Moseley, Q. J. Microsc. Sci. 25, 37 (1885). 7. M. G. Sturrock, J. M. Baxter, J. Zool. 235, 127 (1995). 8. A. C. N. Kingston, D. R. Chappell, D. I. Speiser, J. Exp. Biol., 221, jeb.183632 (2018). 9. P. Omelich, Veliger 10, 77 (1967). 10. P. R. Boyle, Cell Tissue Res. 172, 379 (1976). 11. L. B. Arey, W. J. Crozier, J. Exp. Zool. 29, 157 (1919). 12. F. P. Fischer, Spixiana 1, 209 (1978). 13. D.-E. Nilsson, Vis. Neurosci. 30, 5 (2013). 14. X. Liu, J. D. Sigwart, J. Sun, Mar. Life Sci. Technol. 5, 525 (2023). 15. D. R. Chappell, D. I. Speiser, J. Exp. Biol. 226, jeb244710 (2023). BIOPHYSICS p sect central complex. This would represent a starkly different approach to achieving spatial resolution compared with species with shell eyes, where the arrangement of neural projections from individual eyes to the medullary cords directly reflects their sampling distributions (15). The findings of Varney et al. suggest a powerful role for evolutionary path dependence, where slit number can irreversibly restrict chitons to one of two fixed visual system types and has done so in four separate origins of vision. If so, this unlocks the exciting possibility of understanding the aesthete and visual systems in fossil chitons and offers a tractable new model for studying constraint and convergence at macroevolutionary timescales. Future work, particularly on the function and distribution of eyespots, will be crucial to testing this assertion. Notably, unlike shell eyes, eyespots are not readily preserved in fixed or fossilized material and their phylogenetic, and phylomorphospace, distribution may therefore be greater than presently appreciated. Moreover, the particular relevance of the anterior valves must be explored to determine whether, and how, the fate of a vast distributed visual network can be so tightly constrained by variation in only one region. Finally, the possible existence and nature of evolutionary triggers that surround this proposed critical junction remain unknown. Other factors that affect anterior slit numbers, and improved data on the sensory and behavioral ecology of different chiton lineages, will help to clarify
y , PHOTO: STEVE GSCHMEISSNER/SCIENCE PHOTO LIBRARY UR y g 953 y 1 MARCH 2024 • VOL 383 ISSUE 6686 g SCIENCE science.org p in the position of a sensing probe (9, 10). perimentally inaccessible, as is the case of as adenosine triphosphate. Although cells Estimating the heat dissipation of a livprobes sensing active fluctuations (such as can convert most chemical energy input ing cell by recording spontaneous fluctuamembrane vibrations of red blood cells). into mechanical work, it is never 100% eftions in the motion of a sensing probe is a Data from three different red blood cell ficient, resulting in energy dissipation to major challenge. One problem is that often assays were studied: optical-tweezer sensthe environment in the form of heat. Unonly partial, coarse-grained information is ing, optical-tweezer stretching, and optiderstanding energy efficiency in biologiavailable (such as the position of a probe), cal microscopy of membrane vibrations. cal processes thus requires extending the whereas several nonequilibrium variables The three platforms yielded consistent theory of nonequilibrium thermodynamics (such as intracellular active forces) remain estimates for the heat dissipation of up to to the nanoscale. inaccessible to experimental measurement. 106 kBT/s for red blood cells (where kB is Research on stochastic thermodynamBoltzmann’s constant, T is the ics has led to universal laws temperature of the environconstraining the performance ment, and s is seconds). This is of small systems (2). For exaround a thousand to a million ample, the second law of thertimes higher than estimates for modynamics was extended to red blood cells depleted of an Langevin stochastic dynamics, energy source, and of the same which describe the fluctuating order of magnitude as the heat motion of cells. For a system dissipation measured from bulk that is not in thermodynamic calorimetry. The variance sum equilibrium, there exists an rule allowed access to uneximbalance between the change plored local heat flux density of entropy—the overall amount along the equatorial cell conof molecular disorder—and tour. Spatially resolved heat disthe entropy that flows to the sipation maps revealed a finite system’s environment. The avcorrelation length of around erage of such an imbalance is The rate of heat dissipation varies along the surface of a human red blood cell. half a micrometer, paving the often called entropy producway toward topographic calorition inasmuch as it is always Some approaches have established lower metric considerations (14) in active matter. positive and thus generated within the bounds for heat dissipation of biological Besides estimating heat dissipation, system. In most experiments with living systems in terms of quantitative measures applications of the variance sum rule are cells, nonequilibrium steady states arise in of the progression (so-called arrow) of time envisaged in the field of inference. It can isothermal (constant temperature) condi(11–13). However, quantifying the arrow of be combined with artificial intelligence tions. For most isothermal steady states, time from noisy biological data is a hercuand machine learning algorithms to exthe rate of entropy production is well aplean task involving large uncertainties. tract unknown parameters from stochastic proximated by the steady-state rate of heat Di Terlizzi et al. show that the steadymodels described by Langevin equations. dissipation divided by the temperature of state rate of heat dissipation can be accuDeveloping reliable estimates in nonstathe environment. rately estimated by simply measuring the tionary processes could provide better unAdvances in experimental techniques variance of the fluctuations of a position derstanding of biological processes such have enabled high-resolution tracking of (such as the center of mass of a Brownian as embryo development, cell differentiation, passive probes interacting with living sysparticle) and a force (such as that exerted and cell division (15). j tems, such as colloidal particles interacting by an optical tweezer). The main result is a with metabolically active cells. Single-cell RE FE REN C ES AN D N OT ES proposed variance sum rule equality. This studies on living auditory hair-cell bundles 1. X. Yang et al., Proc. Natl. Acad. Sci. U.S.A. 118, relates variance of the position, variance of (6), oocytes (7), and red blood cells (8) ree2026786118 (2021). vealed that cellular activity affects fluctuathe impulse (the integral of the force with 2. L. Peliti, S. Pigolotti, Stochastic Thermodynamics: An Introduction (Princeton Univ. Press, 2021). tions in the position of the sensing probe. respect to time), and excess variance that 3. I. Di Terlizzi et al., Science 383, 971 (2024). By comparing the spontaneous motion of quantifies dissimilarities between position 4. R. Brown, Philos. Mag. 4, 161 (1828). the probe with its linear response funcand force fluctuations over time. From 5. H. C. Berg, Sci. Am. 233, 36 (1975). tion to weak external stimuli, these studies their variance sum rule, the authors de6. P. Martin, A. J. Hudspeth, F. Jülicher, Proc. Natl. Acad. Sci. U.S.A. 98, 14380 (2001). revealed a violation of a thermodynamic rived an estimate for the heat dissipation 7. É. Fodor et al., Europhys. Lett. 116, 30008 (2016). principle—Kubo’s fluctuation-dissipation rate in terms of the variance of the force 8. H. Turlier et al., Nat. Phys. 12, 513 (2016). theorem. When in contact with a living and the short-time curvature of the mean 9. E. Roldán, J. M. R. Parrondo, Phys. Rev. Lett. 105, 150607 (2010). cell, the probe’s motion could not be desquared displacement of the position as a 10. É. Fodor et al., Phys. Rev. Lett. 117, 038103 (2016). scribed as thermal, Brownian fluctuations. function of time. In other words, the vari11. É. Roldán, J. Barral, P. Martin, J. M. R. Parrondo, F. Thus, to further determine the in vivo nonance sum rule establishes that deviations Jülicher, New J. Phys. 23, 083013 (2021). equilibrium thermodynamic properties of from Einstein’s theory for diffusion are a 12. A. Bacanu, J. F. Pelletier, Y. Jung, N. Fakhri, Nat. Nanotechnol. 18, 905 (2023). living cells, it is essential to develop tools signature of nonequilibrium. 13. I. A. Martínez, G. Bisker, J. M. Horowitz, J. M. R. Parrondo, that allow one to quantify how much acDi Terlizzi et al. verified their findings Nat. Commun. 10, 3542 (2019). tive matter is away from equilibrium by with theoretical stochastic models, using 14. P. Dolai, C. Maes, K. Netočný, SciPost Phys. 14, 126 measuring only spontaneous fluctuations experimental data from optically trapped (2023). 15. J. Rodenfels, K. M. Neugebauer, J. Howard, Dev. Cell 48, colloidal particles dragged through wa646 (2019). ter. Moreover, they extended the variance Quantitative Life Sciences Section, The Abdus Salam sum rule to situations where one or few International Centre for Theoretical Physics (ICTP), Trieste, Italy. Email: edgar@ictp.it system-probe interaction forces are ex10.1126/science.adn9799
I NS I GHTS | P E R S P E C T I V E S CHEMISTRY Nitrogen cuts in during C–C cross-coupling A catalyst system diverts traditional C–C bond coupling into desired C–N bond formation By Kevin H. Shaughnessy T science.org SCIENCE , 10.1126/science.ado0068 y 1. A. Biffis, P. Centomo, A. Del Zotto, M. Zecca, Chem. Rev. 118, 2249 (2018). 2. A. B. Pagett, G. C. Lloyd-Jones, in Organic Reactions, vol. 100, S. E. Denmark, Ed. (Wiley, 2019), chap. 9, pp. 547. 3. J. F. Hartwig et al., in Organic Reactions, vol. 100, S. E. Denmark, Ed. (Wiley, 2019), chap. 14, pp. 853. 4. D. G. Brown, J. Boström, J. Med. Chem. 59, 4443 (2016). 5. P. Onnuch et al., Science 383, 1019 (2024). 6. L.-C. Campeau, N. Hazari, Organometallics 38, 3 (2019). 7. D. Bhattacherjee et al., Adv. Synth. Catal. 363, 1597 (2021). 8. C. M. Abdulla Afsina, R. M. Philip, P. V. Saranya, G. Anilkumar, Curr. Org. Synth. 20, 308 (2023). y g 1 MARCH 2024 • VOL 383 ISSUE 6686 R E F E R E N C ES A N D N OT ES y 954 Onnuch et al. extended this atom insertion concept by achieving an aminative SM coupling through the three-component coupling of a nitrene (NH) precursor, an aryl halide or triflate (–O3SCF3), and an arylboronic acid. In this reaction, the nitrene unit is introduced during the SM catalytic cycle, resulting in the formation of two new C–N bonds. Successful development of this reaction required overcoming several potential challenges. Modern SM catalysts afford high rates for C–C bond formation. Selective formation of the diarylamine product requires efficient nitrogen insertion before the C–C reductive elimination step. In addition, the nitrene reagent must efficiently react with the arylpalladium(II) intermediate but not with the palladium(0) species responsible for insertion into the carbonleaving group bond. These challenges were overcome by Onnuch et al. through the appropriate choice of the nitrene precursor and palladium catalyst. O-Diphenylphosphinyl hydroxylamine (DPPH) was the optimal nitrene precursor, whereas less electrophilic nitrogen sources were less selective for nitrogen insertion. Sterically demanding, electronrich phosphine ligands were also critical to achieving selective formation of the desired unsymmetric diarylamine product. g Department of Chemistry and Biochemistry, University of Alabama, Tuscaloosa, AL, USA. Email: kshaughn@ua.edu “The nitrogen insertion approach can be used to create new potential drugs from existing drug compounds...” This methodology opens new avenues for the synthesis of pharmaceuticals and other fine chemicals through late-stage functionalization of halogen-containing drug molecules to incorporate arylamine moieties. The nitrogen insertion approach can be used to create new potential drugs from existing drug compounds containing a biaryl structure. No other changes are required to the other steps in the synthesis to introduce nitrogen in this way. Onnuch et al. further demonstrated the potential utility of this approach with a four-component coupling of an aromatic bromide, CO, DPPH, and an arylboronic acid to give an N-aryl benzamide derivative. The nitrogen insertion approach was also applied to the coupling of allyl acetates and arylboronic acids to give N-allylaniline derivatives in modest yield. The nitrogen insertion approach developed by Onnuch et al. represents a groundbreaking new avenue in metal-catalyzed cross-coupling in which heteroatoms can be introduced in traditional C–C bond–forming reactions. There is the potential to apply this approach to other classes of coupling reactions beyond the SM coupling. Although an exciting development, the method must overcome some challenges to become widely applicable. Yields range from modest to high, which likely stems from undesired side reactions. In some cases, the arylboron electrophile and the nitrogen reagent react, leading to undesirable aniline side products. In addition, further optimization is needed to afford consistently high selectivity for the diarylamine product over the biaryl product of SM coupling. Additional development of the catalyst system will open the door for wider application of this method for latestage introduction of nitrogen and other heteroatoms into target molecules. j p ransition metal–catalyzed cross-coupling, which creates a bond between two target molecules, is a workhorse method for synthesizing pharmaceuticals, agricultural chemicals, electronic materials, and other fine chemicals (1). The generation of biaryl compounds by the Suzuki–Miyaura (SM) coupling (2) and of aryl amines by the Buchwald–Hartwig (BH) coupling (3) reactions are two of the most used transformations in the pharmaceutical industry (4). Their prevalence has resulted in biaryl and arylamine structures as common motifs in drug candidates. New methods to prepare these structures will expand the chemical space that can be accessed in cross-coupling reactions. On page 1019 of this issue, Onnuch et al. (5) report a palladiumcatalyzed aminative SM coupling reaction in which the traditional SM coupling of an aryl (pseudo)halide and an arylboron compound is interrupted by the insertion of nitrogen. This results in the formation of two new C–N bonds in one reaction. Transition metal–catalyzed coupling reactions are the most widely used methods for C–C and C–heteroatom bond formation. In these reactions, the metal promotes nucleophilic substitution at an electrophilic carbon bearing a leaving group (6). The nucleophiles are typically organometallic reagents, such as organomagnesium (Grignard compounds), organozinc, or organoboron reagents, and the leaving group is typically a halide or sulfonate. These reactions are highly useful synthetic methods because they can typically be carried out under mild conditions and are tolerant of a wide range of functional groups. The mechanism for these bond-forming reactions involves three basic catalytic steps: oxidative addition of the carbon electrophile, typically a haloaromatic compound, to the metal center; substitution of the nucleophilic coupling partner for the leaving group on the metal; and reductive elimination to form the product. In SM coupling, the nucleophile is an organoboron reagent, which results in the formation of a new C–C bond. In the case of the BH coupling, a C–N bond is formed from a nitrogen nucleophile. One method to expand the scope of these reactions is to introduce additional catalytic steps before the bond-forming reductive elimination step, creating multicomponent reactions. For example, addition of carbon monoxide (CO) to cross-coupling reactions leads to CO incorporation between the electrophilic and nucleophilic coupling partners. In SM coupling, the result is a ketone product (7), whereas amides are prepared through the palladium-catalyzed coupling of aromatic halides, CO, and amines (8). These reactions are highly selective for the carbonylative product because CO insertion into the metal-carbon bond occurs much faster than the subsequent steps of the catalytic cycle.
INSIGHTS p g y P OLICY FORUM y g ENERGY Leverage demand-side policies for energy security y Conventional supply-side approaches overlook potential benefits , By Nuno Bento1, Arnulf Grubler2,3, Benigna Boza-Kiss2, Simon De Stercke4, Volker Krey2,5, David L. McCollum2,6,7, Caroline Zimm2, Tiago Alves1 E nergy security is a top priority for governments, companies, and households because energy systems and the critical functions that they support are threatened by disruptions from wars, pandemics, climate change, and other shocks (1). More often than not, governments rely on policies focused on energy supply to enhance energy security while generally ignoring demand-side possibili- 946 1 MARCH 2024 • VOL 383 ISSUE 6686 ties. Further, the indicators traditionally used to measure energy security are also tilted toward the supply side; this fails to capture the full spectrum of vulnerability to energy crises. Energy security assessments need to reflect the wider benefits of security-related interventions more accurately. To that end, we develop a systematic approach to measuring the energy security impacts of policy interventions that explicitly considers energy demand (buildings, transport, and industry). We determine that demand-side actions outperform conventional supply-side approaches at making countries more resilient. Energy demand links more directly than supply to the satisfaction of critical social functions and human well-being that are at the core of energy security. Yet, demandside perspectives tend to be neglected or underrepresented in analysis and policy debates on energy security. Factors that contribute to this supply-side bias include the traditional sectoral organization of industries and policy institutions along fuels (coal, oil, and gas) and energy forms (electric utilities) as well as the decentralized and multivaried activities characteristic of energy demand (from vehicles to household appliances to manufacturing and more), science.org SCIENCE
An infrared scan of a residential building is used to check thermal insulation and energy efficiency. Building efficiency is key to reducing energy demand. which leads to a multitude of actors and institutional fragmentation. The basic fundamentals of energy systems and markets, where demand and supply are intricately linked, have also not yet risen from vague awareness to a central organizing principle among policy-makers for structuring the energy security discourse. 1 MARCH 2024 • VOL 383 ISSUE 6686 947 , SCIENCE science.org y Leoben, Austria. 4Department of Civil and Environmental Engineering, Imperial College London, London, UK. 5Industrial Ecology Programme and Energy Transitions Initiative, Norwegian University of Science and Technology (NTNU), Trondheim, Norway. 6Energy Science and Technology Directorate, Oak Ridge National Laboratory, Oak Ridge, TN, USA. 7Baker School of Public Policy and Public Affairs, University of Tennessee, Knoxville, TN, USA. Email: nuno.bento@iscte.pt y g 1Instituto Universitário de Lisboa (ISCTE-IUL), DINÂMIA’CET, Lisbon, Portugal. 2International Institute for Applied Systems Analysis (IIASA), Laxenburg, Austria. 3Montanuniversität Leoben, y COMPARING ENERGY SECURITY POLICIES Four stylized policy interventions aimed at enhancing energy security are devised and g FACTORS ENHANCING ENERGY SECURITY Indicators used to measure energy security tend to emphasize supply diversification and substitution, costly storage, and redundancies in energy infrastructure. This overlooks the scale of vulnerability to energy crises; the benefits of energy demand reduction; and the energy cost burden to countries, firms, and households. Meanwhile, demand-side indicators more directly measure the satisfaction of individual needs and well-being because the focus is on access to and use of energy services. Examples of demand-based indicators of energy security include energy intensity of the economy (energy needed per unit of GDP), energy efficiency (the inverse of intensity), energy expenditures, and access to critical energy services (10). However, data availability can present a challenge to operationalizing the use of these indicators (11). Illustrating the importance of including energy demand in energy security analyses, our analysis of Organisation for Economic Co-operation and Development (OECD) countries found a positive relationship [coefficient of determination (R2) = 11%, P = 0.08] between the ratio of energy expenditures to GDP and energy intensity (see fig. S2 in the SM). In other words, countries with higher energy intensity (less energy efficient) tend to face higher energy cost burdens. We also found a robust negative correlation between energy intensity and the Shannon diversity index—a supply-side measure based on the diversity of a country’s energy sources—for a set of 20 countries and macro regions (R2 = 48%, P < 0.0001, in 2014; R2 = 56%, P < 0.001, in 2019; see fig. S3, A and B, respectively, in the SM) (12). Put differently, a discernible trend between higher efficiency and diversification is evident across several countries over the past century (see fig. S3C in the SM). Such analyses, possible only by including demand-side indicators, help in gaining a deeper understanding of the factors that reinforce or jeopardize a country’s supply security. Yet, to our knowledge, such analyses have not been central to the scientific or policy discourses for many years. their effectiveness is compared across a range of security indicators. Each of these aim at the same target, an ~10% change (reduction or reallocation) in total primary energy (i.e., unconverted natural resource inputs, such as coal, oil or gas, uranium, wind, or solar). These interventions are targeted at one of several points along the energy conversion chain: primary (PE), final (FE) (energy converted and delivered to end users—e.g., electricity or refined petroleum in the form of gasoline for vehicles), and useful (UE) (energy actually put to the intended use—e.g., the light resulting from the electricity used by a light-emitting diode light bulb). We use an accounting model based on physical energy flows that first calculates conversion efficiencies throughout the energy system from primary to useful energy for specific end uses (mobility, thermal comfort, etc.). The model then calculates changes backward from useful to final to primary—e.g., reflecting how reduced gas use to provide low-temperature heat (useful energy) would affect the primary energy balance for gas and the corresponding potential to reduce gas imports (see box S2 in the SM for more details about the method and data). The four policies analyzed are import diversification (PE 1), fuel substitution (FE 1), reduction of low-temperature heat demand in buildings (UE 1), and transport electrification (UE 2) (see box S3 in the SM for more details about the policies). An additional, somewhat extreme scenario estimates the impact on energy security of ensuring only the most basic energy services that guarantee critical social functions (CSFs) (minimum thermal comfort in buildings, transport, illumination, etc.). The CSF scenario assesses the ultimate social vulnerability of countries to energy crises and illustrates the upper potential of demand-side policies that is far larger than in the four other scenarios examined. Historical analogies help to put the stylized policy measures into context and to demonstrate the order of magnitude of interventions (see boxes S3 and S4 in the SM). On the energy supply side, Germany’s reduction of imports from Russia since the start of the war in Ukraine is an example of rapid import diversification that involved around a third of primary energy (PE 1). The Brazilian ethanol program illustrates fuel substitution (FE 1) that reached an impact equivalent to 10% of primary energy. On the demand side, Germany’s reduc- p SUPPLY AND DEMAND IMBALANCE The energy security literature describes a plethora of indicators and multi-indicator indexes. However, two-thirds of the indicators and more than 80% of the indexes focus on the energy supply side [see fig. S1 in the supplementary materials (SM)], aligned with the International Energy Agency (IEA) approach to define energy security solely as the security of energy supply (2). In addition, energy security analyses often rely on a small number of indicators, such as import dependency, diversity of energy sources (both produced and imported), or cost of energy imports as a proportion of gross domestic product (GDP) (3–7). In the few studies that also consider demand indicators of energy security [a noteworthy exception being (8)], these metrics are rarely quantified (see box S1 in the SM). Not only is the structure of measures of energy security imbalanced, but the predominant indicators do not reflect the full picture. For example, a reduction in energy demand may leave a country’s import dependence ratio unchanged—by simultaneously reducing both the volume of imports in the numerator and total energy consumption in the denominator. In this case, the unchanged ratio masks a marked reduction in the country’s energy vulnerability—a smaller system being more flexibly satisfied from different sources—as well as benefits for the environment and trade balance. Moreover, important gaps remain in the usage of indicators for energy security assessments. Some studies use scenarios for assessing future energy security (9). Others analyze the evolution of energy security in retrospect (3, 7). To our knowledge, no assessment has yet combined scenario-based and historical analyses to determine the impact on energy security for different policy options. To be sure, demand-side indicators of energy security are neither perfect nor all-encompassing; still, they merit greater consideration for comprehensive energy security assessment.
I NS I GHTS | P O L I C Y F O RU M Impact of the policy interventions on enhancing energy security separately (see the figure) for the average of the 14 countries in the assessment. Fuel substitution leads to the highest impact on only two indicators—the share of nonfossil fuels and import independency—confirming the bias against energy efficiency of these UE 1—Low-temp. heat demand reduction PE 1—Import diversification Index values relative to 200 a preintervention two popular energy security indicators. FE 1—Fuel substitution UE 2—Transport electrification baseline of 100 100 80 Demand measures score best in 8 of the 12 indicators, with transport electrification the most impactful (seven 0 Shannon diversity Compound Shannon indicators). Import diversification is index PE diversity index PE consistently the least effective intervenCompound Shannon tion, despite being the most applied in diversity index PE with Europe as a consequence of the Russian import diversification Import invasion of Ukraine. independency Supply National contexts influence the effects of the policy interventions (see the Demand table and see table S1 and fig. S5 in the SM). Transport electrification enhances Share of Compound nonfossil fuels energy security indicators the most (150 Shannon FE times) and only leads to worsening in 12 cases, whereas fuel substitution more often (29 times) deteriorates energy security, Compound Savings in although it also improves it in 117 cases. Shannon FE primary including electricity energy demand Low-temperature heat demand leads to by source improvements in 137 cases and worsening in 23. Import diversification, although a commonly applied approach by governments, has a relatively muted effect—imSavings in energy Final energy provement in only 19 cases and worsening expenditures/GDP efficiency in nine. Looking at four representative coun% of energy Savings in energy tries more closely (see fig. S6 in the SM), expenditures/GDP expenditures/fossil Japan and Australia (both high-income total PE/GDP economies) show a similar pattern, with FE, final energy; GDP, gross domestic product; PE, primary energy; UE, useful energy. transport electrification being the most effective policy. Meanwhile, Japan and China tions of gas demand—mainly from buildings policy for each country. The choice of indi(both large energy importers) share more (UE 1)—saved 5% of primary energy in 2022. cators followed three criteria: They must similar results than energy exporters such Sustained promotion of electric vehicles in be representative, feasible to calculate, and as Australia and Nigeria. Norway enabled a 10% reduction of primary complementary to each other. For example, energy in 2021, an example of the benefits of four diversity indexes are included to asROBUSTNESS OF DEMAND ACTIONS enhancing transport efficiency through elecsess different configurations of the energy An extensive sensitivity analysis that calcutrification (UE 2). Similarly, the Corporate system (e.g., different importing regions, lates every combination of the 12 security Average Fuel Economy (CAFE) standards in different primary energy carriers, and difindicators (from 1 to 12 indicators in each the US have saved more than 10% of primary ferent structures of energy demand). combination; see fig. S7 in the SM) strongly energy over time (13). Finally, as an example To reach the same goal of changing 10% supports the robustness of our concluof energy demand reduction from reduced of primary energy, the four policies entail sions. For example, there are only 6 of the activities, the COVID-19 response measures very different changes in energy flows at 792 combinations (0.76%) that are posin the US led to a 7.5% decrease in primary different points along the energy conversible to create with five indicators where energy in 2020 (14) (followed eventually by sion chain (see the figure). A 10% change in fuel substitution is the most effective of a rebound back to prepandemic amounts). primary energy (PE 1) required only a 9% the policies in improving energy security. We use statistical data for a represenchange in final energy (FE 1) and only beDemand-side options and particularly tative sample of 14 countries in 2019 to tween a 5% and 3% change in useful energy transport electrification rank first in the simulate the impact of the various policy level (UE 1 and UE 2, respectively), reflectremaining combinations. interventions on national energy security. ing the corresponding conversion losses in Our multidimensional indicator and These countries account for two-thirds of energy systems. The difference is higher for policy modeling framework also allows for global energy use in 2019 and include a diexporting countries (see box S6 and fig. S4 testing alternative policies beyond the four verse mix of high-income and low-income in the SM). Overall, interventions at moredescribed above. For example, when connations as well as energy importers and downstream levels benefit from a leverage sidering a representative energy importer exporters (see SM). We quantify a set of effect by avoiding cascading losses in the nation, such as Japan, fuel substitution 12 indicators of energy security from both successive stages of energy conversions. (FE 1) with hydrogen (also domestically demand and supply perspectives (see box The effects of the four stylized policy inproduced) instead of biofuels leads to a S5 in the SM) to assess the impacts of each terventions for all indicators are presented similar level of impacts on energy security Twelve indicators, five supply-side and seven demand-side, reflect impacts of four policy interventions, each aimed at achieving a 10% reduction in primary energy. Impacts are shown in index values relative to preintervention baseline normalized to 100, with larger values reflecting greater security. y y g y , science.org SCIENCE g 1 MARCH 2024 • VOL 383 ISSUE 6686 p 948
Effect of policy interventions on 12 energy security indicators, in number of countries (n = 14) Shading indicates the number of countries where energy security improved ( ) or worsened ( ) based on the given indicator due to the intervention. Policy interventions appear in decreasing order of performance. SUPPLY INDICATORS UE 2 - TRANSPORT ELECTRIFICATION UE 1 - LOW-TEMP. HEAT DEMAND REDUCTION FE 1 - FUEL SUBSTITUTION PE 1 - IMPORT DIVERSIFICATION 14 –1 Import independency 13 9 13 0 Shannon diversity index PE 8 6 5 0 Compound Shannon diversity index PE 8 6 5 1 Compound Shannon diversity index PE with import diversification 10 8 6 10 Compound Shannon FE 11 3 9 –1 Compound Shannon FE including electricity by source 7 7 9 1 Final energy efficiency 13 14 0 1 % of energy expenditures/GDP 14 13 13 –1 Savings in energy expenditures/ fossil total PE/GDP 12 11 10 –2 Savings in energy expenditures/ GDP 14 14 12 1 Savings in primary energy demand 14 14 –8 1 Total (improved net of worsened) 138 114 88 10 DEMAND INDICATORS Total worsened 12 23 29 9 Total improved 150 137 117 19 FE, final energy; GDP, gross domestic product; PE, primary energy; UE, useful energy. ACKNOWLEDGMENTS The authors thank anonymous reviewers for constructive feedback that substantially improved the manuscript. They also thank M. J. Machado of DINÂMIA’CET-ISCTE for administrative assistance. This research was supported by the EDITS project, which is a collaborative initiative coordinated by the Research Institute of Innovative Technology for the Earth (RITE) and the International Institute for Applied Systems Analysis (IIASA) and funded by the Ministry of Economy, Trade, and Industry (METI), Japan. N.B. and T.A. acknowledge funding from the Sus2Trans project, supported by the Fundação para a Ciência e a Tecnologia (PTDC/GESAMB/0934/2020). D.L.M. acknowledges support from the Laboratory Directed Research and Development Program of Oak Ridge National Laboratory (ORNL), managed by UT-Battelle, LLC, for the US Department of Energy (DOE). The views expressed do not represent those of ORNL/UT-Battelle or US DOE. For data and code, see Zenodo (15). SUPPLEMENTARY MATERIALS science.org/doi/10.1126/science.adj6150 10.1126/science.adj6150 1 MARCH 2024 • VOL 383 ISSUE 6686 949 , CONCLUSIONS Demand-side policies offer clear advantages for energy security improvement across many dimensions, including continuity, affordability, and sustainability. They also have advantages in terms of flexibility. Demand-side policies give more opportunities y SCIENCE science.org assumptions that the needed electricity for transportation comes from domestic renewable sources. If, instead, this electricity is generated from, for example, imported natural gas, the policy would be less efficient compared with other policies. The overall ranking of policy options also holds when looking at key indicators beyond energy security, namely carbon dioxide emissions reductions (see fig. S9 in the SM). For the four archetypal policy cases analyzed, demand-side policies again outperform supplyside policies (0% for PE 1 and –11% for FE 1 against –12% for UE 2 and –13% for UE 1), even if the ranking order of transport electrification over heating demand reduction reverses. The ultimate potential of demandside policies is illustrated in the (extreme demand reduction) CSF scenario (–67%). 1. G7 Ministers of Climate, Energy and the Environment, “G7 Climate, Energy and Environment Ministers’ Communiqué,” joint press release (G7 Ministers’ Meeting on Climate, Energy and Environment, 17 April 2023). 2. IEA, “Emergency response and energy security: Ensuring the uninterrupted availability of energy sources at an affordable price” (2023); https://www.iea. org/areas-of-work/energy-security. 3. P. Gasser, Energy Policy 139, 111339 (2020). 4. B. Kruyt, D. P. van Vuuren, H. J. M. de Vries, H. Groenenberg, Energy Policy 37, 2166 (2009). 5. B. K. Sovacool, I. Mukherjee, Energy 36, 5343 (2011). 6. C. Winzer, Energy Policy 46, 36 (2012). 7. B. W. Ang, W. L. Choong, T. S. Ng, Renew. Sustain. Energy Rev. 42, 1077 (2015). 8. F. Creutzig, Nature 606, 460 (2022). 9. J. Jewell, A. Cherp, K. Riahi, Energy Policy 65, 743 (2014). 10. T. B. Johansson, A. Patwardhan, N. Nakicenovic, L. Gomez-Echeverri, Eds., Global Energy Assessment: Toward a Sustainable Future (Cambridge Univ. Press, 2012). 11. E. Kisel, A. Hamburg, M. Härm, A. Leppiman, M. Ots, Energy Policy 95, 1 (2016). 12. S. De Stercke, “Primary, Final and Useful Energy Database (PFUDB)” (IIASA Models and Databases, 2023); https://iiasa.ac.at/models-tools-data/pfudb. 13. D. L. Greene, J. M. Greenwald, R. E. Ciez, Energy Policy 146, 111783 (2020). 14. US Energy Information Administration (EIA), International Energy Statistics online (2023); https:// www.eia.gov/international/overview/world. 15. N. Bento et al., Auxiliary Supplementary Materials (SM), Zenodo (2024); https://doi.org/10.5281/ zenodo.10573539. y g for all indicators but lower final energy efficiency and lower savings in energy expenditures (i.e., hydrogen increases primary energy use and energy costs). Similarly, rolling out heat pumps instead of insulation (UE 1)—in this case, an active measure in place of a passive one—to reduce energy demand for low-temperature heat for buildings in Japan would not ameliorate the energy security indicators (see fig. S8 in the SM). The variations of the policies tested in the sensitivity analysis confirm the robustness of the order of merit of the interventions: Demandside policies generally have more and higher positive impacts on improving energy security compared with supply-side measures. Assumptions for fuel substitution with biofuels are quite optimistic. For example, not every country has enough available biomass, not to mention the potential land-use conflicts with agriculture and environmental concerns. Yet, even under these assumptions, demand-side policies remain the top choice in most cases. It is also worth noting that the higher scores of transport electrification compared with reducing low-temperature heat demand in buildings benefit from our RE FE REN C ES AN D N OT ES y 9 g 14 p Share of nonfossil fuels for intervention at the national level, relative to fuel substitution, for example, which requires international coordination. Energy security is more than security of supply because there are other economic, social, and environmental aspects that are also relevant. Future studies should compare the benefits of different energy security policies more systematically by including a demand-side perspective instead of relying on partial assessments and problematic indicators, such as import dependency. They could also expand to encompass a more comprehensive assessment of the social and environmental effects. This approach would contribute to a more nuanced understanding of energy security and inform more effective policy decisions on both a national and a global scale. j
B O OKS et al . PHILOSOPHY OF SCIENCE Embracing our role as active participants in the Universe should be a vital part of science, contend a trio of authors 955 , 1 MARCH 2024 • VOL 383 ISSUE 6686 y SCIENCE science.org 10.1126/science.adn6303 y g PHOTO: BRIGHTSTARS/ISTOCK PHOTO W y isms betray what the British philosopher Alfred North Whitehead referred to as “the estern science was founded on the bifurcation of nature.” premise of divorcing objective and Frank, Gleiser, and Thompson explicate subjective aspects of nature—an the nature and origin of this deficiency at approach to understanding the the core of science. They then navigate across world that has proven very successdisciplines that deal with the greatest scienful indeed. And yet, such a strategy tific mysteries. Time, matter, and cosmology has major shortcomings. In The Blind Spot, are covered in the second section of the book; astronomer Adam Frank, theoretical physilife, cognition, and consciousness in the cist Marcelo Gleiser, and philosopher Evan third. The Blind Spot, readers learn, is hidThompson set out to reclaim the central den in plain sight everywhere. place of human experience in the scientific When it comes to time and Einstein’s relaenterprise by invoking the image tivity, the authors cite the French of a “Blind Spot.” “At the heart philosopher Henri Bergson’s inof science lies something we do tuition that the experience of the not see that makes science pospassage of time is alien to clocks. sible, just as the blind spot lies at They argue, however, that “noththe heart of our visual field and ing illustrates the Blind Spot as makes seeing possible,” they dedramatically as the emergence clare. “In the visual blind spot sits of quantum physics.” The weirdthe optic nerve; in the scientific ness of superposition, entangleThe Blind Spot: blind spot sits direct experience.” ment, and the measurement Why Science Cannot Seeking to identify and corproblem results, in part, from Ignore Human Experience rect what the Austrian German Adam Frank, Marcelo Gleiser, insisting on a God’s-eye view of philosopher Edmund Husserl reality, they propound. and Evan Thompson MIT Press, 2024. 328 pp. called “the surreptitious substiThe French philosopher tution,” the authors have taken Georges Canguilhem’s insightful on a formidable challenge because the realization that “there is no distinction beBlind Spot is a conceptual Frankenstein, an tween normal and pathological in physics” amalgam of views that includes materialand the German philosopher Hans Jonas’s ism, reductionism, objectivism, instrumenremark that “only life can know life” preface talism, and epiphenomenalism. All these the return of the primacy of the organism currently underway in biology, where agency, purpose, and freedom are being entertained The reviewer is at the Instituto de Neurociencias, again after a long hiatus. In cognitive science, Consejo Superior de Investigaciones Científicas– the computational Blind Spot is epitomized Universidad Miguel Hernández de Elche, Alicante, Spain. Email: agomezmarin@gmail.com in the imminent perils of artificially intelli- g By Alex Gomez-Marin gent systems devoid of human wisdom. But beyond quanta, chaos, and complexity, the greatest opportunity to spot science’s foundational scotoma is consciousness. “The phenomenologist brackets the everyday positing of the world as existing outside consciousness in order to examine the world strictly as it is disclosed to consciousness,” write the authors. The primacy of consciousness is then brought to the fore. We cannot step outside consciousness, and it is not simply another object of knowledge “but also, and more fundamental[ly], that by which any object is knowable.” Their conclusion is unflinching: “the hard problem [of consciousness] is an artifact of the Blind Spot.” To ask “how” the brain gives rise to experience begs the question of “whether” it actually does so. Here, the authors reject not only physicalism and illusionism but also panpsychism and idealism. They contend instead that the real problem of consciousness is “how the brain as a perceptual object within consciousness relates to the brain as part of the embodied conditions for consciousness.” The Blind Spot is not just endemic in science, the authors maintain, it has also percolated to education, journalism, culture, and society writ large. Touching on political economics, the final chapter reimagines our relationship with planet Earth. This is a very important book that has the potential to become a classic text. I wish to note, however, three qualms. First, its diagnosis is much stronger than its prognosis. Having claimed at the start that “we need nothing less than a new kind of scientific worldview,” the authors ultimately leave readers with suggestions for “best practices.” Second, there is a whiff of disdain for speculation, particularly in mathematics and metaphysics. Phenomenology can feel a bit like being in an elevator that is stuck between two floors (science and philosophy): One can see what is wrong in both and yet is unable to contribute much to either. And finally, the book is simultaneously daring and yet mellowly heterodox—the authors could have been bolder in entertaining anomalous experiences at the edges of consciousness. Science is indeed a strange loop: “a highly refined form of experience” whose bounty lies, in part, in its ability to distill “objects of public knowledge” from experience, in ever-ascending “cycles of abstraction.” But, like a kite, it cannot properly fly if it loses its grounding. Being aware of the Blind Spot is a necessary step toward reinscribing human experience back into science’s core. j p Experiencing science Often overlooked, direct human experience is a central factor at play in understanding reality.
I N SI G H TS | B O O K S ANTHROPOLOGY Knowing the Neanderthal The Naked Neanderthal: A New Understanding of the Human Creature Ludovic Slimak Pegasus, 2024. 208 pp. An archaeologist seeks to strip away modern misconceptions about our extinct relatives By April Nowell y g y , science.org SCIENCE y 1 MARCH 2024 • VOL 383 ISSUE 6686 g 956 p to look carefully. He argues, on the basis of the lack of standardization of Neanderthal stone tools (another point many in the field ver the course of 300,000 years, would debate), that Neanderthals were Homo sapiens shared Earth with more creative than Homo sapiens. Whereas potentially as many as seven other Neanderthal creativity is apparent in the species of ancient humans. But of all uniqueness of every stone tool, Homo sapiof these species, it is the Neanderens, he reasons, are only superficially crethals who have captured the imagiative, and yet their “material rationalization nation of both scientists and the public of the world,” as seen in their efficient and alike. When they went extinct some 40,000 highly standardized tools, allowed them to years ago, we were without a close relative drive Neanderthals to extinction within a on this planet for the very first time. As few seasons wherever they encountered each a result, Neanderthals have become the other. Here, again, the lack of nuance in the quintessential “other.” modeling of Neanderthal extinction is out In his newly translated book, The Naked of step with current understandings Neanderthal, archaeologist Ludovic in the field, as is Slimak’s contention Slimak seeks to strip away the modthat it was the more restricted creativern trappings he argues that scientists ity of Homo sapiens that gave them an have projected onto our distant cousadaptive advantage. ins in order to understand the true There are other aspects of the book nature of the Neanderthal “soul.” The that are likely to be stumbling blocks book focuses primarily on the author’s for the reader. For example, because own field projects over the past three the book is structured around Slimak’s decades, including detailed descripcareer in the field, it does not engage tions of his pioneering research at with many other pertinent behaviors the French site of Mandrin investigator sources of data to a meaningful ing the nature of Neanderthal–Homo extent even though they stand to insapiens interactions and the timing fluence the reader’s understanding of and cause of Neanderthal extinction. who the Neanderthals were. These inThe book is filled with evocative clude the species’ medicinal plant use, imagery. Slimak’s descriptions of pyrotechnic knowledge, and cooking, traveling by train to the Arctic Circle as well as the growth and development and digging through sediment ridof Neanderthal “minibrains” (2, 3). dled with shark teeth to find traces Slimak (foreground) and colleagues work in Grotte Mandrin, France. Another issue is that the of Neanderthals below leave a lasting impression on the reader and provide Can he be? He maintains that other scienNeanderthal in The Naked Neanderthal is compelling details of discovery and explortists are incapable of imagining a humanity decidedly male. Beyond Slimak’s use of male ation. Given that it was written primarily that is different from their own and instead pronouns throughout the book and his emfor a popular audience, it is surprising, remake Neanderthals in their own likeness. phasis on hunting as an exclusively male achowever, that the book contains no maps For his part, Slimak dismisses all evitivity, population dynamics are described as or timelines, no glossary of terms, and no dence that Neanderthals made cave art and “I give you my sister, you give me your sister.” images of stone tools, personal ornaments, items of personal adornment, behaviors seen No female agency here. or even Neanderthals themselves, other as hallmarks of “humanness.” He further Although he omits any consideration than one well-known drawing of what a argues that Neanderthal burials simply link of the lives of Levantine Neanderthals, Neanderthal might look like in modern them to other animals who feel loss at the Slimak’s suggestion that the last refuges of clothing. Without these contextualizing and passing of conspecifics. Although new eviNeanderthals may have been in polar regions explanatory elements, it may be difficult for dence has come to light since the book was and not just the warmer climes of Gibraltar those with little to no previous knowledge published—for example, the discovery of is interesting. Despite its shortcomings, such of Neanderthal biological and cultural evoNeanderthal cave art in the form of digital musings are among the many things this lution to find their footing. tracings at La Roche-Cotard, France (1)—it book will leave the reader thinking about. j The Naked Neanderthal takes a deeply seems unlikely to have swayed him. In this, RE FE REN CES A ND N OT ES he is at odds with the vast majority of scien1. J.-C. Marquet et al., PLOS ONE 18, e0286568 (2023). tists in the field. 2. L. S. Weyrich et al., Nature 544, 357 (2017). The reviewer is at the Department of Anthropology, For Slimak, the archaeological record 3. C. A. Trujillo et al., Science 371, eaax2537 (2021). University of Victoria, Victoria, BC V8W 2Y2, Canada. lays bare the Neanderthal soul, if we choose 10.1126/science.adn6093 Email: anowell@uvic.ca O philosophical approach to the study of Neanderthals and is written in a poetic style that is at times cumbersome. Similarly, the chapters can be difficult to follow, and Slimak’s choice of topics can seem somewhat random (for example, why discuss cannibalism but not language?) except that they are linked to each other through the author’s field projects. The Naked Neanderthal is thus almost best thought of as a memoir—its meandering style a reflection of the nature of memory, its philosophical approach a product of the author’s soul-searching. After a lifetime of “hunting Neanderthals,” is Slimak any closer to really knowing them?
Peru’s new law removes obstacles to converting diversity-rich forests to farmland. LET TERS Eric G. Cosio2, Cony Decock6, William Farfan-Rios7, Kenneth Feeley8,9, Eurídice Honorio Coronado10, Isau Huamantupa11, Alfredo J. Ibañez2, Juliane Koepcke de Diller12, Blanca León13, Reynaldo Linares-Palomino14, José L. Marcelo Peña15, Betty Millán5, Justin F. Moat1, R. Toby Pennington16,17, Nigel Pitman18, Norma Salinas2, Roxana RojasVeraPinto19, Philip C. Stevenson1,20, Carolina Tovar1, Oliver Q. Whaley1, Kenneth R. Young13 1Royal Botanic Gardens Kew, Surrey TW9 3AB, UK. Universidad Católica del Perú, 15088 Lima, Peru. 3Philipps-Universität Marburg, 35032 Marburg, Germany. 4Duke University, Durham, NC 27705, USA. 5Universidad Nacional Mayor de San Marcos, 15081 Lima, Peru. 6Université Catholique de Louvain, B-1348 Louvain-la-Neuve, Belgium. 7Department of Biology and Center for Energy, Environment, and Sustainability, Wake Forest University, Winston-Salem, NC 27106, USA. 8Department of Biology, University of Miami, Coral Gables, FL 33146, USA. 9Fairchild Tropical Botanic Garden, Coral Gables, FL 33156, USA. 10University of St. Andrews, St. Andrews KY16 9AL, UK. 11Universidad Nacional Amazónica de Madre de Dios, Puerto Maldonado, Peru. 12Area de Conservación Privada Panguana, Huánuco, Peru. 13Geography and the Environment, University of Texas at Austin, Austin, TX 78712, USA. 14Center for Conservation Education and Sustainability, Smithsonian’s National Zoo & Conservation Biology Institute, Washington, DC 20008, USA. 15Universidad Nacional de Jaén, Jaén, Peru. 16Royal Botanic Garden Edinburgh, Edinburgh EH3 5LR, UK. 17Department of Geography, University of Exeter, Exeter EX4 4RJ, UK. 18Science and Education, The Field Museum, Chicago, IL 60605, USA. 19University of Reading, Reading RG6 6EX, UK. 20Natural Resources Institute, University of Greenwich, Kent ME4 4TB, UK. *Corresponding author. Email: c.martel@kew.org 2Pontificia 10.1126/science.ado0050 1 MARCH 2024 • VOL 383 ISSUE 6686 957 , 1. N. Myers, R. A. Mittermeier, C. G. Mittermeier, G. A. B. da Fonseca, J. Kent, Nature 403, 853 (2000). 2. Ministerio del Ambiente, Government of Peru, “Sexto informe nacional sobre diversidad biológica” (2019) [in Spanish]. 3. K. Brandon, “Ecosystem services from tropical forests–Review of current science,” Center for Global Development Working Paper 380 (2014). 4. O. L. Phillips, R. J. W. Brienen; RAINFOR collaboration, Carbon Balance Manag. 12, 1 (2017). 5. R. Gómez et al., Sustainability (Basel) 15, 4788 (2023). 6. “Ley N° 31973,” El Peruano (2023); https://busquedas. elperuano.pe/dispositivo/NL/2251964-1 [in Spanish]. 7. Ministerio del Ambiente, Government of Peru, “Cobertura y pérdida de bosque húmedo amazónico 2021” (2022); https://geobosques.minam.gob.pe/geobosque/descargas_geobosque/perdida/documentos/ Reporte_Cobertura_y_Perdida_de_Bosque_Humedo_ Amazonico_2021.pdf [in Spanish]. 8. Servicio Nacional Forestal y de Fauna Silvestre, Government of Peru (Cuenta de Bosques del Perú, 2021) [in Spanish]. 9. C. A. Nunes et al., Proc. Natl. Acad. Sci. U.S.A. 119, e2202310119 (2022). 10. R. Beuchle, F. Achard, C. Bourgoin, C. Vancutsem, “Deforestation and forest degradation in the Amazon – Updated status and trends for the year 2021” (Publications Office of the European Union, 2022). 11. N. Giardino, “Narco violence surge in Peru’s Amazon sends Indigenous leader into hiding” (2023). 12. D. Valdivia Blume, “Ley Forestal: ¿quiénes estuvieron detrás de la modificación de la norma que ahora permitirá la deforestación en la Amazonía?” (2023) [in Spanish]. y PHOTO: ARMIN NIESSNER (PANGUANA BIOLOGICAL STATION) RE FE REN CES A ND N OT ES y g SCIENCE science.org Carlos Martel1,2*, Glenda Mendieta-Leiva3, Patricia C. Alvarez-Loayza4, Asunción Cano5, y Peru, one of the most biodiverse countries in the world (1), contains many endemic species that are at risk of extinction (2). The Peruvian Amazon biome harbors most of this diversity and provides globally important ecosystem services and benefits to all people (3, 4) as well as economic and cultural value for Indigenous communities (5). However, recent amendments to Peru’s Forestry and Wildlife Law No. 29763 threaten these important forest ecosystems. On 11 January, the Peruvian Congress amended Law No. 29763 by enacting Law No. 31973 (6), which removes obstacles to deforestation by changing zoning laws and regulatory bodies. Previously, exploitation could only take place in areas zoned as “permanent production forests.” No area could be rezoned as permanent production forests without an evaluation study and approval from the Ministry of Environment, the regulatory body for land use in forested areas. Law No. 31973 removes the evaluation requirement and allows zoning changes with permission from the Ministry of Agricultural Development and Irrigation, which replaces the Ministry of Environment as Peru’s forest regulatory body. Given that a priority of the Ministry of Agricultural Development and Irrigation is to increase agricultural production, it will likely facilitate zoning changes to allow forest exploitation despite g Peru’s zoning amendment endangers forests the threat they pose to diversity-rich areas. These changes allow private agricultural companies that already own forested land to freely convert it to farms, facilitating rapid land-use change. Between 2015 and 2017, Peru lost more than 4770 km2 of forest, comprising 0.7% of Peru’s total forest area (7), 83% of which was transformed for agriculture and livestock (8). Such land conversions lead to biodiversity loss, alter soil properties, and reduce aboveground carbon pools (9). In addition to releasing substantial amounts of carbon into the environment, deforestation affects the hydrological cycle and other natural processes (10). The intrusion of industrial activities in the Amazon could also lead to increased crime against Indigenous communities [e.g., (11)]. Private business groups, such as the National Confederation of Private Business Institutions (CONFIEP), lobby the government in support of land-use change in the Amazon rainforest to establish large-scale intensive agriculture (12). Their demands place profits above long-term environmental and human health. Instead of capitulating to industry, the Peruvian Congress should protect the country’s land and people by ensuring that its legislation serves to preserve and promote the sustainability of the Peruvian forests as well as protect the country’s natural ecosystems and biodiversity. Peruvian citizens and scientists can fight the business lobby by calling on their congressional representatives to act accordingly. p Edited by Jennifer Sills
I N SI G H TS | L E T T E R S Nicaraguan government puts mining over justice de Pós-Graduação em Biodiversidade e Conservação, Universidade Federal do Maranhão, 65080-805, São Luís, MA, Brazil. 2Programa de Pós Graduação em Biodiversidade e Biotecnologia da Amazônia Legal, Universidade Federal do Maranhão, 65085-580, São Luís, MA, Brazil. 3Facultad de Gobierno, Universidad de Chile, 8320000 Santiago, Región Metropolitana, Chile. 4Internet Interdisciplinary Institute, Universitat Oberta de Catalunya, 08018 Barcelona, CAT, Spain. *Corresponding author. Email: raphaelmais12@gmail.com R E F E R E N C ES A N D N OT ES y g Michael J. Staplevan and Faisal I. Hai* R E F E R E N C ES A N D N OT ES 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. P. Bhatt et al., Environ. Res. 200, 111762 (2021). M. J. Stapleton et al., Water Res. 233, 119790 (2023). S. Acharya et al., Text. Res. J. 91, 2136 (2021). G. Guerranti et al., Environ. Toxicol. Pharmacol. 68, 75 (2019). M. M. Haque et al., J. Hazard. Mater. 8, 100166 (2022). G. Suzuki et al., Environ. Pollut. 303, 119114 (2022). Y. Guo et al., Sci. Tot. Environ. 838, 156038 (2022). E. Brown et al., J. Hazard. Mater. 10, 100309 (2023). M.J. Stapleton et al., Sci.Total Environ. 902, 166090 (2023). R. Geyer et al., Sci. Adv. 3, 1700782 (2017). H. B. Sharma et al., Sci. Total Environ. 800, 149605 (2021). European Commission, “Microplastics” (2024); https://environment.ec.europa.eu/topics/plastics/ microplastics_en. 10.1126/science.ado1473 science.org SCIENCE , Strategic Water Infrastructure Laboratory, School of Civil, Mining, Environmental, and Architectural Engineering, University of Wollongong, Wollongong, NSW 2522, Australia. *Corresponding author. Email: faisal@uow.edu.au y 1. A. Marena, “Guía para el Manejo de la Biodiversidad” (2020). 2. F. Galão, “Como a Nicarágua está devastando a segunda maior floresta tropical das Américas,” Gazeta do Povo, 31 December 2023 [in Portuguese]. 3. International Union for Conservation of Nature, Red List, “Red List Category, Critically Endangered and Endangered in Nicaragua” (2024); https://archive.vn/J6d7m. 4. “Acuerdo de Escazú en papel: Régimen de Daniel Ortega niega información en materia ambiental,” Onda Local, 26 December 2022 [in Spanish]. 5. Nicaragua, Presidente de la República, “Ley Creadora de la Empresa Nicaragüense de Minas (ENIMINAS)” (2017); https://archive.vn/OSkiQ [in Spanish]. 6. S. Quartucci, “Illegal Mining and Its Impacts on Human Rights-Nicaragua,” Latina Republic, 6 December 2023. 7. “Ortega ha concesionado la cuarta parte de Nicaragua a empresas mineras,” Divergentes, 16 July 2022 [in Spanish]. 8. A. Hines, “Decade of defiance,” Global Witness, 29 September 2022. 9. The Global Organized Crime Index, “Nicaragua” (2023); https://archive.vn/AWNNo. 10. M. Civillini, “UN climate fund suspends project in Nicaragua over human rights concerns,” Climate Home News, 26 July 2023. 11. S. Cortés, R. Sáenz, in Serie América Central en Perspectiva Ístmica Vol. 2: Pueblos, Movimientos, Saberes y Migraciones en el Istmo Centroamericano (Edições EACH, 2023), pp. 108–146 [in Spanish]. 12. T. Clifford, S. Heavey, “U.S. mining sanctions take aim at Nicaragua’s Ortega,” Reuters, 24 October 2022. 10.1126/science.ado1264 y 1 MARCH 2024 • VOL 383 ISSUE 6686 1Programa Potentially harmful microscopic plastics (microplastics) have been identified in flora, fauna, and humans (1, 2), and their volume and impact in the environment are difficult to quantify. The most effective microplastics mitigation strategy is to pinpoint their sources and prevent their release. Many industries, including textiles, cosmetics, and pharmaceuticals, have been linked to the release of microplastics into the environment (3–5). However, one counterintuitive source has been overlooked: the plastic recycling industry. The size-reduction units at plastic recycling facilities can generate substantial amounts of microplastics, which can be released into the environment during the subsequent washing process (6–9). In one case, 200,000 microplastic particles were released per liter of effluent (6). The commercial process for plastic recycling may have been emitting microplastics since its first use nearly half a century ago (10). Plastic recycling is integral to the transition from a linear to circular economy (11), but to ensure that the process is a net benefit, measures need to be put in place to prevent microplastic contamination. Preventing the release of microplastics from the recycling sector will require cooperation among scientists, industry, and governments. Researchers need to work with the recycling industry to find ways to effectively contain the microplastics that facilities emit. In addition, environmental regulatory agencies should implement and enforce wastewater emission standards that specifically target microplastics as a contaminant of concern, similar to the policies the European Commission has proposed (12). g 958 Rafael F. Oliveira1*, Felipe P. Ottoni1,2, Lucas O. Vieira2, Grettel N. Obando3, Ronald Sáenz4, Diego S. Campos2 Recycling process produces microplastics p Nicaragua contains 7% of global biodiversity and encompasses 60% of Central America’s ecosystem types (1). In recent decades, corruption, crime, and government negligence have threatened the country’s biodiversity, especially in areas such as the Bosawás Reserve, the second largest tropical forest in the Americas, and the Indio Maíz Biological Reserve, the second largest forest in Nicaragua (2), both protected areas that shelter endemic and threatened species (3). In 2019, Nicaragua signed the Escazú Agreement, a transnational pact pledging public participation and access to information to ensure environmental justice in Latin America and the Caribbean (4). However, the Nicaraguan government’s prioritization of mining activities, at the expense of the environment and Indigenous peoples, undermines the agreement. In 2017, President Daniel Ortega’s administration approved Law No. 953 (5), which established the Nicaraguan Mining Company (ENIMINAS) and thus mandated state participation in mineral exploitation. Law No. 953 does not specify the percentage of land to be allocated to mining activities, but since it took effect, there has been a substantial increase. In 2021, mining was taking place on approximately 835,000 hectares (about 7% of Nicaragua’s total land), with the possibility of expanding to 4.2 million hectares (approximately 36% of the country) (6). Some of that land is located in natural reserves or traditional territories, where previous laws prohibit mineral extraction (2, 6, 7). Government approval of mining in areas where mining is illegal has led to increasing conflict as traditional communities face persecution from land grabbers (2, 6–8). The Global Organized Crime Index, which tracks environmental offenses such as timber trafficking and illegal mining, rates 2023 crime in Nicaragua a 5.72 out of 10 and Nicaragua’s ability to address crime-related challenges (resilience) in 2023 only a 2.08 out of 10 (9). In response to the escalating violence against Indigenous peoples, the Green Climate Fund, a United Nations linked funder with the goal of reducing deforestation in reserves, suspended US$117 million from Nicaragua in 2023 (2, 10). Because of government-driven mineral extraction, Nicaragua faces increased environmental degradation and decreased access to funding to address it. In the past two decades, opposition to the government has primarily stemmed from an alliance between grassroots farmworker and environmentalist movements who are concerned about resource depletion, including land, water, and biodiversity in protected areas (11). The international community has also taken steps to help protect Nicaragua’s biodiversity and Indigenous communities. For example, in 2022, the US government increased economic pressure on Nicaragua by banning business with the gold industry and placing sanctions on the national mining authority (12). Increased diplomatic pressure is needed, along with support for local nongovernmental organizations and independent investigations. International organizations should foster dialogue among stakeholders to find joint solutions to this socio-environmental crisis and ensure that Nicaragua complies with the Escazú Agreement. Most importantly, the root cause of the problem must be addressed: Nicaragua’s government must honor its protective laws instead of passing legislation that overrides and contradicts them.
RESEARCH IN S CIENCE JOU R NA L S Edited by Michael Funk p MARINE CONSERVATION Protecting pelagic species SCIENCE science.org PHOTO: MANU SAN FELIX Science p. 967, 10.1126/science.adk3863 NEUROSCIENCE Touch receptor diversity Touch sensation is mediated by mechanically activated ion channels. Although some of these channels have been identified, the mechanosensitivity of sensory neurons is likely to involve multiple types of mechanically gated channels. Chakrabarti et al. identified a putative ion channel, ELKIN1, that is activated by mechanical force and is necessary for normal touch sensation in mice. Deletion of Elkin1 reduced the activation of low-threshold, mechanically activated currents. A similar reduction was observed in induced human sensory neurons upon small interfering RNA–mediated reduction in ELKIN1. The identification of ELKIN1’s contribution to touch sensation expands our understanding of the molecular basis of cutaneous sensation. —MMa Science p. 992, 1 0.1126/science.adl0495 RIVER FLOW Changing seasonal changes Patterns of river flow vary seasonally, which has important effects on the occurrence of floods and droughts, degrees of water security, and ecology. What is anthropogenic climate change doing to these seasonal cycles? Wang et al. used in situ observations of monthly average river flow from 1965 to 2014, combined with modeling, to show that human effects on climate have already caused a reduction of river flow seasonality at latitudes above 50° N. Understanding these changes is necessary for ensuring that 1 MARCH 2024 • VOL 383 ISSUE 6686 959 , In vitro work has shown that endocannabinoids mediate a form of synaptic plasticity called depolarization-induced suppression of inhibition (DSI). However, whether DSI occurs in vivo and if it contributes to physiological function have needed more investigation. Dudok et al. now demonstrate that a subpopulation of cells in the hippocampus, which fire in specific locations called place cells, trigger endocannabinoid signaling in their place field that can be detected both in the postsynaptic membrane and the presynaptic inhibitory axons. The authors show that inhibiting the endocannabinoid signaling alters place cell firing. These results reveal that a form of DSI-like plasticity occurs in vivo and plays an important role in shaping hippocampal spatial representation. —MMa y Location-dependent signaling y g NEUROSCIENCE y Researchers deploy a remote underwater video station in French Polynesia for unbiased surveys of ocean fish species. g M arine megafauna are increasingly threatened and are difficult to protect. Understanding the influence of humans on body size in fishes is also challenging given that data on marine species often come from fishery-based activities. Letessier et al. deployed more than 17,000 remotely operated baited devices to collect data on fish size and abundance as related to habitat (pelagic or benthic), human activities, and marine protected areas. Pelagic species were strongly influenced by human pressures and protection. The authors concluded that benthic species could be effectively protected even near markets, whereas only more remote protected areas will effectively safeguard large pelagic species. —SNV Science p. 976,, 10.1126/science.adi7562
R ES EA RCH | I N S C I E N C E J O U R NA L S freshwater ecosystems maintain their essential functions, for securing sustainable water resources, and for determining allocations for irrigation or hydropower generation. —HJS Science p.1009, 10.1126/science.adi9501 safe passage out of the body. INSPIRE could offer a direct treatment for postoperative ileus, but future studies will need to focus on optimizing electrical stimulation, as well as on safety and efficacy for human translation. —MY IN OTHER JOURNALS Edited by Caroline Ash and Jesse Smith Sci. Robot. (2024) 10.1126/scirobot.adh8170 STAR FORMATION Ultraviolet light erodes protoplanetary disks Growing larger crystals faster The production of large crystals of porous covalent organic frameworks (COFs) usually requires slow growth over weeks to avoid precursor assembly that results in defects. Han et al. found that large imine-linked single-crystal COFs (15 to 100 micrometers) can be grown in 1 or 2 days using trifluoroacetic acid as a catalyst and trifluoroethylamine as an intermediate reactant that is displaced by the reactant amine. This approach grew a wide variety of large COF crystals with x-ray diffraction resolutions up to 0.8 angstroms. —PDS p g y During their formation process, young stars are surrounded by a protoplanetary disk of gas and dust within which planets can form. Stars mostly form in clusters, and bright, high-mass stars irradiate the disks around low-mass stars with ultraviolet light. Berné et al. combined infrared, submillimeter, and optical observations of a protoplanetary disk in the Orion Nebula to determine the effect of ultraviolet irradiation. The authors found that the heating and ionization induced by the ultraviolet photons caused gas to be lost. They measured the loss rate and discuss the implications for planet formation in the disk. —KTS FRAMEWORK MATERIALS Science p. 1014, 10.1126/science.adk8680 Science p. 988, 10.1126/science.adh2861 CANCER MEDICAL ROBOTS Restoring intestinal peristalsis The world has seen unprecedented fertility declines across advanced, industrialized countries. Although childless families are rarely idealized, does the number of children still shape our perceptions of a successful family? Previous research tended to narrowly examine individual attributes (e.g., wealth, gender roles, communication quality, or number of children) in isolation instead of holistically accounting for the several dimensions that affect contemporary family ideals. Aassve et al. used family vignettes to investigate perceptions of ideal family characteristics across eight culturally diverse industrialized countries. The countries consistently prioritized good communication, wealth, Proc. Natl. Acad. Sci. U.S.A. (2024) 10.1073/pnas.2311847121 , 1 MARCH 2024 • VOL 383 ISSUE 6686 Sci. Transl. Med. (2024) 10.1126/scitranslmed.adf9874 Is a two-child family still ideal? egalitarian gender roles, and parenthood involving at least one child. However, having only one child (versus more than one) did not matter, suggesting that policies supporting satisfying marriages should target dimensions other than fertility. —EEU y 960 Aromatase inhibitors prevent estrogen production and can be effective against estrogen receptor–positive breast cancer, but subsequent tumor metabolic adaptation often thwarts treatment efficacy. Bacci et al. report that acetyl-CoAcarboxylase-1 (ACC1) promotes lipid mobilization in estrogendeprived breast cancer cells, leading to anti–estrogen therapy resistance. Pharmacologically targeting ACC1 in patientderived, treatment-resistant xenograft models reduced tumor growth and increased mouse survival. This work indicates that targeting ACC1 may be an avenue to resensitizing estrogen receptor–positive breast cancer to endocrine-based therapies. —CAC FAMILY IDEALS y g Paralysis of the intestinal track is a common postoperative complication that not only causes several painful symptoms, but also often results in prolonged hospital stays. Srinivasan et al. developed an ingestible robotic device designed to reanimate the intestines through electrical stimulation. The S-shaped device, named INSPIRE, contains electrode contacts on its outer surface. An expansion mechanism triggered in the small intestine creates contact between the lumen and the electrodes. INSPIRE improved intestinal contractions by 44% in anesthetized swine and by 140% in a model of induced ileus. Made of biodegradable polymers, the device degrades within 24 hours, enabling Repotentiating aromatase inhibitors IMMUNOLOGY How PD-1 influences T cell signaling T lymphocytes are immune cells that, when properly activated, attack and kill cancer cells. Inhibitory receptors such as programmed cell death 1 (PD-1) impair the activation of T cells. Therefore, cancer immunotherapy that blocks PD-1 can be used to restore tumor-specific T cell responses. Despite the success of PD-1 inhibitor therapy science.org SCIENCE
Genetic basis of color is a real hoot C oloration is vital for predator avoidance, attracting mates, and many other keys to survival. However, color is difficult to investigate mechanistically because it is often both polygenic and environmentally influenced. Cumer et al. use whole-genome data from 75 barn owls to identify genetic variation underlying plumage coloration. They replicated previously known associations with MC1R, a gene involved in pigmentation in many species, and identified two new variants, including one with effects that are only seen in the presence of the MC1R allele that confers white pigmentation. These results highlight the oligogenic and complex interplays of epistasis and dominance among genetic variants underlying pigmentation. —CNS Plant Cell (2024) 10.1093/plcell/koae033 g Proc. Biol. Soc. (2024) 10.1098/rspb.2023.1995 SPINTRONICS In many settings, particularly lowand middle-income countries, challenges faced by both lenders SCIENCE science.org TEXTILES Clean water from cloth Water resources are inadequate in many parts of the world. Li et al. developed a fabric-based solar steam generator to produce clean PLANT SCIENCE Leaf shape and development Leaf shapes exhibit remarkable diversity. Leaflet initiation and boundary formation are key developmental events that control compound leaf morphogenesis. He et al. identified a Phys. Rev. Lett. (2024) 10.1103/PhysRevLett.132.056704 1 MARCH 2024 • VOL 383 ISSUE 6686 961 , Accessing education with digital collateral Adv. Funct. Mater. (2024) 10.1002/adfm.202312613 y ECONOMICS Q. J. Econ. (2024) 10.1093/qje/qjae003 water. They were able to accomplish relatively efficient water production by designing a fabric that absorbs sunlight but is structured to efficiently separate salt from water. As a proof of concept, the authors constructed a floating outdoor water purification device. Using fabrics as a basis for solar steam generation may be helpful for scaling in a cost-efficient way, providing a different pathway for clean water generation. —BG The vast majority of today’s computing technologies are based on the transport of charged carriers around electrical circuits. However, the speed at which electrons can be moved around, together with ohmic losses, restricts how far these technologies can progress. The next generation of devices based on wave technologies such as acoustics, optics, or spin waves (the collective magnetic properties of electrons) could overcome these limitations. Hwang et al. have shown that magnons, the quanta of spin waves, propagating in a thin magnetic film can be strongly coupled to another wave excitation, phonons (surface acoustic waves), propagating across the surface of the film. This effect may provide opportunities to develop hybrid wave–based devices in which information (classical and possibly quantum) can be stored, manipulated, and carried in a variety of different ways. —ISO y g J. Exp. Med. (2023) 10.1084/jem.20231242 and borrowers in securing loans with physical collateral can affect households’ access to resources. Describing their field experiment in Uganda, Gertler et al. show how securing loans with digital collateral, a home solar system that the lender doesn’t physically repossess but can temporarily deactivate using lock-out technology until loan payments are made, increased the rate of return to the lender and reduced loan default rates. The loans allowed borrowers to pay school fees, increasing enrollment in, and expenditures on, schooling. —BW y Strongly coupling magnons to phonons European barn owls exhibit continuous color variation that is primarily generated by interactions between three genomic regions. in cancer patients, there is still much to learn about how inhibitory receptors affect immune cells. Chan et al. developed an imaging technology called FILMSTAR (Fluorescent Intracellular Live Multiplex Signal Transduction Activity Reporter) to study activation signals in T cells. The system allows for real-time, single-cell tracking of multiple signaling pathways and may improve our understanding of how PD-1 and related molecules influence the T cell anticancer response. —PNK p transcription factor, PINNATELIKE PENTAFOLIATA2 (PINNA2), in Medicago truncatula (a small annual legume) that controls compound leaf development. They found that PINNA2 is specifically expressed at organ boundaries, and its loss-of-function mutations convert trifoliate leaves into a pentafoliate form. PINNA2 synergistically acts with other genes to down-regulate the expression of SINGLE LEAFLET1 (SGL1), a positive regulator of leaflet initiation. Precise SGL1 expression by PINNA2 in compound leaf primordia maintains a proper pattern of leaflet initiation. Therefore, regulatory pathways are intrinsically coordinated in time and space to regulate compound leaf morphogenesis. —AWa GENETICS
R ES E ARCH ALSO IN SCIENCE JOURNALS NEUROSCIENCE Closing the (Syn)GAP on plasticity Science p. 964, 10.1126/science.adh0755 GROUNDWATER A changing dynamic Science p. 962, 10.1126/science.adf0630 INNATE IMMUNITY A bacteria-killing coat Multiplying crop improvement 1 MARCH 2024 • VOL 383 ISSUE 6686 The pre-T cell receptor a (PTCRA) chain is critical for ab T cell development in mice, but whether this also holds true for humans is unclear. Materna et al. examined 10 patients with rare biallelic loss-of-function PTCRA variants. Despite having small thymi and low circulating naïve ab T cell counts, the memory ab T cell counts in these patients were normal, suggesting that the pre-TCRa may not be absolutely required for ab T cell development in humans. The authors also identified two common hypomorphic PTCRA variants that were responsible for partial pre-TCRa deficiency in homozygotes in about one in 4000 individuals from the Middle East and South Asia, resulting in high circulating naïve gd T cell counts and a significantly increased incidence of autoimmunity. —STS Science p. 966, 10.1126/science.adh4059 THERMODYNAMICS Measuring the changes in entropy Entropy in a closed system is a measure of the disorder or randomness and represents the energy unavailable to do work. Di Terlizzi et al. propose a method for evaluating the steady-state entropy production in nonequilibrium stochastic systems (see the Perspective by Roldán). This method is achieved using a variance sum rule that connects changes in positions with the forces required to restore those positions. The approach was verified using high-resolution experimental data on optically trapped Brownian particles and red blood cells, including stretching of the ATMOSPHERIC DYNAMICS Building up flow How does random turbulence organize to form large-scale structures in planetary atmospheres? Such a process implies the existence of an inverse energy cascade, an idea that has been suggested but not yet demonstrated for Earth’s atmosphere. Alexakis et al. conducted numerical simulations at high spatial resolutions to show that rotating and stratified flows can support a three-dimensional, bidirectional cascade of energy under conditions applicable to those on Earth. These results explain how spontaneous order can arise in a dry atmosphere through an inverse cascade of energy to large spatial scales. —HJS Science p. 1005, 10.1126/science.adg8269 EVOLUTION Follow the path Established morphological traits can direct trait evolution along particular trajectories in a process known as path dependence. Varney et al. explored this process in two lineages of chitons that have evolved two different visual systems, eye spots and shell eyes (see the Perspective by Sumner-Rooney). They found that lineages with more nerve openings in their shell evolved eye spots, whereas those with fewer openings evolved shell eyes. —SNV Science p. 983, 10.1126/science.adg2689; see also p. 947, 10.1126/science.ado1700 ORGANIC CHEMISTRY C–C coupling diverted to form C–N bonds Two of the most common reactions in pharmaceutical science.org SCIENCE , 961-B A spectrum of pre-TCRa deficiency Science p. 971, 10.1126/science.adh1823; see also p. 948, 10.1126/science.adn9799 y Plants often throw out offspring with different chromosome numbers (ploidy). This phenomenon can create bigger flowers and fruits or provide environmental resilience, and it has become a target in plant breeding for crop improvement. Westermann et al. investigated why de novo polyploids show reduced fertility compared with established descendant polyploid plants. Fertility loss was originally thought to result primarily from issues relating to segregation of multiple chromosomes during meiosis, but this is not the only obstacle. In a survey of genes under selection, the authors identified two: AGC1, which Human cells have many mechanisms to detect and respond to bacterial and viral intruders. Proteins that recognize bacterial cell wall components can coat the surface of invading bacteria and serve as a scaffold for the assembly of signaling proteins and antimicrobial enzymes. Zhu et al. performed genetic, biochemical, and structural experiments to reveal how this large protein complex is formed and to understand how it functions to protect cells from intracellular infection. Cryo– electron tomography revealed that monomers and dimers of GBP1 form an even coating on bacteria, and medium-resolution reconstructions suggested that an extended conformation allows the protein to insert into and disrupt the bacterial outer IMMUNOLOGY cells and contour fluctuations, a measure of the cells’ metabolic activity. —MSL y g PLANT SCIENCE Science p. 965, 10.1126/science.abm9903 y The availability of fresh groundwater is vital for agriculture, industry, people, and ecosystems, but its quality and quantity have been significantly affected by climate change and anthropogenic activities. Kuang et al. review the changes that groundwater is experiencing now and will experience in the near future and discuss future challenges to groundwater supplies. Considering these changes is important for managing this critical resource in an ever-more challenging environment. —HJS membrane. —MAF and SMH g Science p. 963, 10.1126/science.adk1291; see also p. 946, 10.1126/science.adn8707 is important for pollen tube growth, and ACA8, a calcium transporter, both of which are known to affect pollen tube structure. Experiments verified the role that adaptations in the expression of these genes play in correcting defective pollen tube growth after ploidy generation. —CA and AWa p Synaptic plasticity is the critical mechanism supporting learning, memory, and many other neurophysiological processes during brain development and in adulthood. The GTPaseactivating protein SynGAP has been shown to be necessary for synaptic plasticity, and mutations have been associated with autism and other intellectual disabilities. Araki et al. found that the GAP activity of SynGAP is not required for synaptic plasticity (see the Perspective by Choquet). Instead, the protein modulates synaptic plasticity by competing with the AMPA receptor–TARP complex at excitatory synapses, influencing the formation of molecular condensates and ultimately regulating the recruitment of AMPA receptors during plasticity. These results will help in the development of treatments for SynGAP-mediated neurological disorders. —MMa Edited by Michael Funk
Science p. 1019, 10.1126/science.adl5359; see also p. 950, 10.1126/science.ado0068 CATALYSIS A protective layer of innate-like T cells Although T cells are primarily activated in response to antigen recognition through their T cell receptor (TCR), they can also undergo TCR-independent “bystander” activation in response to certain cytokines. Using single-cell transcriptomics and chromatin accessibility profiling, Watson et al. found that neonatal CD8+ T cells undergo a distinct and robust program of innate-like bystander activation controlled by a balance of Bach2 and AP-1 transcription factor activity. Neonatal CD8+ T cells could protect against bacterial, viral, and parasitic pathogens in a TCR-independent manner. Innate-like CD8+ T cells were also present in both adult mice and humans, indicating that multiple layers of defense may exist within the adult naïve T cell pool. —CO y g y Sci. Immunol. (2024) 10.1126/sciimmunol.adf8776 , Science p. 998, 10.1126/science.adk5195 T CELLS y An effective catalyst for propane dehydrogenation must avoid unwanted carbon buildup and metal agglomeration by stabilizing rhodium atoms in silicalite-1 zeolite. Rhodium catalysts for this reaction tend to be unstable at the high temperatures need to drive high conversion. Zeng et al. found that alloying with indium formed RhIn4 groups attached to the zeolite through an In–O linkage. This catalyst was stable for more than 1200 hours at 600°C, exhibited high propane conversion (~65%) and propylene selectivity (98%), and was also highly active for ethane and butane dehydrogenation. —PDS Sci. Signal. (2024) 10.1126/scisignal.adh1178 g Stabilizing rhodium atoms in zeolites clinical severity of RA. The US Food and Drug Administration– approved ALOX5 inhibitor zileuton suppressed CD4+ T cell pyroptosis and reduced joint inflammation in rodent models of RA, suggesting ALOX5 as a potential therapeutic target. —AMV p chemistry entail the Pd-catalyzed formation of C–C and C–N bonds. Onnuch et al. report that conditions under which the two reactants primed to form C–C bonds through Suzuki coupling can instead both be coupled to a common N center to form an amine (see the Perspective by Shaughnessy). The intervention, which hinges on a bulky phosphine ligand on Pd and a P-based electrophilic N source, offers a simple means of diversifying existing Suzuki reactant libraries. —JSY IMMUNOLOGY ALOX5 stokes rheumatoid arthritis Pyroptosis of CD4+ T cells is associated with synovial inflammation in rheumatoid arthritis (RA). Cai et al. found that increased abundance of the leukotriene biosynthetic enzyme ALOX5 in circulating and synovium-infiltrating CD4+ T cells drove pyroptosis in these cells, which correlated with the SCIENCE science.org 1 MARCH 2024 • VOL 383 ISSUE 6686 961-C
RES EARCH ◥ GROUNDWATER The changing nature of groundwater in the global water cycle Xingxing Kuang, Junguo Liu*, Bridget R. Scanlon, Jiu Jimmy Jiao, Scott Jasechko, Michele Lancia, Boris K. Biskaborn, Yoshihide Wada, Hailong Li, Zhenzhong Zeng, Zhilin Guo, Yingying Yao, Tom Gleeson, Jean-Philippe Nicot, Xin Luo, Yiguang Zou, Chunmiao Zheng* 5 2 12 4 1 2 3 4 5 7 Unconfined aquifer Seawater Shale intrusion formation Flux (×1000 km3/yr) Ocean evaporation (420 ± 20%) Precipitation on ocean (380 ± 20%) Net water vapor flux transport (46 ± 20%) Rainfall (98.5 ± 10%) Snowfall (12.5) 11 8 Storage (×1000 km3) 6 7 8 9 10 Terrestrial evapotranspiration (69 ± 10%) Runoff (46 ± 10%) Groundwater discharge (4.5 ± 70%) Groundwater withdrawal (~1.0) Managed aquifer recharge (MAR) 0.01 11 12 13 14 Ocean 1,338,000 Glaciers and snow 24,064 Permafrost 300 Groundwater 23,400 Simplified global water cycle with its components. Groundwater is becoming increasingly more dynamic in the global water cycle. Kuang et al., Science 383, 962 (2024) 1 March 2024 ▪ The list of author affiliations is available in the full article online. *Corresponding author. Email: liujg@sustech.edu.cn (J. L.); zhengcm@sustech.edu.cn (C. Z.) Cite this article as X. Kuang et al., Science 383, eadf0630 (2024). DOI: 10.1126/science.adf0630 READ THE FULL ARTICLE AT https://doi.org/10.1126/science.adf0630 1 of 1 , Co nfin ed aqu ifer Industry 9 y 6 14 Bedrock 1 10 13 y g 3 OUTLOOK: The role of groundwater in the global water cycle is becoming increasingly dynamic and complex while the security of groundwater resources faces considerable threats worldwide in terms of both quantity and quality. The sustainable use of groundwater resources has become a crucial global concern. In planning for a more sustainable future, groundwater resources should be considered from both regional and global perspectives, especially for large, transboundary groundwater systems. As global changes continue to affect these resources, it is imperative to manage groundwater and surface water as a single resource. Additionally, ensuring food and water security and maintaining ecosystem health must be addressed concurrently. Various management strategies, including forest and wetland conservation, desalination, wastewater recycling, managed aquifer recharge, water diversion projects, and green infrastructure development may be employed to bolster the resilience of groundwater. Major research gaps exist that warrant further exploration, including detailed studies of groundwater in high-latitude and mountainous regions, more accurate predictions of groundwater recharge, quantitative assessments of injected and discharged groundwater volumes, and accurate modeling of the global water balance. To address these gaps effectively, comprehensive observational datasets are essential, as they enable a thorough evaluation of the current state and future changes in groundwater resources. y pogenic activities have led to regional and global transformations in groundwater dynamics. Climate-driven modifications include shifts in groundwater recharge rate across continents, increased groundwater contributions to streamflow in glacierized catchments, and profound alterations in groundwater flow patterns within permafrost areas. Glacial meltwater infiltrates into the subsurface, sustaining a stable groundwater discharge to streams during dry seasons. Permafrost thaw fosters increased rainfall infiltration, amplifies groundwater storage, creates new subsurface flow pathways, and increases groundwater discharge to streamflow. Direct anthropogenic activities include groundwater withdrawal, unconventional oil and gas production, geothermal energy exploration, managed aquifer recharge, afforestation, land reclamation, urbanization, and international food trade. These undertakings engender groundwater withdrawal and injection, reshaping regional groundwater flow regimes, impacting water g ADVANCES: Climate change and other anthro- able freshwater resource and forms an active component of the global water cycle. It serves as the primary source of fresh water for billions of people and provides drinking water to numerous communities. Moreover, groundwater supplies over 40% of global irrigation demand and is becoming increasingly important in mitigating water scarcity induced by climate change. In the past few decades, climate change and other anthropogenic activities have substantially altered groundwater recharge, discharge, flow, storage, and distribution. Climate warming–induced glacier retreat and permafrost thaw have led to changes in groundwater in glacierized and permafrost areas. In the interest of fostering a more comprehensive understanding of the state of global groundwater, we present a synthesis of its changing nature in the global water cycle over the recent decades, shaped by the impacts of climate change and other various anthropogenic activities. p BACKGROUND: Groundwater is the largest avail- tables and groundwater storage, and redistributing embedded groundwater in foods globally. Groundwater depletion occurs across the globe and has intensified over recent decades. Groundwater pumped from aquifers participates in the global water cycle by contributing to river discharge and evapotranspiration. Groundwater withdrawal transfers fresh water from long-term storage to the active water cycle at the Earth’s surface. Moreover, nonrenewable groundwater withdrawal from deep aquifers integrates deep ancient fossil groundwater into the active contemporary water cycle, ultimately contributing to rising sea levels. The risks of saltwater intrusion and groundwater inundation in coastal regions are exacerbated by sea level rise. The importance of groundwater for drinking and irrigation is poised to increase in response to climate change. Consequently, the effects of groundwater depletion on sea level rise are expected to become magnified in the future. ILLUSTRATION ADAPTED FROM EREBORMOUNTAIN/SHUTTERSTOCK REVIEW SUMMARY
RES EARCH REVIEW ◥ GROUNDWATER The changing nature of groundwater in the global water cycle Xingxing Kuang1, Junguo Liu1,2*, Bridget R. Scanlon3, Jiu Jimmy Jiao4, Scott Jasechko5, Michele Lancia1, Boris K. Biskaborn6, Yoshihide Wada7, Hailong Li1, Zhenzhong Zeng1, Zhilin Guo1, Yingying Yao8, Tom Gleeson9, Jean-Philippe Nicot3, Xin Luo4, Yiguang Zou1, Chunmiao Zheng10,1* 1 March 2024 1 of 13 , Kuang et al., Science 383, eadf0630 (2024) y *Corresponding author. Email: liujg@sustech.edu.cn (J.L.); zhengcm@sustech.edu.cn (C.Z.) y g State Environmental Protection Key Laboratory of Integrated Surface Water-Groundwater Pollution Control, Guangdong Provincial Key Laboratory of Soil and Groundwater Pollution Control, School of Environmental Science and Engineering, Southern University of Science and Technology, Shenzhen, China. 2Henan Provincial Key Lab of Hydrosphere and Watershed Water Security, North China University of Water Resources and Electric Power, Zhengzhou, China. 3Bureau of Economic Geology, Jackson School of Geosciences, University of Texas at Austin, Austin, TX 78758, USA. 4Department of Earth Sciences, The University of Hong Kong, Pokfulam Road, Hong Kong, China. 5 Bren School of Environmental Science and Management, University of California, Santa Barbara, CA 93106, USA. 6 Alfred Wegener Institute Helmholtz Centre for Polar and Marine Research, 14473 Potsdam Germany. 7Biological and Environmental Science and Engineering Division, King Abdullah University of Science and Technology, Thuwal, Saudi Arabia. 8Department of Earth and Environmental Science, School of Human Settlements and Civil Engineering, Xi’an Jiaotong University, Xi’an, China. 9Department of Civil Engineering and School of Earth and Ocean Sciences, University of Victoria, 3800 Finnerty Road, Victoria, BC V8P 5C2, Canada. 10Eastern Institute for Advanced Study, Eastern Institute of Technology, Ningbo, China. y 1 water could mitigate the impacts of climate extremes on water resources (11, 12) and is already widely used as a buffer against water scarcity during droughts (7). The importance of groundwater as a drinking and irrigation source is expected to increase as a result of climate change (13). Global warming may cause shifts in groundwater recharge rates (7, 14); warming also causes accelerated glacier retreat (15, 16) and permafrost degradation in high-latitude and high-altitude areas (17). Glacier retreat and permafrost degradation in turn lead to changes in groundwater in glacierized and permafrost areas (18, 19). Lowland populations are often dependent on water resources derived from mountain headwaters as irrigation sources (20). Many different anthropogenic activities have changed groundwater flow, storage, and distribution during past decades. Groundwater overexploitation occurs in many regions globally and groundwater depletion has grown in past decades (21). Other anthropogenic activities that can lead to changes in groundwater flow and storage include unconventional oil and gas production (22), geothermal energy exploration (23), managed aquifer recharge (24), afforestation (25), land reclamation and urbanization (26), and international food trade (27). Much of the withdrawn groundwater eventually enters the oceans and contributes to sea level rise (28). Rising sea levels increase the water table in coastal areas, which may cause flooding through groundwater inundation (29). In the interest of developing a more comprehensive understanding of the state of global groundwater, we synthesize aspects of the changing nature of groundwater in the global water cycle over recent decades resulting from Groundwater recharge is affected by climate variability and change (30, 31). Climate change affects groundwater resources by changing precipitation, evapotranspiration (ET), recharge, and pumpage (7, 32). On a global scale, modern global mean groundwater recharge fluxes are estimated to be at least ~12,000 to ~17,000 km3 per year (33–36). However, recharge rates vary substantially across different regions. Fig. 2A shows simulated mean annual groundwater recharge between 1960 and 2010 modeled by PCR-GLOBWB and considering lateral groundwater flow (37). A nonlinear relationship is found between precipitation and groundwater recharge in some regions, with wetter regions having higher recharge than drier areas (38). At the global scale, the effects of precipitation change on global average groundwater recharge may be insignificant. Higher precipitation (and recharge) in some areas may be offset by lower precipitation (and recharge) in other areas, leading to relatively small changes in interannual groundwater recharge rates at the global scale but large changes at the local scale (31). Both increasing and decreasing trends in groundwater recharge have been found in response to climate change (14). Increases in recharge projected in some areas have been attributed to projected increases in precipitation in regions such as the Upper Colorado River Basin in the United States (39) and to increasing intensity of precipitation in regions such as Indonesia and East Africa (14, 38). Increases in induced recharge may also be caused by groundwater overexploitation (30). Groundwater withdrawals vary over time with climate extremes, with more withdrawals during droughts and less withdrawals during wet periods (30). Declines in groundwater recharge are projected in some tropical and temperate climate regions (14, 40), such as much of the western United States (41). An average decline of 10 to 20% in total recharge is estimated for some aquifers in the southwestern United States (41). Climate models g G roundwater is the largest available freshwater resource and constitutes a major component of the global hydrological cycle (1). Groundwater also provides drinking water for billions of people (2) and supplies ~40% of global irrigation demand (3), in which it is becoming increasingly important (4–6). As a key component of the global water cycle (Fig. 1), groundwater sustains river discharge, lakes, wetlands, crops, forests, and ecosystems (7). The global water cycle is being modified by climate change and other anthropogenic activities at an unprecedented rate (8), the effects of which need to be better understood to meet the challenges that these changes present. Climate change is expected to fundamentally alter the global water cycle (9, 10). Ground- Groundwater changes driven by climate change Effects on groundwater recharge variability p In recent decades, climate change and other anthropogenic activities have substantially affected groundwater systems worldwide. These impacts include changes in groundwater recharge, discharge, flow, storage, and distribution. Climate-induced shifts are evident in altered recharge rates, greater groundwater contribution to streamflow in glacierized catchments, and enhanced groundwater flow in permafrost areas. Direct anthropogenic changes include groundwater withdrawal and injection, regional flow regime modification, water table and storage alterations, and redistribution of embedded groundwater in foods globally. Notably, groundwater extraction contributes to sea level rise, increasing the risk of groundwater inundation in coastal areas. The role of groundwater in the global water cycle is becoming more dynamic and complex. Quantifying these changes is essential to ensure sustainable supply of fresh groundwater resources for people and ecosystems. climate change and other anthropogenic activities. First, we discuss alterations to groundwater systems driven by climate change, including shifts in groundwater recharge and variations in groundwater flow systems in glacierized and permafrost areas. Then, we review other anthropogenic activities that lead to changes in groundwater levels, storage, and regional groundwater flow regimes. Finally, we evaluate the contribution of groundwater to sea level rise and groundwater inundation in coastal areas induced by sea level rise. We acknowledge that human activities also affect groundwater quality but a thorough discussion of groundwater quality changes is beyond the scope of this Review.
RES EARCH | R E V I E W Snowfall (12.5 ± 10%) Net water vapor flux transport (46 ± 20%) Glaciers and snow 24,064 Precipitation on ocean (380 ± 20%) Rainfall (98.5 ± 10%) Permafrost 300 Terrestrial evaporation (69 ± 10%) MAR (0.01) Ocean evaporation (420 ± 20%) Industry Groundwater withdrawal (~1.0) Groundwater 23,400 Runoff (46 ± 10%) Co nf in ed Unconfined aquifer fe Sh Be dro ck ale for ma r Ocean 1,338,000 p aq ui Seawater Groundwate r intrusion discharge (4.5 ± 70%) tio n g y Fig. 1. Global hydrological cycle with its components. The global water fluxes (×1000 km3 per year) in brackets and water storage (×1000 km3) were obtained from previous studies (9, 36). The upward arrows show annual evaporation from the ocean and terrestrial evapotranspiration. Global groundwater withdrawal is set at 1000 km3 per year based on data from 2010 in the literature (21). Antarctica was not included in the terrestrial water balance. [Adapted from EreborMountain/Shutterstock] y g y , Fig. 2. Groundwater recharge, withdrawal, water level decline, and storage changes. (A) Mean annual groundwater recharge from 1960 to 2010 modeled by PCR-GLOBWB coupled with MODFLOW (37). Positive values indicate groundwater recharge and negative values indicate capillary rise. (B) Mean annual potential net groundwater withdrawal from 1980 to 2016 simulated by WaterGAP 2.2d (44). Negative values indicate an increase in groundwater storage caused by surface water irrigation whereas positive values indicate a net removal of groundwater from aquifers due to human water use. (C) Annual groundwater storage change rate from 1980 to 2016 modeled by WaterGAP 2.2d (44). (D) Annual averaged decline in the groundwater level in the world’s major aquifers from 1990 to 2014 simulated by PCR-GLOBWB 2 run coupled with MODFLOW (101). Kuang et al., Science 383, eadf0630 (2024) 1 March 2024 2 of 13
RES EARCH | R E V I E W precipitation result in large uncertainties in projected groundwater recharge (7). Groundwater recharge is affected by rainfall amount and intensity (38, 40). Regions that experience increases in rainfall intensity may experience increases in groundwater recharge (12, 40). However, many predictions of future changes in precipitation frequency and intensity are highly uncertain. Current representations of hydrological processes and groundwater in global hydrological models may also lead to large uncertainties in the projected groundwater recharge (14). Incorporation of the impact of the changing climate and atmospheric CO2 levels on vegetation in global hydrological models can lead to variations of 100 mm per year in simulated groundwater recharge (14). Regionally, the predominant sources of uncertainty may stem from selection of global climate models and emissions scenarios (49). Increases in groundwater contribution to streamflow due to glacier retreat y A g Glacial meltwater has been identified as an important source of aquifer recharge in glacierized catchments (50). A portion of glacial meltwater infiltrates and recharges groundwater; groundwater then discharges farther down-gradient to streams (Fig. 3A) (51). For example, in the rapidly retreating Virkisjökull glacier in southeastern Iceland, >25% and often >50% of the groundwater is recharged from glacial meltwater in summer (52). In the Upper Indus River Basin, ~44% of annual groundwater recharge is derived from glacial meltwater (53). Groundwater in glacierized catchments contributes substantially to river discharge. In Nepal, groundwater flowing through fractured basement aquifers contributes ~66% of annual river discharge, which is six times higher than the contribution from glaciers and snow melt (54). The percentage of river discharge derived from groundwater can be >90% (55). During dry periods and winter, groundwater may be the main source of river discharge, with contributions of 50 to 90% (56). In the Shullcas watershed in central Peru, a typical proglacial watershed, groundwater provides ~70% of the dry season streamflow (57). These examples highlight the importance of groundwater in sustaining streamflow in mountainous areas. Accelerating glacier retreat may threaten the sustainability of water resources in mountainous areas (57); however, groundwater in high mountain areas may provide some resilience to glacier retreat (19). Groundwater storage in glacier forelands can buffer streamflow changes (52). The stored groundwater is released during dry seasons and compensates for high variability in glacial meltwater and sustains streamflow (58). Climate change has induced substantial glacier retreat in recent decades, with glaciers retreating in High Mountain Asia and many of the world's other p project that droughts will become more frequent and intense in California, decreasing recharge and increasing demand for groundwater (42). However, considerable uncertainty exists in some of these climate projections. Surface water irrigation can increase groundwater recharge and replenish aquifers from irrigation return flows (40, 43, 44). Inefficient surface water irrigation will increase groundwater recharge and storage (45). Canal leakage and return flow are the main pathways for increased groundwater recharge from surface water irrigation. Groundwater storage in the Indo-Gangetic Basin increased by ~420 km3 during the 20th century before large-scale groundwater withdrawal began in the late 1990s and early 2000s (46). Leakage from surface water irrigation increased groundwater storage by ~20 km3 in the Columbia Plateau in the northwestern United States between ~1940 and ~1970 (45). Previous studies estimated that 10 to 50% of total irrigation becomes irrigation return flow (47); the latter can be reduced with more efficient irrigation schemes such as drip rather than flood irrigation (48). Uncertainty in recharge projections arises from several sources, including uncertainty in changes in future precipitation rates and, critically, intensities (7, 40, 41). Annual and seasonal precipitation and temperature are identified as some of the most important factors in predicting spatial variation in groundwater recharge (31). Considerable uncertainties in future C River Active layer Lake Permafrost y g Glacier Runoff Groundwater flow paths River Sub-permafrost aquifer Bedrock y , D B River Active layer Lake Permafrost Glacier Runoff Groundwater flow paths Talik River Sub-permafrost aquifer Bedrock Fig. 3. Schematics of groundwater flow systems in glacierized catchments and permafrost areas. (A) and (B) Groundwater flow system in a glacierized catchment before and after glacier retreat (A) and (B), respectively (61). The blue curves with arrows show the groundwater flow from subglacial meltwater recharge. (C) and (D) Groundwater flow system in a permafrost area before and after climate warming (C) and (D), respectively (78, 79). The blue arrows in (D) show the enhanced groundwater flow. Kuang et al., Science 383, eadf0630 (2024) 1 March 2024 3 of 13
RES EARCH | R E V I E W , 4 of 13 y 1 March 2024 Groundwater is pumped out of many aquifers globally (89, 90). As an essential water source for humans, groundwater withdrawal accounted for an estimated ~22% of total water withdrawal in 2000 according to global hydrological models (34) and ~26% in 2010 according to national and international databases (91). Groundwater is withdrawn from both unconfined and confined aquifers (Fig. 4, A and B). Global groundwater withdrawal increased from ~310 ± 37 to 460 km3 per year in 1960 (4, 92, 93), to ~570 to 790 ± 30 km3 per year in 2000 (21, 33, 34), and then to ~1000 km3 per year in 2010 (21). Fig. 2B shows the mean annual potential net groundwater withdrawal from 1980 to 2016 simulated by the global hydrological model WaterGAP 2.2d (44). Although global groundwater withdrawal has increased from 1960 to the present, groundwater withdrawal has stabilized during recent decades in countries such as the United States, China, Pakistan, and Iran (91, 94). Large groundwater withdrawals have caused substantial declines in global aquifer storage (Fig. 2C) (6, 95, 96) and groundwater depletion may account for ~15% of total groundwater withdrawal (97, 98). The remaining 85% of groundwater withdrawal is linked to surface water capture, reduced evapotranspiration, and decreased discharge (97, 98). Groundwater withdrawal has resulted in substantial groundwater level declines in many areas in recent decades, such as parts of the US High Plains aquifer, the y g Kuang et al., Science 383, eadf0630 (2024) Groundwater changes driven by other anthropogenic activities Groundwater withdrawal y Permafrost underlies 14 to 16 million km2 of the Earth's exposed land surface (66), with a mean active layer thickness of ~0.8 m in the High Arctic and ~2.3 m in the alpine and highplateau regions (67). The observed permafrost temperatures have increased continuously over the past few decades (17, 68). Permafrost thaw and active layer thickening occur throughout cold regions globally (Fig. 3, C and D); the latter has been observed since the 1990s (68), charge to streams, providing stable baseflow during winter and dry periods (84). Enhanced infiltration, groundwater storage, and groundwater flow indicate an expanding role for groundwater in the high-latitude hydrological cycle (85). Continued permafrost degradation may exacerbate regional ecological challenges, including a reduction in soil water availability, vegetation degradation or greening, and land desertification (86). It is crucial to recognize the intricate interdependencies between the permafrost thermal regime and vegetation, as the impact of vegetation on permafrost degradation is complex (68, 86). Substantial increases in groundwater discharge to streams induced by permafrost thaw are likely to occur in the next few centuries (73, 87). An increase of 2°C in the mean annual surface temperature of the Tibetan Plateau could increase groundwater discharge to streams by a factor of three (88). The increase in runoff is caused by infiltrated water flowing through the subsurface and discharging to rivers during periods of flow recession (71). In catchments with ice-rich permafrost, excess ground ice provides large quantities of potential meltwater for groundwater flow (87). g Groundwater flow enhancement by permafrost thaw and in the Russian Arctic the active layer thickness increased by 0.4 m between 1999 and 2019 (68). In the Tibetan Plateau, the active layer thickness increased at 19.5 cm per decade from 1980 to 2018 (69), and the permafrost area decreased by ~1500 × 103 km2 during the past half century (70). Thawing permafrost increases groundwater storage, deepens groundwater flow pathways, and augments groundwater discharge to streams (Fig. 3, C and D) (18, 71, 72), especially during low-flow seasons (73). The permafrost area in the Yangtze River source region decreased by ~8000 km2 between 1962 and 2012, increasing groundwater storage at a rate of 1.6 km3 per year (74). In the Yukon River basin, long-term (>30 years) observations indicate a 7 to 9% increase in groundwater discharge to streamflow per decade (18). Thawing permafrost and thickening of the active layer can augment baseflow by enhancing groundwater flow pathways and releasing groundwater from storage to streams (75–77). Thickening of the active layer can eventually lead to the formation of large taliks (unfrozen zones in permafrost), plausibly increasing infiltration rates, subsurface storage volumes, and flow depths that alter groundwater flow pathways (Fig. 3, C and D) (78, 79), increasing groundwater discharge to streams through baseflow (72). Progressive permafrost thaw facilitates shallow groundwater flow systems whereas complete permafrost thaw creates new deep groundwater flow systems (73). Thawing permafrost also increases hydrologic connectivity and linkages between surface water and groundwater (77). Vertical talik expansion enhances regional groundwater circulation (76, 79). When a closed talik degrades to an open talik (i.e., a talik completely penetrates the permafrost), a pathway is created for groundwater flow (78). Open taliks connect shallow groundwater in the active layer to the aquifer below the permafrost, serving as vertical conduits for groundwater flow (Fig. 3D), thus enhancing regional groundwater circulation and discharge (79). Open taliks enhance surface water–groundwater interactions and groundwater flow converges at the talik (78, 80). Open taliks allow migration of relatively warm groundwater from above or geothermally warmed groundwater from below, thus accelerating permafrost thaw and expanding the talik network (81). As global warming persists in the coming decades, permafrost is projected to continue thawing (82). Over 40% of permafrost area may disappear if the climate is stabilized at 2°C above preindustrial levels (82). The low permeability of permafrost generally provides a hydraulic barrier that reduces rainfall and snowmelt infiltration (83). Where permafrost is discontinuous, rainfall and snowmelt can infiltrate and recharge groundwater, flow within the groundwater system, and finally dis- p high mountain areas (15). Global projections suggest that glaciers will lose ~20 to ~50% of their mass by 2100 relative to 2015 (59). In the Shullcas watershed in Peru, glaciers are projected to disappear entirely by 2100; however, the relatively consistent groundwater discharge to rivers is expected to compensate for the reduction in glacial meltwater (57). Continued future climate change may further decrease glacial meltwater contributions to rivers and some stream sources may undergo a progressive shift toward snow melt and groundwater (Fig. 3B) (60). As climate warming continues, many debriscovered glaciers will transform into rock glaciers, which are poorly sorted, angular rock debris with ice (61). Groundwater stored in rock glaciers discharges to streams through springs (61, 62). In the Canadian Rockies, groundwater discharge from one rock glacier spring accounts for 50% of streamflow during summer and up to 100% during winter (63). Continued climate warming may lead to the thawing of ice in rock glaciers. Although streamflow may initially increase as a result of ice melting in rock glaciers (62), after the volume of stored ice has declined, snowmelt and rainwater formerly flowing on the ice surface may infiltrate into the rock glacier matrix and flow out of the basin as groundwater (62) (Fig. 3B). Rock glaciers, talus, moraines, and alpine meadows are typical to alpine aquifers (64). Alpine aquifers can store large volumes of groundwater, which is vital in sustaining baseflow in rivers during low-flow seasons (64). In the Canadian Cordillera, which is experiencing glacier retreat, minimal reductions in winter streamflow have been observed in 17 rivers, indicating that groundwater storage in alpine headwater aquifers supports streamflow during the low-flow season (64). The high hydraulic conductivities of these alpine aquifers allow rapid infiltration of rainwater and snowmelt to unconfined aquifers above bedrock surfaces (63); these aquifers can then provide steady discharge to rivers for many months (64, 65). A large amount of groundwater stored in these aquifers sustains river runoff and stabilizes catchment outflow, which may affect catchment responses to climate change (65).
RES EARCH | R E V I E W A Withdrawal B Ground surface 0 Withdrawal C 0 Ground surface 0 Before withdrawal 10 10 After withdrawal 15 Unconfined aquifer F 1 3 4 2 km Direct discharge Cold water Reinjection Production well Injection well 2 3 4 5 Withdrawal Geothermal energy utilization Hot water Injection well Production well 2 5 1 km H 1 km I ET Infiltration pond 0 5 After MAR 10 Reinjection 0 1 Ground surface 5 Direct discharge Cold water Before MAR 15 After MAR 10 0 Before MAR Depth (m) Injection Geothermal energy utilization 0 Shale formation Deep formation Hot water Depth (km) Surface Pumping Injection water well well Shallow aquifer E y 0 10 m 125 g G Depth (m) Produced water 2 4 Deep confined aquifer 50 Shell well 3 10 m Confined aquifer Depth (km) Depth (km) 40 p 1 Confined aquifer 75 Aquitard 10 m Hydraulic fracturing recycling 0 30 Depth (m) D Aquitard Aquitard 50 100 20 25 After withdrawal After withdrawal 20 Before withdrawal 25 Depth (m) Before withdrawal Depth (m) Depth (m) 5 Withdrawal Ground surface 15 Aquifer Aquifer 100 m 100 m enhanced geothermal system (23, 129). (G and H) Schematics of MAR: (G) Aquifer storage and recovery, in which water is injected into the aquifer for storage and recovery using the same well; (H) Infiltration ponds, in which water infiltrates from a constructed pond into an unconfined aquifer for storage and recovery (140). (I) Water table before and after afforestation. ET, evapotranspiration. 137 km3 per year from 1960 to 2010 according to PCR-GLOBWB (93). Estimates of cumulative global groundwater depletion between 1960 and the early 21st century range from 2000 to as much as ~27,000 km3 (93, 103), highlighting the substantial uncertainty in cumulative groundwater depletion estimates. Groundwater depletion varies substantially across different regions (21); depletion estimates include 8 ± 3 km3 per year from 2000 to 2012 in the transboundary Indo-Gangetic Basin (104), ~4 km3 per year from 2003 to 1 March 2024 Aquifer After afforestation 2010 in the California Central Valley (105), and ~6 km3 per year from 1945 to 2020 in the North China Plain (106). Groundwater with mean renewal times surpassing human timescales (i.e., 100 years) is globally widespread and has been termed “nonrenewable” in some works (21, 107). Pumpage of this old groundwater is especially common when wells tap deep aquifers (Fig. 4C). An estimated ~20% of global gross irrigation water demand was derived from this old groundwater in 2000 (4). Groundwater that 5 of 13 , North China Plain, and the Indo-Gangetic Basin (Fig. 2D) (32, 46, 99–101). Groundwater depletion is often caused by withdrawals for irrigation (5, 99). Global annual irrigation water use was estimated to be 960 ± 130 km3 per year from 2011 to 2018 (102). Groundwater accounts for 45 to 50 and 60% of irrigation in India and the United States, respectively (5, 99). Global groundwater depletion was estimated to be 56 km3 per year from 1960 to 2000 and 113 km3 per year from 2000 to 2009 according to WaterGAP (43) and Before afforestation y Fig. 4. Schematics of different types of groundwater withdrawal and recharge. Groundwater withdrawal in an (A) unconfined aquifer, (B) confined aquifer, and (C) deep confined aquifer. (D) Schematics of shale gas development with hydraulic fracturing of a horizontal well (117, 118). (E and F) Schematics of different geothermal systems: (E) two-well circulation system and (F) 8 10 25 25 Kuang et al., Science 383, eadf0630 (2024) 100 m 4 6 y g 20 20 2
RES EARCH | R E V I E W Unconventional oil and gas production Geothermal energy exploration , 6 of 13 y Geothermal energy can be used for either geothermal power generation or direct utilization (129). Geothermal power generation has increased significantly worldwide in recent decades (23, 130). From 2010 to 2014, at least 2200 wells were drilled in 42 countries for both direct utilization and power generation, a 6.2% increase compared with 2005 to 2009 (131). From 2015 to 2019, at least 2647 wells were drilled by 42 countries for both direct utilization and power generation, with an additional ~20,000 shallow heat pump wells up to 100 m deep (132). Geothermal direct utilization worldwide increased from 71 GWt in 2014 to 108 GWt in 2019 (131, 132). The number of countries with direct utilization of geothermal energy increased from 28 in 1995 to 88 in 2019, including China, the United States, Sweden, Germany, and Turkey (132). The utilization of geothermal energy can be realized by pumping hot groundwater out of a hydrothermal system. Intensive withdrawal of deep thermal groundwater is needed during geothermal energy production. After geothermal y g 1 March 2024 y To enable unconventional oil and gas production from low-permeability source rocks such as shale, coal, or tight sandstone formations, hydraulic fracturing is widely used (Fig. 4D) (117, 118). During hydraulic fracturing, highvolume, high-pressure fluids, chemical additives, and proppants are injected into the low-permeability shale and tight rocks to fracture and maintain open fractures in the rocks (117, 119, 120). Horizontal drilling and hydraulic fracturing allows for large quantities of gas or oil to be extracted from these rocks (Fig. 4D). From 2009 to 2017, 1.8 km3 of water was used to fracture ~73,000 wells with a total lateral length of 134,000 km in the United States (22). Annual water use for hydraulic fracturing for major plays in the United States has increased rapidly since 2009 (22, 121). Groundwater was the primary water source (~13,000 wells) for hydraulic fracturing from 2010 to 2019 for the Permian Basin in the United States (121). Future increases in unconventional oil and gas production would require larger quantities of water for hydraulic fracturing, which would also lead to larger volumes of produced water (120). Produced water is coproduced with oil and gas over the life of a well and is mostly comprised of formation water (122, 123). The volume of produced water is estimated to vary widely from 1720 to 50,000 m3 per well, with 1720 to 14,320 m3 per well for the major US unconventional plays, 10,000 to 20,000 m3 per well during the first year of production for China, and 10,000 to 50,000 m3 per well for Canada (118, 120). Common methods for produced water management include deep underground injection, reuse for hydraulic fracturing, and surface discharge. Part of the produced water is reused for hydraulic fracturing and the percentage of water used for the latter derived from recycling tends to increase over time (Fig. 4D) (22, 118, 122). For the Marcellus Shale in the United States, 13% of the produced water was recycled from 2000 to 2010; this percentage had increased to 56% by 2011 (122). Deep underground injection is the primary method for produced water management (Fig. 4D) (119, 122). Most of the produced water in the United States is managed by deep underground injection (22, 122). In semiarid regions and/or areas with high groundwater consumption, the use of groundwater for drilling and hydraulic fracturing may change local water availability or lead to water stress (22, 124, 125). Globally, 20% of shale deposits are located in regions with groundwater depletion (125). In the United States, nearly half of shale wells are distrib- uted in water-scarce basins, in which unconventional wells increased water use (22, 124). The withdrawal of groundwater for shale oil or gas development may also lead to declining water levels and decrease the contribution of baseflow to streams (22, 121, 126). For the Eagle Ford play and Permian basin in the United States, a total of ~11,000 water wells were drilled to meet water demands for hydraulic fracturing from 2009 to 2017 (22). Water levels declined more considerably in confined aquifers in the Eagle Ford play (6 to 18 m per year over a ~5-year period) than in unconfined aquifers (22). From 2009 to 2013, the use of groundwater for hydraulic fracturing in the Eagle Ford play resulted in an estimated local drawdown of ~30 to 60 m in ~6% of the western play area (126). Regional groundwater flow regimes may be modified by unconventional oil or gas production. When groundwater is used for hydraulic fracturing, large volumes of groundwater are generally pumped out from shallow aquifers. Shallow groundwater is injected into shale layers during hydraulic fracturing and part of it remains in the shale layer. The produced water is then injected into deep underground geologic formations. The withdrawal and injection of groundwater leads to the redistribution of groundwater at different depths. Upward hydraulic gradients may be caused by injection that could potentially result in upward fluid leakage into shallow aquifers (127). Hydraulic fracturing also provides additional pathways for groundwater flow. Additionally, abandoned wells can provide potential conduits for produced water, and groundwater may flow from one aquifer to another (121, 128). g Kuang et al., Science 383, eadf0630 (2024) changes to global hydrological cycling induced by increased groundwater withdrawals as well as to assess the role of capture in groundwater resources in different regions. p was recharged by precipitation that fell before the Holocene (~12,000 years ago) is termed fossil groundwater (7, 9, 108). A synthesis of ~6500 wells globally shows that fossil groundwater dominates storage at depths of ≥ ~250 m (108). In the US High Plains Aquifer, the estimated depletion of fossil groundwater—much of which was recharged during the past 13,000 years—was 330 km3 from the 1950s to 2007 (5). Groundwater overexploitation in some aquifers leads to permanent depletion of water resources, sometimes referred to as groundwater mining (109). In the United States, the proportion of newly drilled wells that are sufficiently deep (200 ± 100 m) to tap fossil aquifers has grown in recent decades, although this deep drilling is not necessarily associated with depletion (110). Groundwater withdrawal is expected to increase under different future climate change scenarios (21, 111, 112). By 2050, the estimated global groundwater withdrawal rate is projected to be ~1250 ± 118 km3 per year, and the depletion rate is estimated to be ~300 ± 50 km3 per year (21, 111). By 2099, the projected global groundwater withdrawal is ~1600 ± 130 km3 per year, and the depletion is ~600 ± 85 km3 per year (92). Declining water levels may result in wells drying up, meaning deeper wells must be drilled to supply water (113). If global groundwater levels were to decline by only a few meters, millions of wells would be at risk of running dry (114). Deep fresh groundwater will become a strategic resource in areas with high extraction and low recharge rates (113). However, drilling deeper wells is an unsustainable stopgap measure for addressing groundwater depletion (113). Groundwater pumped from aquifers participates in the global water cycle by discharging to rivers and providing water for evapotranspiration (33, 99). In regions with groundwaterfed irrigation, increased groundwater use may cause higher evapotranspiration (102), potentially leading to higher precipitation downwind and thus augmenting river discharge (40). Irrigation in California's Central Valley strengthens the regional water cycle by an estimated ~15% increase in summer precipitation and a nontrivial increase in Colorado River streamflow (115). Large groundwater withdrawals can modify natural groundwater flow systems. Groundwater discharges to streams—which are vital to sustaining streamflow especially during dry seasons and droughts—may decline or even stop flowing, springs may dry up, and streamflow may decrease (2, 112). With greater groundwater withdrawals, particularly in areas with dry climates, it is likely that there will be more ephemeral and losing rivers (streams with water levels higher than those in adjacent wells) that can seep into underlying aquifers (100, 116). More studies are needed to evaluate
RES EARCH | R E V I E W y Coastal groundwater flow systems can be modified by land reclamation and urbanization. During urbanization of coastal areas, land reclamation from the sea and high-rise building construction with deep foundations are two common measures implemented to meet the growing demand for land (26, 163). Land reclamation in coastal areas is practiced worldwide (164). Large-scale land reclamation can change the regional groundwater regime by increasing groundwater levels and altering or slowing seaward groundwater discharge (Fig. 5A) (164, 165). Locally, seaward groundwater discharge may increase as a result of additional recharge in reclaimed land (163). The saltwater-freshwater interface may also move seaward after land reclamation. The 7 of 13 , 1 March 2024 Land reclamation and urbanization y g Kuang et al., Science 383, eadf0630 (2024) Afforestation can potentially increase annual evapotranspiration (Fig. 4I) while reducing annual streamflow. Global tree cover increased by 2.2 million km2 from 1982 to 2016 (153). Climate simulations suggest that tree plantations can increase summer evapotranspiration by more than 0.3 mm per day (154). Large-scale tree restoration has been found to increase terrestrial evapotranspiration by 1.2% and increase terrestrial precipitation by 0.7% due to recycling of increased evaporation (155). Largescale tree plantations may lead to groundwater declines where the enhanced evapotranspiration rates reduce recharge (25, 156). However, divergent impacts of tree restoration on streamflow have been found (155, 156). Some rivers experienced a decrease in streamflow by 6% as a result of enhanced evapotranspiration whereas for other rivers, the greater evapotranspiration is counterbalanced by enhanced moisture recycling (155). Afforestation can cause declines in the water table (Fig. 4I) as well as reductions in groundwater recharge, effective infiltration, soil moisture, and baseflow to streams. Afforestation may lead to water table declines in arid and semiarid areas of 0.5 to 3.0 m from 1952 to 2011 (25, 157). Compared with grasslands, groundwater recharge decreased by 3 to 7% for deeprooted forests (158). Much greater reductions in recharge of 33 to >90% were found in forests related to surrounding bare sandy soil in semiarid areas (159). Groundwater recharge is reduced as a result of increased transpiration and interception (160). Increased tree cover reduces soil moisture (161); for example, revegetation of a 16,000 km2 area in the Loess Plateau in China decreased soil moisture by ~2.4 mm per year and reduced runoff by ~0.5 mm per year from 2000 to 2010 (162). As forest plantations increase evapotranspiration (162), groundwater discharge to streams (baseflow) tends to decline, especially in drylands or during dry seasons (25, 156). y Managed aquifer recharge (MAR) refers to intentionally recharging and storing water in aquifers for subsequent recovery and various beneficial uses (24, 140–142). As a means of adapting to climate change and land use change and realizing sustainable water management, MAR has been implemented in many regions globally (143), including Europe, Australia, North and South America, Africa, and South Afforestation g Managed aquifer recharge Asia (30, 141, 144). MAR has also been implemented in mines to preserve aquifers, manage surplus water, or adhere to licensing (145). Effective MAR means that both water quantity and quality are managed effectively and is a water management strategy that is becoming increasingly important (24). There are ~1200 MAR sites in 62 countries (143). MAR has increased by 5% per year since the 1960s (24). The average MAR volume increased from 1.0 km3 per year in 1965 to 10 km3 per year in 2015, representing ~1% of global groundwater withdrawal in 2015 (24); however, it can be important for alleviating regional water stress (98). MAR is projected to exceed 10% of global groundwater extraction as MAR techniques become more advanced (24). MAR as a percentage of groundwater use varies significantly for different continents, from 0.4% in Africa to 9% in the Middle East (24, 142). MAR refers to a suite of methods that can be used to maintain and enhance groundwater systems under climate change and groundwater overexploitation (24, 146). MAR projects have various goals, such as raising groundwater levels, increasing groundwater storage, improving groundwater quality, preventing saltwater intrusion, and meeting irrigation demand (24, 143, 146). Different water sources have been used for MAR, including surface water (rivers and lakes), stormwater, treated wastewater, desalinated water, rainwater, and fresh and brackish groundwater from other aquifers (141, 144, 147). Surface waters such as river and lake water are the dominant sources of MAR (142, 144). There are many types of MAR methods, including infiltration basins, percolation tanks, bank filtration, recharge wells, and agricultural MARs (140, 141, 148) (Fig. 4, G and H). Depleted aquifers provide additional subsurface reservoir storage capacity for MAR in many regions, estimated at ~1000 km3 in the United States, exceeding the surface reservoir storage capacity (98). MAR buffers against the adverse impacts of climate extremes or change (142) and groundwater overexploitation (149). MAR can be used to enhance resilience to drought by storing excess surface waters and recycled water (146). Additional water is recharged during flooding or wet periods for subsequent abstraction during drought or dry periods (142, 146, 149). Depleted aquifers can be used to store water by recharging groundwater with surface water through MAR (147, 150). In semiarid areas where groundwater is either overexploited or saline, MAR has the potential to store excess runoff in aquifers (140). Stormwater or floodwater can drain into aquifers through infiltration basins, wells, or sumps to reduce flood and drought risks and then reuse this water for drinking or irrigation purposes (140, 151). Guidelines and regulations are vital to implementing MAR safely and sustainably (152). p energy utilization, the cold water is either reinjected deep underground or discharged directly to the surface (Fig. 4E). For a single-well extraction system, hot groundwater was pumped out and then released on the surface after use (133). The ratio of reinjected mass to produced fluid can vary from 5 to 100% (23). The distance between the production and reinjection zones ranges from 0.1 to 6.0 km, with an average value of 1.3 km (23). Sources of water used for reinjection include produced and surface water such as waste-, rain-, stream-, lake-, and groundwater (23). Enhanced geothermal systems use engineering strategies to enhance geothermal energy production, in which hydraulic fracturing is utilized to improve rock permeability and the injected water is heated by the rock (129, 134). The heated water is pumped out by the production well and the cold water is reinjected (Fig. 4F). Throughout many stages of enhanced geothermal systems, a substantial amount of water is introduced into the deep subsurface, including water from well drilling, hydraulic fracturing, and fluid circulation, in addition to water lost during the recovery process (129). As geothermal production and injection wells are generally several kilometers deep, groundwater withdrawal and injection may cause deep groundwater redistribution among different formations, perturbing local water cycling to some degree (135). Injection can also lead to elevated pore pressure, which may reactivate faults and cause new thermal fractures (134, 136, 137), thus providing new paths for deep groundwater flow. At the Geysers geothermal field in the United States, injected water can migrate >3 km below the injection point due to a hydraulically conductive fracture network (136). At the Nesjavellir geothermal field in Iceland, the injected fluid flowed through faults from the injection zone to the northeast (138). Intensive withdrawal of deep thermal groundwater can decrease the artesian pressure in deep fractures and allow shallow groundwater to flow into these deep fractures (135). In some geothermal fields, excessive withdrawal of geothermal fluid has resulted in sea or lake water intrusion when a sea or lake is nearby (23). Additional water may also be injected into geothermal systems to sustain production rates and maintain reservoir pressures (23, 139).
RES EARCH | R E V I E W A C Gr ou nd After reclamation su rf 5m ac e 100 m 500 m 500 m Reclamation Before reclamation Spring Sea Sea -SW e FWerfac t in Bedrock B D 100 m Gr ou nd High-rise buildings su rfa After reclamation 10 m ce 2 km Spring Sea Before reclamation -SW e FWerfac t n i Land reclamation p Reclamation 500 m Sea Sea Bedrock Deep foundations Fresh groundwater lens before land reclamation and urbanization (26, 173). (D) Coastal groundwater flow system after land reclamation and urbanization with deep foundations (26, 173). Curves with arrows show the groundwater flow paths. FW-SW interface, freshwater-saline water interface. g Fig. 5. Groundwater flow system changes caused by land reclamation and urbanization. (A) Land reclamation beside a coastal hillside with an unconfined aquifer (164, 165). (B) Land reclamation beside an elongated oceanic island with an unconfined aquifer (164–166). (C) Coastal groundwater flow system y A substantial share of groundwater depletion has primarily resulted from irrigation and an estimated ~11% of groundwater depletion is linked to the international food trade (176). The global groundwater depletion embedded in international food trade increased from 18 km3 per year in 2000 to 26 km3 per year in 2010 (176). “Virtual water trade” refers to exchanges of virtual water (amount of water embedded in a commodity) between different regions or nations through the exchange of physical com- 1 March 2024 8 of 13 , International food trade modities such as food (177). Enhanced international food trade is the main reason for increasing virtual water trade (177). At a national scale, groundwater depletion in three major US aquifers (Central Valley, High Plains, and Mississippi Embayment) related to food trade in the United States is linked primarily to domestic food transfers (31 km3), accounting for 90% of trade-related groundwater depletion, with the remaining 10% accounted for by international exports (178). Groundwater depletion linked to domestic trade grew from 26 km3 in 2002 to 35 km3 over a decade (2002 to 2012), with a similar rise in international trade (2.7 to 3.7 km3) (179). Embedded green water (soil moisture) and blue water (surface- and groundwater) exports are projected to more than triple from 2010 to 2100 from ~905 to 3200 km3 for green water and ~56 to ~170 km3 for blue water (27). To meet future crop demands, international food trade is projected to nearly triple by 2050, including virtual water transfers from water-abundant regions to water-scarce regions (180). Large groundwater volumes embedded in international food trade redistribute groundwater demand globally. Virtual water trading generates a virtual water flux that links water resources used physically in the production area to the consumption area (181). Unsustainable irrigation embedded in virtual water trade globally demonstrates a redistribution of irrigation y Kuang et al., Science 383, eadf0630 (2024) gradient (169, 172). Deep foundations limit groundwater flow, raising the water table and leading to upward groundwater flow in the transition zone between the natural slope and urbanized areas (26, 172, 173) (Fig. 5, C and D). When permeable natural soils are replaced by much less permeable deep foundations, the hydraulic conductivity of the aquifer system is reduced locally (26, 173). During urbanization, native surface soils are replaced by impervious surfaces, including roads, foundations, and pavement. These impervious surfaces prevent infiltration, leading to more surface runoff and less groundwater recharge (171). However, other studies show that urbanization leads to increased recharge due to rain and runoff infiltration and losses from water supply systems and sewer systems (174, 175). y g response of a given groundwater system to land reclamation can be a slow process, requiring several decades to reach a new equilibrium (163). Land reclamation around an oceanic island can change the groundwater system on the entire island, raising the water table on the island, shifting the water divide toward the reclaimed side, and increasing submarine groundwater discharge on the other side (164, 165). The saltwater-freshwater interface at the reclamation side may also move seaward after land reclamation (Fig. 5B) (164, 165). Lab experiments and numerical modeling indicate that land reclamation can enlarge fresh groundwater lenses by up to 85% in tropical islands (166). Groundwater systems can also be modified by dewatering and underground structures. Construction of high-rise buildings or underground infrastructures usually includes dewatering, deep excavations, and diaphragm walls (167). In areas with shallow water tables, dewatering requires pumping large quantities of groundwater (168). Artificial recharge beyond the excavation site can mitigate the impacts of dewatering on the foundation stability of neighboring buildings (167). Underground structures below the water table impact the groundwater flow system by acting as barriers to flow and altering the groundwater budget (168–171). The water table rises up-gradient of the underground structures and falls down-
RES EARCH | R E V I E W water demand, including groundwater demand (182). From 2000 to 2015, an estimated 15% of global unsustainable irrigation was virtually exported (182). Studies on changes in the global water cycle should consider both the physical and virtual water cycles (181). Groundwater and sea level rise Contribution of groundwater to sea level rise Globally, groundwater resources face substantial threats in terms of both their quantity and quality (21, 30). Excessive groundwater withdrawals continue to drive substantial groundwater depletion and the demand for groundwater is projected to rise. Climate warming has led to a diverse array of changes in groundwater recharge across different regions of the world. Other anthropogenic activities are reshaping regional groundwater flow regimes, complicating groundwater storage dynamics, altering groundwater discharge to streams, and redistributing embedded groundwater in the global food supply chain. Groundwater depletion transfers fresh water from long-term storage to the active water cycle, thereby contributing to sea level rise. Moreover, pollution from anthropogenic sources and interactions between surface water and groundwater have led to deterioration in groundwater quality (195). Groundwater-dependent ecosystems and geological environments have been severely affected by water table changes or poor groundwater quality (195). Given these challenges, the sustainable use of groundwater resources is a crucial global C d surfa ce Gro Water table und surf a y g Groun ce Water table Sea Sea FW-SW interface FW-SW interface 1m Aquifer 100 m B Saline water 1m 100 m , Saline water y Aquifer D Withdrawal y Rising sea levels can cause water tables to rise in unconfined coastal aquifers (29, 191, 192). This rise can then cause groundwater discharge to surface drainage networks and flooding from below in low-lying coastal areas (Fig. 6, C and D), which is referred to as groundwater inundation (29, 192). In California, areas flooded in this manner are projected to expand ~50 to 130 m inland in response to a sea level rise of 1 m (192). In northern California's coastal plains, a 1- to 2-m sea level rise may cause widespread groundwater emergence (193). In urban Honolulu, Hawaii, a 1-m sea level rise may inundate an estimated 10% of a 1-km wide coastal zone that is heavily urbanized (29). Groundwater inundation alone may increase the area flooded by seawater inundation by a factor of two (29). In urbanized coastal Sustainable use of groundwater resources g A Groundwater inundation induced by sea level rise areas, dense networks of buried and low-lying infrastructure may lead to thinning and loss of unsaturated subsurface space, which may further magnify the risk of groundwater inundation (194). Groundwater inundation caused by sea level rise enlarges the likelihood of groundwater discharge at the surface and accelerates groundwater circulation within the water cycle in coastal areas. p Groundwater withdrawal transfers fresh water from long-term groundwater storage to the active water cycle at the Earth's surface (7). Much of the groundwater ultimately returns to the ocean and causes sea level rise, which is particularly important in coastal areas (Fig. 6, A and B) (28, 183). Groundwater withdrawal also causes land subsidence, and coastal land subsidence contributes to relative sea level rise (184). From 1900 to 2008, the estimated contribution of cumulative global groundwater depletion to sea level rise was 13 mm (103) and ranged from 13 to 19 mm from 1948 to 2016 (185). The rate of global mean sea level rise increased from 1.56 ± 0.33 mm per year from 1900 to 2018 to 3.35 ± 0.47 mm per year from 1993 to 2018 (183). Similar increasing rates were reported in other studies from 1.7 ± 0.3 mm per year since 1950 to 3.3 ± 0.4 mm per year from 1993 to 2009 (186). Estimated contributions of past groundwater depletion to rates of sea level rise range from 0.2 to 0.9 mm per year (187, 188). Global groundwater depletion was estimated to contribute 0.31 mm per year (2000 to 2009) to sea level rise based on WaterGAP (43) and 0.40 ± 0.11 mm per year (2000 to 2008) based on in situ measurements (103), accounting for ~10% of global mean sea level rise. Te global mean sea level has been predicted to rise by 0.5 to 1.4 m by 2100 (29, 186), with the contribution of groundwater depletion to sea level rise projected to increase in the future (111). By 2050, groundwater depletion has been projected to contribute 0.82 ± 0.13 mm per year to sea level rise (111) and the percentages of cumulative contribution of groundwater depletion to global sea level rise range from ~10 to ~27% (29, 111). Groundwater depletion and sea level rise may lead to seawater intrusion into coastal freshwater aquifers which is becoming a critical environmental issue, with ~500 coastal cities experiencing seawater intrusion crises globally (189, 190). Seawater intrusion may become even more challenging to manage because of climate change (190). Groundwater utilization Gro und sur Discharge fac e FW-SW interface Aquifer Gro und surf After sea level rise Before sea level rise 1m Saline water 100 m ace Groundwater inundation FW-SW interface Aquifer After sea level rise Before sea level rise 1m Saline water 100 m Fig. 6. Schematics of groundwater withdrawal, sea level rise, and inundation. (A to B) Contribution of groundwater withdrawal to sea level rise (28, 187). (C to D) Groundwater inundation caused by sea level rise (29). FW-SW interface, freshwater-saline water interface. Kuang et al., Science 383, eadf0630 (2024) 1 March 2024 9 of 13
RES EARCH | R E V I E W RE FE RENCES AND N OT ES 1. 3. 5. 6. 7. 9. 10. 13. 14. 15. 16. Kuang et al., Science 383, eadf0630 (2024) 1 March 2024 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 10 of 13 , 12. 43. y 11. 42. T. Meixner et al., Implications of projected climate change for groundwater recharge in the western United States. J. Hydrol. 534, 124–138 (2016). doi: 10.1016/ j.jhydrol.2015.12.027 N. S. Diffenbaugh, D. L. Swain, D. Touma, Anthropogenic warming has increased drought risk in California. Proc. Natl. Acad. Sci. U.S.A. 112, 3931–3936 (2015). doi: 10.1073/ pnas.1422385112; pmid: 25733875 P. Döll, H. M. Schmied, C. Schuh, F. T. Portmann, A. Eicker, Global-scale assessment of groundwater depletion and related groundwater abstractions: Combining hydrological modeling with information from well observations and GRACE satellites. Water Resour. Res. 50, 5698–5720 (2014). doi: 10.1002/2014WR015595 H. M. Schmied et al., The global water resources and use model WaterGAP v2.2d: Model description and evaluation. Geosci. Model Dev. 14, 1037–1079 (2021). doi: 10.5194/ gmd-14-1037-2021 B. R. Scanlon et al., Effects of climate and irrigation on GRACE-based estimates of water storage changes in major US aquifers. Environ. Res. Lett. 16, 094009 (2021). doi: 10.1088/1748-9326/ac16ff D. J. MacAllister, G. Krishan, M. Basharat, D. Cuba, A. M. MacDonald, A century of groundwater accumulation in Pakistan and northwest India. Nat. Geosci. 15, 390–396 (2022). doi: 10.1038/s41561-022-00926-1 B. Dewandel, J.-M. Gandolfi, D. de Condappa, S. Ahmed, An efficient methodology for estimating irrigation return flow coefficients of irrigated crops at watershed and seasonal scale. Hydrol. Processes 22, 1700–1712 (2008). doi: 10.1002/hyp.6738 S. Zuidema et al., Interplay of changing irrigation technologies and water reuse: Example from the upper Snake River basin, Idaho, USA. Hydrol. Earth Syst. Sci. 24, 5231–5249 (2020). doi: 10.5194/hess-24-5231-2020 S. B. Ajjur, S. G. Al-Ghamdi, Quantifying the uncertainty in future groundwater recharge simulations from regional climate models. Hydrol. Processes 36, e14645 (2022). doi: 10.1002/hyp.14645 A. Vincent, S. Violette, G. Aðalgeirsdóttir, Groundwater in catchments headed by temperate glaciers: A review. Earth Sci. Rev. 188, 59–76 (2019). doi: 10.1016/ j.earscirev.2018.10.017 W. W. Immerzeel, F. Pellicciotti, M. F. P. Bierkens, Rising river flows throughout the twenty-first century in two Himalayan glacierized watersheds. Nat. Geosci. 6, 742–745 (2013). doi: 10.1038/ngeo1896 B. É. Ó Dochartaigh et al., Groundwater-glacier meltwater interaction in proglacial aquifers. Hydrol. Earth Syst. Sci. 23, 4527–4539 (2019). doi: 10.5194/hess-23-4527-2019 S. A. Lone et al., Meltwaters dominate groundwater recharge in cold arid desert of Upper Indus River Basin (UIRB), western Himalayas. Sci. Total Environ. 786, 147514 (2021). doi: 10.1016/j.scitotenv.2021.147514 C. Andermann et al., Impact of transient groundwater storage on the discharge of Himalayan rivers. Nat. Geosci. 5, 127–132 (2012). doi: 10.1038/ngeo1356 D. Penna, M. Engel, G. Bertoldi, F. Comiti, Towards a tracer-based conceptualization of meltwater dynamics and streamflow response in a glacierized catchment. Hydrol. Earth Syst. Sci. 21, 23–41 (2017). doi: 10.5194/ hess-21-23-2017 A. H. Laskar, S. K. Bhattacharya, D. K. Rao, R. A. Jani, N. Gandhi, Seasonal variation in stable isotope compositions of waters from a Himalayan river: Estimation of glacier melt contribution. Hydrol. Processes 32, 3866–3880 (2018). doi: 10.1002/hyp.13295 L. D. Somers et al., Groundwater buffers decreasing glacier melt in an Andean watershed-but not forever. Geophys. Res. Lett. 46, 13,016–13,026 (2019). doi: 10.1029/2019GL084730 J. Pourrier, H. Jourde, C. Kinnard, S. Gascoin, S. Monnier, Glacier meltwater flow paths and storage in a geomorphologically complex glacial foreland: The case of the Tapado glacier, dry Andes of Chile (30°S). J. Hydrol. 519, 1068–1083 (2014). doi: 10.1016/j.jhydrol.2014.08.023 D. R. Rounce et al., Global glacier change in the 21st century: Every increase in temperature matters. Science 379, 78–83 (2023). doi: 10.1126/science.abo1324; pmid: 36603094 P. J. Blaen, D. M. Hannah, L. E. Brown, A. M. Milner, Water temperature dynamics in High Arctic river basins. Hydrol. Processes 27, 2958–2972 (2013). doi: 10.1002/hyp.9431 y g 8. 41. y 4. B. K. Biskaborn et al., Permafrost is warming at a global scale. Nat. Commun. 10, 264 (2019). doi: 10.1038/ s41467-018-08240-4; pmid: 30651568 18. M. A. Walvoord, R. G. Striegl, Increased groundwater to stream discharge from permafrost thawing in the Yukon River basin: Potential impacts on lateral export of carbon and nitrogen. Geophys. Res. Lett. 34, L12402 (2007). doi: 10.1029/2007GL030216 19. L. D. Somers, J. M. McKenzie, J. M. MeKenzie, A review of groundwater in high mountain environments. WIREs. Water 7, e1475 (2020). doi: 10.1002/wat2.1475 20. D. Viviroli, M. Kummu, M. Meybeck, M. Kallio, Y. Wada, Increasing dependence of lowland populations on mountain water resources. Nat. Sustain. 3, 917–928 (2020). doi: 10.1038/s41893-020-0559-9 21. M. F. P. Bierkens, Y. Wada, Non-renewable groundwater use and groundwater depletion: A review. Environ. Res. Lett. 14, 063002 (2019). doi: 10.1088/1748-9326/ab1a5f 22. B. R. Scanlon, S. Ikonnikova, Q. Yang, R. C. Reedy, Will water issues constrain oil and gas production in the United States? Environ. Sci. Technol. 54, 3510–3519 (2020). doi: 10.1021/acs.est.9b06390; pmid: 32062972 23. Z. Kamila, E. Kaya, S. J. Zarrouk, Reinjection in geothermal fields: An updated worldwide review 2020. Geothermics 89, 101970 (2021). doi: 10.1016/j.geothermics.2020.101970 24. P. Dillon et al., Sixty years of global progress in managed aquifer recharge. Hydrogeol. J. 27, 1–30 (2019). doi: 10.1007/s10040-018-1841-z 25. B. A. Bryan et al., China’s response to a national land-system sustainability emergency. Nature 559, 193–204 (2018). doi: 10.1038/s41586-018-0280-2; pmid: 29995865 26. J. J. Jiao, X.-S. Wang, S. Nandy, Preliminary assessment of the impacts of deep foundations and land reclamation on groundwater flow in a coastal area in Hong Kong, China. Hydrogeol. J. 14, 100–114 (2006). doi: 10.1007/ s10040-004-0393-6 27. N. T. Graham et al., Future changes in the trading of virtual water. Nat. Commun. 11, 3632 (2020). doi: 10.1038/ s41467-020-17400-4; pmid: 32686671 28. Y. N. Pokhrel et al., Model estimates of sea-level change due to anthropogenic impacts on terrestrial water storage. Nat. Geosci. 5, 389–392 (2012). doi: 10.1038/ngeo1476 29. K. Rotzoll, C. H. Fletcher, Assessment of groundwater inundation as a consequence of sea-level rise. Nat. Clim. Chang. 3, 477–481 (2013). doi: 10.1038/nclimate1725 30. U. Lall, L. Josset, T. Russo, A snapshot of the world’s groundwater challenges. Annu. Rev. Environ. Resour. 45, 171–194 (2020). doi: 10.1146/annurev-environ-102017-025800 31. C. Moeck et al., A global-scale dataset of direct natural groundwater recharge rates: A review of variables, processes and relationships. Sci. Total Environ. 717, 137042 (2020). doi: 10.1016/j.scitotenv.2020.137042; pmid: 32062252 32. T. A. Russo, U. Lall, Depletion and response of deep groundwater to climate-induced pumping variability. Nat. Geosci. 10, 105–108 (2017). doi: 10.1038/ngeo2883 33. Y. Wada et al., Global depletion of groundwater resources. Geophys. Res. Lett. 37, L20402 (2010). doi: 10.1029/ 2010GL044571 34. N. Hanasaki, S. Yoshikawa, Y. Pokhrel, S. Kanae, A global hydrological simulation to specify the sources of water used by humans. Hydrol. Earth Syst. Sci. 22, 789–817 (2018). doi: 10.5194/hess-22-789-2018 35. V. Mohan, A. W. Western, Y. Wei, M. Saft, Predicting groundwater recharge for varying land cover and climate conditions – a global meta-study. Hydrol. Earth Syst. Sci. 22, 2689–2703 (2018). doi: 10.5194/hess-22-2689-2018 36. B. W. Abbott et al., Human domination of the global water cycle absent from depictions and perceptions. Nat. Geosci. 12, 533–540 (2019). doi: 10.1038/ s41561-019-0374-y 37. I. E. M. de Graaf, K. Stahl, A model comparison assessing the importance of lateral groundwater flows at the global scale. Environ. Res. Lett. 17, 044020 (2022). doi: 10.1088/ 1748-9326/ac50d2 38. R. G. Taylor et al., Evidence of the dependence of groundwater resources on extreme rainfall in East Africa. Nat. Clim. Chang. 3, 374–378 (2013). doi: 10.1038/nclimate1731 39. F. D. Tillman, S. Gangopadhyay, T. Pruitt, Changes in groundwater recharge under projected climate in the upper Colorado River basin. Geophys. Res. Lett. 43, 6968–6974 (2016). doi: 10.1002/2016GL069714 40. A. C. Amanambu et al., Groundwater system and climate change: Present status and future considerations. J. Hydrol. 589, 125163 (2020). doi: 10.1016/j.jhydrol.2020.125163 g 2. W. Aeschbach-Hertig, T. Gleeson, Regional strategies for the accelerating global problem of groundwater depletion. Nat. Geosci. 5, 853–861 (2012). doi: 10.1038/ngeo1617 T. Gleeson et al., Groundwater sustainability strategies. Nat. Geosci. 3, 378–379 (2010). doi: 10.1038/ngeo881 S. Siebert et al., Groundwater use for irrigation-a global inventory. Hydrol. Earth Syst. Sci. 14, 1863–1880 (2010). doi: 10.5194/hess-14-1863-2010 Y. Wada, L. P. H. van Beek, M. F. P. Bierkens, Nonsustainable groundwater sustaining irrigation: A global assessment. Water Resour. Res. 48, W00L06 (2012). doi: 10.1029/ 2011WR010562 B. R. Scanlon et al., Groundwater depletion and sustainability of irrigation in the US High Plains and Central Valley. Proc. Natl. Acad. Sci. U.S.A. 109, 9320–9325 (2012). doi: 10.1073/ pnas.1200311109; pmid: 22645352 M. Rodell et al., Emerging trends in global freshwater availability. Nature 557, 651–659 (2018). doi: 10.1038/ s41586-018-0123-1; pmid: 29769728 R. G. Taylor et al., Ground water and climate change. Nat. Clim. Chang. 3, 322–329 (2013). doi: 10.1038/nclimate1744 T. Gleeson, et al., Illuminating water cycle modifications and Earth system resilience in the Anthropocene. Water Resour. Res. 56, e2019WR024957 (2020). doi: 10.1038/nclimate1744 T. Oki, S. Kanae, Global hydrological cycles and world water resources. Science 313, 1068–1072 (2006). doi: 10.1126/ science.1128845; pmid: 16931749 A. M. DeAngelis, X. Qu, M. D. Zelinka, A. Hall, An observational radiative constraint on hydrologic cycle intensification. Nature 528, 249–253 (2015). doi: 10.1038/ nature15770; pmid: 26659186 M. O. Cuthbert et al., Global patterns and dynamics of climate-groundwater interactions. Nat. Clim. Chang. 9, 137–141 (2019). doi: 10.1038/s41558-018-0386-4 M. O. Cuthbert et al., Observed controls on resilience of groundwater to climate variability in sub-Saharan Africa. Nature 572, 230–234 (2019). doi: 10.1038/ s41586-019-1441-7; pmid: 31391559 A. F. Lutz et al., South Asian agriculture increasingly dependent on meltwater and groundwater. Nat. Clim. Chang. 12, 566–573 (2022). doi: 10.1038/s41558-022-01355-z R. Reinecke et al., Uncertainty of simulated groundwater recharge at different global warming levels: A global-scale multi-model ensemble study. Hydrol. Earth Syst. Sci. 25, 787–810 (2021). doi: 10.5194/hess-25-787-2021 H. D. Pritchard, Asia’s shrinking glaciers protect large populations from drought stress. Nature 569, 649–654 (2019). doi: 10.1038/s41586-019-1240-1; pmid: 31142854 R. Hugonnet et al., Accelerated global glacier mass loss in the early twenty-first century. Nature 592, 726–731 (2021). doi: 10.1038/s41586-021-03436-z; pmid: 33911269 17. p concern. In planning for a more sustainable future for water in an increasingly interconnected world, groundwater resources should be considered from both regional and global perspectives, especially in the case of large, transboundary groundwater systems (196). As global changes continue to affect these resources, it is imperative to manage groundwater and surface water as a single resource (98). Additionally, ensuring food and water security and maintaining ecosystem health must be addressed concurrently (197). There has been a growing global trend toward incorporating sustainability into groundwater laws, regulations, and policies (198, 199). Various management strategies, including forest and wetland conservation, desalination, wastewater recycling (98), managed aquifer recharge, water diversion projects, and green infrastructure development (200) are already being employed to bolster groundwater resilience, and will be critical to combat the growing problem of groundwater depletion globally.
RES EARCH | R E V I E W 61. 62. 63. 64. 65. 66. 67. 69. 70. 73. 74. 76. 79. 80. 81. Kuang et al., Science 383, eadf0630 (2024) 87. 88. 89. 90. 91. 92. 93. 94. 95. 96. 97. 98. 99. 100. 101. 102. 103. 104. 105. 106. 107. 1 March 2024 11 of 13 , 78. 86. y 77. 85. y g 75. 84. 108. S. Jasechko et al., Global aquifers dominated by fossil groundwaters but wells vulnerable to modern contamination. Nat. Geosci. 10, 425–429 (2017). doi: 10.1038/ngeo2943 109. P. D’Odorico et al., The global food-energy-water nexus. Rev. Geophys. 56, 456–531 (2018). doi: 10.1029/2017RG000591 110. M. GebreEgziabher, S. Jasechko, D. Perrone, M. GebreEgziabher, Widespread and increased drilling of wells into fossil aquifers in the USA. Nat. Commun. 13, 2129 (2022). doi: 10.1038/ s41467-022-29678-7; pmid: 35440593 111. Y. Wada et al., Past and future contribution of global groundwater depletion to sea-level rise. Geophys. Res. Lett. 39, L09402 (2012). doi: 10.1029/2012GL051230 112. I. E. M. de Graaf, T. Gleeson, L. P. H. Rens van Beek, E. H. Sutanudjaja, M. F. P. Bierkens, Environmental flow limits to global groundwater pumping. Nature 574, 90–94 (2019). doi: 10.1038/s41586-019-1594-4; pmid: 31578485 113. D. Perrone, S. Jasechko, Deeper well drilling an unsustainable stopgap to groundwater depletion. Nat. Sustain. 2, 773–782 (2019). doi: 10.1038/s41893-019-0325-z 114. S. Jasechko, D. Perrone, Global groundwater wells at risk of running dry. Science 372, 418–421 (2021). doi: 10.1126/ science.abc2755; pmid: 33888642 115. M.-H. Lo, J. S. Famiglietti, Irrigation in California’s Central Valley strengthens the southwestern U.S. water cycle. Geophys. Res. Lett. 40, 301–306 (2013). doi: 10.1002/ grl.50108 116. S. Jasechko, H. Seybold, D. Perrone, Y. Fan, J. W. Kirchner, Widespread potential loss of streamflow into underlying aquifers across the USA. Nature 591, 391–395 (2021). doi: 10.1038/s41586-021-03311-x; pmid: 33731949 117. J. C. McIntosh et al., A critical review of state-of-the-art and emerging approaches to identify fracking-derived gases and associated contaminants in aquifers. Environ. Sci. Technol. 53, 1063–1077 (2019). doi: 10.1021/acs. est.8b05807; pmid: 30585065 118. C. Zhong et al., Comparison of the hydraulic fracturing water cycle in China and North America. Environ. Sci. Technol. 55, 7167–7185 (2021). doi: 10.1021/acs.est.0c06119; pmid: 33970611 119. R. D. Vidic, S. L. Brantley, J. M. Vandenbossche, D. Yoxtheimer, J. D. Abad, Impact of shale gas development on regional water quality. Science 340, 1235009 (2013). doi: 10.1126/science.1235009; pmid: 23687049 120. A. J. Kondash, N. E. Lauer, A. Vengosh, The intensification of the water footprint of hydraulic fracturing. Sci. Adv. 4, eaar5982 (2018). doi: 10.1126/sciadv.aar5982; pmid: 30116777 121. B. R. Scanlon, R. C. Reedy, B. D. Wolaver, Assessing cumulative water impacts from shale oil and gas production: Permian Basin case study. Sci. Total Environ. 811, 152306 (2022). doi: 10.1016/j.scitotenv.2021.152306; pmid: 34906580 122. R. B. Jackson et al., The environmental costs and benefits of fracking. Annu. Rev. Environ. Resour. 39, 327–362 (2014). doi: 10.1146/annurev-environ-031113-144051 123. A. Kondash, A. Vengosh, Water footprint of hydraulic fracturing. Environ. Sci. Technol. Lett. 2, 276–280 (2015). doi: 10.1021/acs.estlett.5b00211 124. A. Vengosh, R. B. Jackson, N. Warner, T. H. Darrah, A. Kondash, A critical review of the risks to water resources from unconventional shale gas development and hydraulic fracturing in the United States. Environ. Sci. Technol. 48, 8334–8348 (2014). doi: 10.1021/es405118y; pmid: 24606408 125. L. Rosa, M. C. Rulli, K. F. Davis, P. D’Odorico, The waterenergy nexus of hydraulic fracturing: A global hydrologic analysis for shale oil and gas extraction. Earths Futur. 6, 745–756 (2018). doi: 10.1002/2018EF000809 126. B. R. Scanlon, R. C. Reedy, J. P. Nicot, Will water scarcity in semiarid regions limit hydraulic fracturing of shale plays? Environ. Res. Lett. 9, 124011 (2014). doi: 10.1088/1748-9326/ 9/12/124011 127. K. Jellicoe, J. C. McIntosh, G. Ferguson, Changes in deep groundwater flow patterns related to oil and gas activities. Groundwater 60, 47–63 (2022). doi: 10.1111/ gwat.13136; pmid: 34519028 128. C. Perra, J. C. McIntosh, T. Watson, G. Ferguson, Commingled fluids in abandoned boreholes: Proximity analysis of a hidden liability. Groundwater 60, 210–224 (2022). doi: 10.1111/gwat.13140; pmid: 34617284 129. W. G. P. Kumari, P. G. Ranjith, Sustainable development of enhanced geothermal systems based on geotechnical research-A review. Earth Sci. Rev. 199, 102955 (2019). doi: 10.1016/j.earscirev.2019.102955 y 72. 83. S. E. Chadburn et al., An observation-based constraint on permafrost loss as a function of global warming. Nat. Clim. Chang. 7, 340–343 (2017). doi: 10.1038/nclimate3262 G. Cheng, H. Jin, Permafrost and groundwater on the Qinghai-Tibet Plateau and in northeast China. Hydrogeol. J. 21, 5–23 (2013). doi: 10.1007/s10040-012-0927-2 M.-K. Woo, D. L. Kane, S. K. Carey, D. Yang, Progress in permafrost hydrology in the new millennium. Permafr. Periglac. Process. 19, 237–254 (2008). doi: 10.1002/ppp.613 L. C. Smith, T. M. Pavelsky, G. M. MacDonald, A. I. Shiklomanov, R. B. Lammers, Rising minimum daily flows in northern Eurasian rivers: A growing influence of groundwater in the high-latitude hydrologic cycle. J. Geophys. Res. 112, G04S47 (2007). doi: 10.1029/2006JG000327 X.-Y. Jin et al., Impacts of climate-induced permafrost degradation on vegetation: A review. Adv. Clim. Chang. Res. 12, 29–47 (2021). doi: 10.1016/j.accre.2020.07.002 P. Wang et al., Potential role of permafrost thaw on increasing Siberian river discharge. Environ. Res. Lett. 16, 034046 (2021). doi: 10.1088/1748-9326/abe326 S. G. Evans, S. Ge, S. Liang, Analysis of groundwater flow in mountainous, headwater catchments with permafrost. Water Resour. Res. 51, 9564–9576 (2015). doi: 10.1002/ 2015WR017732 T. Gleeson, Y. Wada, M. F. P. Bierkens, L. P. H. van Beek, Water balance of global aquifers revealed by groundwater footprint. Nature 488, 197–200 (2012). doi: 10.1038/ nature11295; pmid: 22874965 A. S. Richey et al., Quantifying renewable groundwater stress with GRACE. Water Resour. Res. 51, 5217–5238 (2015). doi: 10.1002/2015WR017349; pmid: 26900185 J. Margat, J. van der Gun, Groundwater Around the World (CRC Press, 2013). doi: 10.1201/b13977 Y. Wada, M. F. P. Bierkens, Sustainability of global water use: Past reconstruction and future projections. Environ. Res. Lett. 9, 104003 (2014). doi: 10.1088/1748-9326/9/10/104003 I. E. M. de Graaf et al., A global-scale two-layer transient groundwater model: Development and application to groundwater depletion. Adv. Water Resour. 102, 53–67 (2017). doi: 10.1016/j.advwatres.2017.01.011 UNESCO. Groundwater making the invisible visible (The United Nations World Water Development Report, 2022) J. S. Famiglietti, The global groundwater crisis. Nat. Clim. Chang. 4, 945–948 (2014). doi: 10.1038/nclimate2425 L. E. Condon, R. M. Maxwell, Simulating the sensitivity of evapotranspiration and streamflow to large-scale groundwater depletion. Sci. Adv. 5, eaav4574 (2019). doi: 10.1126/sciadv.aav4574; pmid: 31223647 L. Konikow, Overestimated water storage. Nat. Geosci. 6, 3 (2013). doi: 10.1038/ngeo1659 B. R. Scanlon et al., Global water resources and the role of groundwater in a resilient water future. Nat. Rev. Earth Environ. 4, 87–101 (2023). doi: 10.1038/s43017-022-00378-6 M. Rodell, I. Velicogna, J. S. Famiglietti, Satellite-based estimates of groundwater depletion in India. Nature 460, 999–1002 (2009). doi: 10.1038/nature08238; pmid: 19675570 M. R. Khan et al., Megacity pumping and preferential flow threaten groundwater quality. Nat. Commun. 7, 12833 (2016). doi: 10.1038/ncomms12833; pmid: 27673729 WRI (World Resources Institute), Aqueduct: Using cuttingedge data to identify and evaluate water risks around the world. www.wri.org/aqueduct. K. Zhang, X. Li, D. Zheng, L. Zhang, G. Zhu, Estimation of global irrigation water use by the integration of multiple satellite observations. Water Resour. Res. 58, e2021WR030031 (2022). doi: 10.1038/ncomms12833; pmid: 27673729 L. F. Konikow, Contribution of global groundwater depletion since 1900 to sea-level rise. Geophys. Res. Lett. 38, L17401 (2011). doi: 10.1029/2011GL048604 A. M. MacDonald et al., Groundwater quality and depletion in the Indo-Gangetic Basin mapped from in situ observations. Nat. Geosci. 9, 762–766 (2016). doi: 10.1038/ngeo2791 J. S. Famiglietti et al., Satellites measure recent rates of groundwater depletion in California’s Central Valley. Geophys. Res. Lett. 38, L03403 (2011). doi: 10.1029/2010GL046442 M. Lancia et al., The China groundwater crisis: A mechanistic analysis with implications for global sustainability. Sustain. Horiz. 4, 100042 (2022). doi: 10.1016/j.horiz.2022.100042 G. Ferguson, M. O. Cuthbert, K. Befus, T. Gleeson, J. C. McIntosh, Rethinking groundwater age. Nat. Geosci. 13, 592–594 (2020). doi: 10.1038/s41561-020-0629-7 g 71. 82. p 68. D. B. Jones, S. Harrison, K. Anderson, W. B. Whalley, Rock glaciers and mountain hydrology: A review. Earth Sci. Rev. 193, 66–90 (2019). doi: 10.1016/j.earscirev.2019.04.001 S. T. Geiger, J. M. Daniels, S. N. Miller, J. W. Nicholas, Influence of rock glaciers on stream hydrology in the La Sal Mountains, Utah. Arct. Antarct. Alp. Res. 46, 645–658 (2014). doi: 10.1657/1938-4246-46.3.645 J. S. Harrington, A. Mozil, M. Hayashi, L. R. Bentley, Groundwater flow and storage processes in an inactive rock glacier. Hydrol. Processes 32, 3070–3088 (2018). doi: 10.1002/hyp.13248 M. Hayashi, Alpine hydrogeology: The critical role of groundwater in sourcing the headwaters of the world. Ground Water 58, 498–510 (2020). doi: 10.1111/gwat.12965; pmid: 31762021 M. Cochand, P. Christe, P. Ornstein, D. Hunkeler, Groundwater storage in high alpine catchments and its contribution to streamflow. Water Resour. Res. 55, 2613–2630 (2019). doi: 10.1029/2018WR022989 J. Obu, How much of the Earth's surface is underlain by permafrost? J. Geophys. Res.-Earth Surf. 126, e2021JF006123 (2021). doi: 10.1029/2018WR022989 Y. Ran et al., New high-resolution estimates of the permafrost thermal state and hydrothermal conditions over the Northern Hemisphere. Earth Syst. Sci. Data 14, 865–884 (2022). doi: 10.5194/essd-14-865-2022 S. L. Smith, H. B. O’Neill, K. Isaksen, J. Noetzli, V. E. Romanovsky, The changing thermal state of permafrost. Nat. Rev. Earth Environ. 3, 10–23 (2022). doi: 10.1038/s43017-021-00240-1 D. Zhao et al., Changing climate and the permafrost environment on the Qinghai-Tibet (Xizang) plateau. Permafr. Periglac. Process. 31, 396–405 (2020). doi: 10.1002/ ppp.2056 Y. Ran, X. Li, G. Cheng, Climate warming over the past half century has led to thermal degradation of permafrost on the Qinghai–Tibet Plateau. Cryosphere 12, 595–608 (2018). doi: 10.5194/tc-12-595-2018 M. Rogger et al., Impact of mountain permafrost on flow path and runoff response in a high alpine catchment. Water Resour. Res. 53, 1288–1308 (2017). doi: 10.1002/ 2016WR019341 M. A. Walvoord, C. I. Voss, B. A. Ebel, B. J. Minsley, Development of perennial thaw zones in boreal hillslopes enhances potential mobilization of permafrost carbon. Environ. Res. Lett. 14, 015003 (2019). doi: 10.1088/ 1748-9326/aaf0cc V. F. Bense, G. Ferguson, H. Kooi, Evolution of shallow groundwater flow systems in areas of degrading permafrost. Geophys. Res. Lett. 36, L22401 (2009). doi: 10.1029/ 2009GL039225 W. Yi et al., Increasing annual streamflow and groundwater storage in response to climate warming in the Yangtze River source region. Environ. Res. Lett. 16, 084011 (2021). doi: 10.1088/1748-9326/ac0f27 S. Ge, J. McKenzie, C. Voss, Q. Wu, Exchange of groundwater and surface-water mediated by permafrost response to seasonal and long term air temperature variation. Geophys. Res. Lett. 38, L14402 (2011). doi: 10.1029/ 2011GL047911 S. G. Evans, B. Yokeley, C. Stephens, B. Brewer, Potential mechanistic causes of increased baseflow across northern Eurasia catchments underlain by permafrost. Hydrol. Processes 34, 2676–2690 (2020). doi: 10.1002/hyp.13759 S. N. Wright et al., Thaw-induced impacts on land and water in discontinuous permafrost: A review of the Taiga Plains and Taiga Shield, northwestern Canada. Earth Sci. Rev. 232, 104104 (2022). doi: 10.1016/ j.earscirev.2022.104104 B. L. Kurylyk, K. T. B. MacQuarrie, J. M. McKenzie, Climate change impacts on groundwater and soil temperatures in cold and temperate regions: Implications, mathematical theory, and emerging simulation tools. Earth Sci. Rev. 138, 313–334 (2014). doi: 10.1016/j.earscirev.2014.06.006 M. A. Walvoord, B. L. Kurylyk, Hydrologic impacts of thawing permafrost: A review. Vadose Zone J. 15, 1–20 (2016). doi: 10.2136/vzj2016.01.0010 J. M. Scheidegger, V. F. Bense, Impacts of glacially recharged groundwater flow systems on talik evolution. J. Geophys. Res. Earth Surf. 119, 758–778 (2014). doi: 10.1002/ 2013JF002894 J. M. McKenzie, C. I. Voss, Permafrost thaw in a nested groundwater-flow system. Hydrogeol. J. 21, 299–316 (2013). doi: 10.1007/s10040-012-0942-3
RES EARCH | R E V I E W 174. 175. 176. 177. 178. 179. 180. 181. 182. 183. 184. 185. 186. 188. 191. 192. 193. 194. 12 of 13 , 190. y 189. y g 187. y 1 March 2024 173. Hydrol. Process. 22, 1857–1865 (2008). doi: 10.1002/ hyp.6768 J. J. Jiao, C.-M. Leung, G. Ding, Changes to the groundwater system, from 1888 to present, in a highly-urbanized coastal area in Hong Kong, China. Hydrogeol. J. 16, 1527–1539 (2008). doi: 10.1007/s10040-008-0332-z I. Tubau, E. Vázquez-Suñé, J. Carrera, C. Valhondo, R. Criollo, Quantification of groundwater recharge in urban environments. Sci. Total Environ. 592, 391–402 (2017). doi: 10.1016/j.scitotenv.2017.03.118; pmid: 28324856 F. La Vigna, Review: Urban groundwater issues and resource management, and their roles in the resilience of cities. Hydrogeol. J. 30, 1657–1683 (2022). doi: 10.1007/ s10040-022-02517-1 C. Dalin, Y. Wada, T. Kastner, M. J. Puma, Groundwater depletion embedded in international food trade. Nature 543, 700–704 (2017). doi: 10.1038/nature21403; pmid: 28358074 C. Dalin, M. Taniguchi, T. R. Green, Unsustainable groundwater use for global food production and related international trade. Glob. Sustain. 2, e12 (2019). doi: 10.1017/sus.2019.7 L. Marston, M. Konar, X. Cai, T. J. Troy, Virtual groundwater transfers from overexploited aquifers in the United States. Proc. Natl. Acad. Sci. U.S.A. 112, 8561–8566 (2015). doi: 10.1073/pnas.1500457112; pmid: 26124137 S. Gumidyala et al., Groundwater depletion embedded in domestic transfers and international exports of the United States. Water Resour. Res. 56, e2019WR024986 (2020). doi: 10.1038/s41893-019-0287-1 A. V. Pastor et al., The global nexus of food-trade-water sustaining environmental flows by 2050. Nat. Sustain. 2, 499–507 (2019). doi: 10.1038/s41893-019-0287-1 P. D’Odorico et al., Global virtual water trade and the hydrological cycle: Patterns, drivers, and socio-environmental impacts. Environ. Res. Lett. 14, 053001 (2019). doi: 10.1088/ 1748-9326/ab05f4 L. Rosa, D. D. Chiarelli, C. Tu, M. C. Rulli, P. D’Odorico, Global unsustainable virtual water flows in agriculture trade. Environ. Res. Lett. 14, 114001 (2019). doi: 10.1088/ 1748-9326/ab4bfc T. Frederikse et al., The causes of sea-level rise since 1900. Nature 584, 393–397 (2020). doi: 10.1038/ s41586-020-2591-3; pmid: 32814886 M. Shirzaei et al., Measuring, modelling and projecting coastal land subsidence. Nat. Rev. Earth Environ. 2, 40–58 (2021). doi: 10.1038/s43017-020-00115-x D. Cáceres et al., Assessing global water mass transfers from continents to oceans over the period 1948-2016. Hydrol. Earth Syst. Sci. 24, 4831–4851 (2020). doi: 10.5194/ hess-24-4831-2020 R. J. Nicholls, A. Cazenave, Sea-level rise and its impact on coastal zones. Science 328, 1517–1520 (2010). doi: 10.1126/ science.1185782; pmid: 20558707 Y. Wada et al., Fate of water pumped from underground and contributions to sea-level rise. Nat. Clim. Chang. 6, 777–780 (2016). doi: 10.1038/nclimate3001 Y. Wada et al., Recent changes in land water storage and its contribution to sea level variations. Surv. Geophys. 38, 131–152 (2017). doi: 10.1007/s10712-016-9399-6; pmid: 32269399 H. Ketabchi, D. Mahmoodzadeh, B. Ataie-Ashtiani, C. T. Simmons, Sea-level rise impacts on seawater intrusion in costal aquifers: Review and integration. J. Hydrol. 535, 235–255 (2016). doi: 10.1016/j.jhydrol.2016.01.083 T. Cao, D. Han, X. Song, Past, present, and future of global seawater intrusion research: A bibliometric analysis. J. Hydrol. 603, 126844 (2021). doi: 10.1016/ j.jhydrol.2021.126844 G. Ferguson, T. Gleeson, Vulnerability of coastal aquifers to groundwater use and climate change. Nat. Clim. Chang. 2, 342–345 (2012). doi: 10.1038/nclimate1413 K. M. Befus, P. L. Barnard, D. J. Hoover, J. A. F. Hart, C. I. Voss, Increasing threat of coastal groundwater hazards from sea-level rise in California. Nat. Clim. Chang. 10, 946–952 (2020). doi: 10.1038/s41558-020-0874-1 D. J. Hoover, K. O. Odigie, P. W. Swarzenski, P. Barnard, Sea-level rise and coastal groundwater inundation and shoaling at select sites in California, USA. J. Hydrol. Reg. Stud. 11, 234–249 (2017). doi: 10.1016/j.ejrh.2015.12.055 S. Habel, C. H. Fletcher, K. Rotzoll, A. I. El-Kadi, Development of a model to simulate groundwater inundation induced by g Kuang et al., Science 383, eadf0630 (2024) 151. X. He et al., Climate-informed hydrologic modeling and policy typology to guide managed aquifer recharge. Sci. Adv. 7, eabe6025 (2021). doi: 10.1126/sciadv.abe6025; pmid: 33883132 152. E. F. Escalante, J. D. H. Casas, J. S. S. Sauto, R. C. Gil, Monitored and intentional recharge (MIR): A model for managed aquifer recharge (MAR) guideline and regulation formulation. Water 14, 3405 (2022). doi: 10.3390/w14213405 153. X.-P. Song et al., Global land change from 1982 to 2016. Nature 560, 639–643 (2018). doi: 10.1038/s41586-018-0411-9; pmid: 30089903 154. R. B. Jackson et al., Trading water for carbon with biological carbon sequestration. Science 310, 1944–1947 (2005). doi: 10.1126/science.1119282; pmid: 16373572 155. A. J. H. van Dijke et al., Shifts in regional water availability due to global tree restoration. Nat. Geosci. 15, 363–368 (2022). doi: 10.1038/s41561-022-00935-0 156. J. Jones et al., Forest restoration and hydrology. For. Ecol. Manage. 520, 120342 (2022). doi: 10.1016/ j.foreco.2022.120342 157. C. Lu, T. Zhao, X. Shi, S. Cao, Ecological restoration by afforestation may increase groundwater depth and create potentially large ecological and water opportunity costs in arid and semiarid China. J. Clean. Prod. 176, 1213–1222 (2018). doi: 10.1016/j.jclepro.2016.03.046 158. G. Chen et al., Evaluating potential groundwater recharge in the unsteady state for deep-rooted afforestation in deep loess deposits. Sci. Total Environ. 858, 159837 (2023). doi: 10.1016/j.scitotenv.2022.159837; pmid: 36411672 159. T. Huang, Z. Pang, S. Yang, L. Yin, Impact of afforestation on atmospheric recharge to groundwater in a semiarid area. J. Geophys. Res.-Atmos. 125, e2019JD032185 (2020). doi: 10.1016/j.scitotenv.2021.146336; pmid: 34030299 160. Z. Zhang et al., Salix psammophila afforestations can cause a decline of the water table, prevent groundwater recharge and reduce effective infiltration. Sci. Total Environ. 780, 146336 (2021). doi: 10.1016/j.scitotenv.2021.146336; pmid: 34030299 161. Y. Li et al., Divergent hydrological response to large-scale afforestation and vegetation greening in China. Sci. Adv. 4, eaar4182 (2018). doi: 10.1126/sciadv.aar4182; pmid: 29750196 162. X. Feng et al., Revegetation in China’s Loess Plateau is approaching sustainable water resource limits. Nat. Clim. Chang. 6, 1019–1022 (2016). doi: 10.1038/nclimate3092 163. L. Hu, J. J. Jiao, Modeling the influences of land reclamation on groundwater systems: A case study in Shekou peninsula, Shenzhen, China. Eng. Geol. 114, 144–153 (2010). doi: 10.1016/j.enggeo.2010.04.011 164. L. Hu, J. J. Jiao, H. Guo, Analytical studies on transient groundwater flow induced by land reclamation. Water Resour. Res. 44, W11427 (2008). doi: 10.1029/2008WR006926 165. H. Guo, J. J. Jiao, Impact of coastal land reclamation on ground water level and the sea water interface. Ground Water 45, 362–367 (2007). doi: 10.1111/j.1745-6584.2006.00290.x; pmid: 17470125 166. C. Sheng, J. J. Jiao, H. Xu, Y. Liu, X. Luo, Influence of land reclamation on fresh groundwater lenses in oceanic islands: Laboratory and numerical validation. Water Resour. Res. 57, e2021WR030238 (2021). doi: 10.1111/j.1745-6584.2006.00290.x; pmid: 17470125 167. E. Pujades, A. Jurado, Groundwater-related aspects during the development of deep excavations below the water table: A short review. Undergr. Space 6, 35–45 (2021). doi: 10.1016/ j.undsp.2019.10.002 168. Y.-X. Wu, S.-L. Shen, D.-J. Yuan, Characteristics of dewatering induced drawdown curve under blocking effect of retaining wall in aquifer. J. Hydrol. 539, 554–566 (2016). doi: 10.1016/ j.jhydrol.2016.05.065 169. E. Pujades, A. López, J. Carrera, E. Vázquez-Suñé, A. Jurado, Barrirer effect of underground structures on aquifers. Eng. Geol. 145-146, 41–49 (2012). doi: 10.1016/ j.enggeo.2012.07.004 170. G. Attard, T. Winiarski, Y. Rossier, L. Eisenlohr, Review: Impact of underground structures on the flow of urban groundwater. Hydrogeol. J. 24, 5–19 (2016). doi: 10.1007/ s10040-015-1317-3 171. J. Bonneau, T. D. Fletcher, J. F. Costelloe, M. J. Burns, Stormwater infiltration and the ‘urban karst’-A review. J. Hydrol. 552, 141–150 (2017). doi: 10.1016/ j.jhydrol.2017.06.043 172. G. Ding, J. J. Jiao, D. Zhang, Modelling study on the impact of deep building foundations on the groundwater system. p 130. R. Bertani, Geothermal power generation in the world 2010-2014 update report. Geothermics 60, 31–43 (2016). doi: 10.1016/j.geothermics.2015.11.003 131. J. W. Lund, T. L. Boyd, Direct utilization of geothermal energy 2015 worldwide review. Geothermics 60, 66–93 (2016). doi: 10.1016/j.geothermics.2015.11.004 132. J. W. Lund, A. N. Toth, Direct utilization of geothermal energy 2020 worldwide review. Geothermics 90, 101915 (2021). doi: 10.1016/j.geothermics.2020.101915 133. S. Chen, Q. Zhang, P. Andrews-Speed, B. Mclellan, Quantitative assessment of the environmental risks of geothermal energy: A review. J. Environ. Manage. 276, 111287 (2020). doi: 10.1016/j.jenvman.2020.111287; pmid: 32877889 134. F. Parisio, V. Vilarrasa, W. Wang, O. Kolditz, T. Nagel, The risks of long-term re-injection in supercritical geothermal systems. Nat. Commun. 10, 4391 (2019). doi: 10.1038/ s41467-019-12146-0; pmid: 31558715 135. L. Jiang, L. Zhu, E. Hiltunen, Large-scale geo-energy development: Sustainability impacts. Front. Energy 13, 757–763 (2019). doi: 10.1007/s11708-017-0455-9 136. C. W. Johnson, E. J. Totten, R. Bürgmann, Depth migration of seasonally induced seismicity at The Geysers geothermal field. Geophys. Res. Lett. 43, 6196–6204 (2016). doi: 10.1002/2016GL069546 137. W. Luo, A. Kottsova, P. J. Vardon, A. C. Dieudonne, M. Brehme, Mechanisms causing injectivity decline and enhancement in geothermal projects. Renew. Sustain. Energy Rev. 185, 113623 (2023). doi: 10.1016/j.rser.2023.113623 138. E. Gómez-Díaz, S. Scott, T. Ratouis, J. Newson, Numerical modeling of reinjection and tracer transport in a shallow aquifer, Nesjavellir Geothermal System, Iceland. Geotherm. Energy 10, 7 (2022). doi: 10.1186/s40517022-00217-3 139. R. Duggal et al., A comprehensive review of energy extraction from low-temperature geothermal resources in hydrocarbon fields. Renew. Sustain. Energy Rev. 154, 111865 (2022). doi: 10.1016/j.rser.2021.111865 140. P. Dillon, Future management of aquifer recharge. Hydrogeol. J. 13, 313–316 (2005). doi: 10.1007/s10040004-0413-6 141. C. Sprenger et al., Inventory of managed aquifer recharge sites in Europe: Historical development, current situation and perspectives. Hydrogeol. J. 25, 1909–1922 (2017). doi: 10.1007/s10040-017-1554-8 142. G. Ebrahim, J. F. Lautze, K. G. Villholth, Managed aquifer recharge in Africa: Taking stock and looking forward. Water 12, 1844 (2020). doi: 10.3390/w12071844 143. C. Stefan, N. Ansems, Web-based global inventory of managed aquifer recharge applications. Sustain. Water Resour. Manag. 4, 153–162 (2018). doi: 10.1007/ s40899-017-0212-6 144. S. Alam, A. Borthakur, S. Ravi, M. Gebremichael, S. K. Mohanty, Managed aquifer recharge implementation criteria to achieve water sustainability. Sci. Total Environ. 768, 144992 (2021). doi: 10.1016/j.scitotenv.2021.144992; pmid: 33736333 145. S. Sloan, P. G. Cook, I. Wallis, Managed aquifer recharge in mining: A review. Groundwater 61, 305–317 (2023). doi: 10.1111/gwat.13311; pmid: 36950867 146. N. Ulibarri, N. E. Garcia, R. L. Nelson, A. E. Cravens, R. J. McCarty, Assessing the feasibility of managed aquifer recharge in California. Water Resour. Res. 57, e2020WR029292 (2021). doi: 10.1111/gwat.13311; pmid: 36950867 147. B. R. Scanlon, R. C. Reedy, C. C. Faunt, D. Pool, K. Uhlman, Enhancing drought resilience with conjunctive use and managed aquifer recharge in California and Arizona. Environ. Res. Lett. 11, 035013 (2016). doi: 10.1088/ 1748-9326/11/3/035013 148. E. Levintal et al., Agricultural managed aquifer recharge (Ag-MAR)—a method for sustainable groundwater management: A review. Crit. Rev. Environ. Sci. Technol. 53, 291–314 (2023). doi: 10.1080/10643389.2022.2050160 149. S. Alam, M. Gebremichael, R. Li, J. Dozier, D. P. Lettenmaier, Can managed aquifer recharge mitigate the groundwater overdraft in California's Central Valley? Water Resour. Res. 56, e2020WR027244 (2020). doi: 10.1088/1748-9326/ abcfe1 150. D. E. Wendt, A. F. Van Loon, B. R. Scanlon, D. M. Hannah, Managed aquifer recharge as a drought mitigation strategy in heavily-stressed aquifers. Environ. Res. Lett. 16, 014046 (2021). doi: 10.1088/1748-9326/abcfe1
RES EARCH | R E V I E W 195. 196. 197. 198. sea-level rise and high tides in Honolulu, Hawaii. Water Res. 114, 122–134 (2017). doi: 10.1016/j.watres.2017.02.035; pmid: 28229950 Y. Wang, C. Zheng, R. Ma, Review: Safe and sustainable groundwater supply in China. Hydrogeol. J. 26, 1301–1324 (2018). doi: 10.1007/s10040-018-1795-1 T. Gleeson, M. Cuthbert, G. Ferguson, D. Perrone, Global groundwater sustainability, resources, and systems in the Anthropocene. Annu. Rev. Earth Planet. Sci. 48, 431–463 (2020). doi: 10.1146/annurev-earth-071719-055251 S. M. Gorelick, C. Zheng, Global change and the groundwater management challenge. Water Resour. Res. 51, 3031–3051 (2015). doi: 10.1002/2014WR016825 A. S. Elshall et al., Groundwater sustainability: A review of the interactions between science and policy. Environ. Res. Lett. 15, 093004 (2020). doi: 10.1088/ 1748-9326/ab8e8c 199. E. Stokstad, Deep deficit. Science 368, 230–233 (2020). doi: 10.1126/science.368.6488.230; pmid: 32299932 200. M. A. Palmer, J. Liu, J. H. Matthews, M. Mumba, P. D’Odorico, Manage water in a green way. Science 349, 584–585 (2015). doi: 10.1126/science.aac7778; pmid: 26250670 ACKN OWLED GMEN TS We thank three anonymous reviewers for their constructive comments and suggestions that have led to significant improvement of this work. Funding: This work was supported by the following: National Natural Science Foundation of China grants 92047202 and 91747204 (to X.K.), Guangdong Provincial Key Laboratory of Soil and Groundwater Pollution Control (2023B1212060002) and Ministry of Education of the People's Republic of China (D20020) (to C.Z.), Strategic Priority Research Program of the Chinese Academy of Sciences grant XDA20060402 and Shenzhen Science and Technology Program grant KCXFZ20201221173601003 (to J.L.) Author contributions: C.Z, X.K., and J.L. conceptualized the study. X.K. wrote the initial manuscript; J.J.J., C.Z., J.L., B.K.B., Y.W., B.R.S., S.J. T.G., and J.-P. N. reviewed and edited the manuscript. All authors made substantial contributions to discussions of the content of the manuscript. Competing interests: Authors declare that they have no competing interests. Data availability: All data presented here are based on previously published studies that are cited in the review. License information: Copyright © 2024 the authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original US government works. https: per per www.sciencemag.org per about per sciencelicenses-journal-article-reuse Submitted 27 September 2022; accepted 5 January 2024 10.1126/science.adf0630 p g y y g y , Kuang et al., Science 383, eadf0630 (2024) 1 March 2024 13 of 13
RES EARCH RESEARCH ARTICLE SUMMARY ◥ INNATE IMMUNITY Native architecture of a human GBP1 defense complex for cell-autonomous immunity to infection Shiwei Zhu†, Clinton J. Bradfield†, Agnieszka Maminska†, Eui-Soon Park†, Bae-Hoon Kim†, Pradeep Kumar, Shuai Huang, Minjeong Kim, Yongdeng Zhang, Joerg Bewersdorf, John D. MacMicking* complex assembled directly on Stm inside human cells. This defense complex comprised RATIONALE: Since their discovery in the phys- ical assembly of antimicrobial and innate im- Extended GBP1 conformers Human GBP1 defense complex Bacterial LPS Architecture of a human GBP1 defense complex. (Left) 3D reconstruction of human GBP1 on the outer membrane (OM) of Salmonella bacteria from cryo-ET. IM, inner membrane. Size of scale bar shown in Angstroms. (Right) Pseudomodel showing the extended upright GBP1 conformer inserting into the OM LPS layer. Release of LPS by GBP1 insertion subsequently activated caspase-4 following its coassembly on the same bacterial surface. Zhu et al., Science 383, 965 (2024) 1 March 2024 ▪ The list of author affiliations is available in the full article online. *Corresponding author. Email: john.macmicking@yale.edu †These authors contributed equally to this work. Cite this article as S. Zhu et al., Science 383, eabm9903 (2024). DOI: 10.1126/science.abm9903 READ THE FULL ARTICLE AT https://doi.org/10.1126/science.abm9903 1 of 1 , Bacterial IM y Bacterial ribosomes nate immune signaling cascades is the higher-order assembly of repetitive protein units that generate large polymers capable of amplifying signal transduction. Our results identify human GBP1 as the principal repetitive unit, numbering thousands of proteins per bacillus, that undergoes dramatic conformational opening to establish a host defense platform directly on the surface of gram-negative bacteria. This platform enabled the recruitment of other immune partners, including GBP family members and components of the inflammasome pathway, that initiate protective responses downstream of activating cytokines such as interferon-g. Elucidating this giant molecular structure not only expands our understanding of how human cells recognize and combat infection but may also have implication for antibacterial approaches within the human population. y g 200 Å 200 Å Bacterial OM y CONCLUSION: An emerging paradigm for inRESULTS: We identified a multiprotein defense Salmonella g mune signaling complexes over a decade ago, guanylate-binding proteins (GBPs) have emerged as major organizers of intracellular host defense to a broad array of bacteria, viruses, or parasites in animals and plants. In mammals, these large dynamin-like guanosine triphosphatases (GTPases) relocate to intracellular pathogens, where they can establish macromolecular assemblies on the microbial outer membrane (OM) that serve as interactive hubs for inflammatory proteins or bactericidal effectors as part of the cell-autonomous innate immune response. To better understand the mechanistic details underlying these distinct hybrid structures, we enlisted host and bacterial genetics plus single-particle nanoscopy and cryo–electron tomography (cryo-ET) to visualize GBP defense complexes on the surface of a gram-negative bacterial pathogen, Salmonella enterica serovar Typhimurium (Stm), within the cytosol of human cells. p INTRODUCTION: The compartmentalized landscape of eukaryotic cells offers a wide variety of intracellular niches for microbial pathogens to hide and replicate. Consequently, eukaryotes have evolved compartment-specific immune surveillance mechanisms that alert the host to infection and recruit antimicrobial proteins that help bring microbial replication under control. Many of these host defense proteins form giant macromolecular complexes when encountering either pathogens or their products to amplify innate immune signaling and spatially localize protein partners at the site of microbial recognition. In some cases, complete signaling cascades are built directly upon the invading pathogen itself, a distinctive situation in which a large foreign object acts as the anchoring platform for assembling the entire host defense machinery. How these massive host-pathogen platforms are initiated and structurally organized at the molecular level remains unknown. four members of the human GBP family (GBP1, GBP2, GBP3, and GBP4) together with human caspase-4 and one of its natural substrates, full-length Gasdermin D (GSDMD). It triggered innate immune signaling through caspase-4 cleavage of GSDMD into its pore-forming subunits, resulting in the extracellular release of an immune cytokine, interleukin-18 (IL-18), and pyroptotic cell death needed for protection against this bacterial pathogen. Notably, human GBP1 was obligate for initiating the entire signaling cascade; its genetic removal prevented the remaining immune proteins being recruited onto the gram-negative bacterial surface. C-terminal anchorage and GTPase-driven self-assembly enabled GBP1 to bind to and polymerize over the surface of cytosolic Stm to establish the recruitment platform. Nearly 30,000 GBP1 molecules were assembled in just a few minutes. Reconstitution of this massive GBP1 defense complex with a bacterial minicell system allowed cryo-ET visualization of the entire coat structure in its native state. Within this native platform, individual GBP1 dimers were found to adopt an open conformation for vertical insertion into the bacterial OM through their extended C-terminal lipidated tail. Anchorage of the upright GBP1 conformer led to OM disruption, which released the gram-negative cell wall component, lipopolysaccharide (LPS), to activate coassembled caspase-4.
RES EARCH RESEARCH ARTICLE ◥ INNATE IMMUNITY Native architecture of a human GBP1 defense complex for cell-autonomous immunity to infection Shiwei Zhu1,2,3,4†‡, Clinton J. Bradfield1,2,3,4†§, Agnieszka Maminska1,2,3,4†, Eui-Soon Park1,2,3,4†, Bae-Hoon Kim1,2,3,4†¶#, Pradeep Kumar1,2,3,4, Shuai Huang1,2,3,4**, Minjeong Kim1,2,3,4, Yongdeng Zhang5††, Joerg Bewersdorf5,6, John D. MacMicking1,2,3,4* 1 March 2024 1 of 18 , Zhu et al., Science 383, eabm9903 (2024) y *Corresponding author. Email: john.macmicking@yale.edu †These authors contributed equally to this work. ‡Present address: Department of Physiology & Biophysics, Case Western Reserve University School of Medicine, Cleveland, OH, USA. §Present address: Signaling Systems Section, Laboratory of Immune System Biology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, MD, USA. ¶Present address: Rare Disease R&D Center, PRG Science and Technology Co. Ltd., Pusan, Republic of Korea. #Present address: Department of Molecular Biology, College of Natural Sciences, Pusan National University, Pusan, Republic of Korea. **Present address: Department of Molecular Genetics, The Ohio State University, Columbus, OH, USA. ††Present address: School of Life Sciences, Westlake University, Hangzhou, Zhejiang, PR China. y g Howard Hughes Medical Institute, Yale University School of Medicine, New Haven, CT 06510, USA. 2Yale Systems Biology Institute, West Haven, CT 06477, USA. 3Department of Microbial Pathogenesis, Yale University School of Medicine, New Haven, CT 06510, USA. 4Department of Immunobiology, Yale University School of Medicine, New Haven, CT 06510, USA. 5Department of Cell Biology, Yale University School of Medicine, New Haven, CT 06510, USA. 6 Yale Nanobiology Institute, West Haven, CT 06477, USA. y 1 This ability to generate extended, filamentous signaling platforms stems in part from the modularity of the proteins involved. Signalosome proteins often harbor leucine-rich repeat domains, caspase activation and recruitment domains (CARDs), or death effector domains that concentrate receptors, adaptors, and effectors through cooperativity (3). As a result, they yield some of the most iconic and visible structures inside immune-activated cells. These include retinoic acid–inducible gene I filaments and mitochondrial antiviral-signaling protein prion-like structures that control RNA sensing; CARD and nucleotide-binding domain, leucine-rich (NLR)–containing protein filaments as part of the inflammasome machinery; Myddosomes orchestrating nuclear factor kB and interferon (IFN) regulatory factor signaling; and NLR HOPZ-ACTIVATED RESISTANCE 1 pentamers that underpin the plant resistosome (3–6). Collectively, these large polymeric structures represent an increasingly pervasive paradigm for cell-autonomous innate immunity throughout metazoan evolution. Their mode of assembly differs from that of classical antigen or immunoglobulin signaling at the plasma membrane, which are typically transmitted through clustered synapses (3). To this list can now be added members of a dynamin-like guanosine triphosphatase (GTPase) family termed guanylate-binding proteins (GBPs), which undergo polymerization for generating innate immune signaling platforms and coordinating local antimicrobial activity. GBPs assemble into large multimeric structures inside Arabidopsis, zebrafish, mouse, and human cells, in some cases using phase-separation to further concentrate homotypic complexes (7–12). In plants, the 69- to 122-kDa GBP-like proteins g I n biological systems, environmental cues are often sensed by ligand-induced allosteric changes in cell surface receptors that rapidly transmit signals to the interior for mobilizing the desired physiological response. Within the cell-autonomous defense systems of plants and animals (1, 2), additional modalities are used to decode the outside world, including intracellular protein assemblies formed through helical symmetry (3, 4). These higherorder assemblies amplify innate immune signals through protein polymerization or “prionization” events to facilitate proximity-induced autoactivation of latent zymogens, caspases, and kinases. The benefits to such repetitive design are manifold: lowered signaling thresholds, all-or-none responsivity, and stable signalosome platforms that can recruit and accommodate numerous protein partners (3). p All living organisms deploy cell-autonomous defenses to combat infection. In plants and animals, large supramolecular complexes often activate immune proteins for protection. In this work, we resolved the native structure of a massive host-defense complex that polymerizes 30,000 guanylate-binding proteins (GBPs) over the surface of gram-negative bacteria inside human cells. Construction of this giant nanomachine took several minutes and remained stable for hours, required guanosine triphosphate hydrolysis, and recruited four GBPs plus caspase-4 and Gasdermin D as a cytokine and cell death immune signaling platform. Cryo–electron tomography suggests that GBP1 can adopt an extended conformation for bacterial membrane insertion to establish this platform, triggering lipopolysaccharide release that activated coassembled caspase-4. Our “open conformer” model provides a dynamic view into how the human GBP1 defense complex mobilizes innate immunity to infection. (GBPLs) respond to inducible immune signals, including salicylic acid and pipecolic acid, to assemble large nuclear RNA polymerase II hubs that transcribe host defense genes during infection (7, 8). In animals, immune cytokines such as IFNs induce 65- to 73-kDa GBP expression to control microbicidal or inflammasome responses within the cytosol of both immune and nonimmune cells (9–13). These activities often coincide with the relocation of GBPs to the site of microbial replication where they completely “coat” targeted pathogens to build mesoscale signaling or killing platforms (9, 12–16). GBP-coated pathogens can range in size from ~750 nm in diameter for Salmonella enterica serovar Typhimurium (Stm) to >5 mm for Toxoplasma gondii tachyzoites (17). Assembling such a large coat complex must enlist biochemical properties synonymous with dynamin-like proteins (DLPs). DLPs typically exhibit robust GTPase activity (kcat, ~2 to 100 min−1), low-micromolar substrate affinity and nucleotide-dependent self-assembly to generate >0.5- to 1-MDa complexes within cells (18, 19). Hence, they are “large” GTPases, which often function as mechanoenzymes to deform or tubulate membranes during vesicular trafficking, organelle division, or cytokinesis (18, 19). Human GBPs also exhibit high intrinsic catalytic activity (kcat, ~80 min−1) to produce guanosine diphosphate (GDP) or monophosphate (GMP) from guanosine triphosphate (GTP) in a two-step hydrolysis reaction (20, 21). GTP hydrolysis likely initiates conformational changes leading to cooperative self-assembly of GBP dimers. Structurally, all human GBPs possess a large globular (LG) N-terminal catalytic domain and extended a-helical C-terminal tail (19); the latter spans a middle domain (MD) comprising helices a7 to a11 and GTPase effector domain (GED) encompassing the final a12 and a13 helices (20, 22, 23). In human GBP1 and GBP5 crystal structures, the GED folds back tightly onto the LG and MD regions (20, 22, 23). This could represent a closed, autoinhibited state, as substrate binding results in different geometries for isolated GBP1 when viewed by conventional electron microscopy (24). Indeed, substrate catalysis could theoretically release the GED to yield an open, active dimer that undergoes further multimerization, although high-resolution GBP structures captured directly on the pathogen surface after GTP hydrolysis have yet to be reported. In addition, GBP1, GBP2, and GBP5 each possess C-terminal CaaX motifs for isoprenyl modification to facilitate membrane binding (19, 24). Isoprenylation could offer not only anchorage but also serve as a nucleating template to deposit more GBPs on the microbial surface to build a signaling platform during innate immunity (12–16). In this study, we characterized a massive immune defense complex comprising nearly
RES EARCH | R E S E A R C H A R T I C L E 30,000 GBP1 molecules assembled on the bacterial surface using cryo–electron tomography (cryo-ET). Notably, despite their central role for host defense across plant and animal kingdoms (25–27), the ultrastructural organization of these mesoscale GBP coat complexes on an intact pathogen membrane is currently unknown. Visualizing such structures below the light diffraction limit would enhance our understanding of how eukaryotic cells recognize and combat infection. It would also yield information on GBP1 coat assembly under native conditions, which trigger innate immune signaling. Each has important implications for anti-infective therapy as well as the basic biology of immune recognition and host defense within the human population. y , 2 of 18 y g 1 March 2024 Coat construction required GBP1 C-terminal attachment and N-terminal catalytic activities to polymerize over the entire Salmonella surface. Whether microbial activities or physical features of bacteria also influence this process was examined by engineering 13 Stm strains differing in size, shape, motility, and OM composition. Stm isolates that were longer (StmpBAD-ftsZ, up to 20 mm), wider (StmMreB K27E mutants, ~2 mm in diameter), or smaller (StmDminD minicells 250 to 300 nm in diameter arising from aberrant septation) still recruited endogenous GBP1 in IFN-g–primed cells to activate IL-18 release and pyroptotic cell death (Fig. 1, G and H). Bent StmMreB D78V mutants likewise mobilized this pathway (34, 35) (Fig. 1, G and H). Hence, microbial cell size, division, or curvature did not seem to influence GBP1 coat formation to generate an innate immune signaling platform. Flagellin-expressing (36) and flagellin-deficient Stm (StmDflhD) were both targeted by GBP1, ruling out motility or bacterial immobilization as a cue to begin coat complex assembly. We therefore turned to the OM itself. Gramnegative bacteria harbor long polysaccharide LPS chains that form a divalent cation-crosslinked barrier that is impermeable to hydrophobic solutes (37). The LPS moiety consists of O-antigen polysaccharide, outer core galactose- and inner core heptose- and 3-Deoxy-D-mannooctulosonic acid (KDO)–enriched saccharides, and a lipid A module with multiple acyl chains embedded at the base by electrostatic and hydrophobic interactions (Fig. 1G). Isogenic Stm mutants with progressively shorter LPS chains [generated by inactivating enzymes at successive steps of the LPS biosynthetic pathway y Zhu et al., Science 383, eabm9903 (2024) Host and bacterial determinants of GBP1 coat complex assembly g We first examined the human GBP1 coat complex surrounding cytosolic bacteria using 4Pi single-molecule switching (4Pi-SMS) nanoscopy and fast, live three-dimensional structured illumination microscopy (3D-SIM) with an OMXSR Blaze imaging instrument equipped with high-speed galvanometers. 4Pi-SMS is a dualobjective, single-molecule localization, superresolution microscope that resolves 3D structures to ~20 nm (200 Å) isotropically throughout entire mammalian cells (28, 29); it enabled us to detect single GBP molecules on the surface of virulent Stm inside human cells. 3D-SIM imaging with the OMX-SR instrument is capable of ~180 frames per second, ensuring that coat complex assembly could be followed throughout the entire bacterial encapsulation process. We tracked GBP1 as the forerunner of this seven-member DLP family in humans. Recent work discovered that human GBP1 recruitment onto the outer membrane of cytosol-invasive pathogens, including Stm and Shigella flexneri, enables bactericidal activity by apolipoprotein L3 (APOL3) in IFN-g–activated primary human intestinal epithelia, myofibroblasts, and endothelium, as well as in HeLa CCL2 cells (13). We and others also reported that GBP1 recruits additional GBP family members plus endogenous human caspase-4 to stimulate cytokine release [interleukin-18 (IL-18)] and pyroptosis in primary intestinal human organoids, human macrophages, and human epithelial cell lines (12, 14–16). The GBP coat complex has thus emerged as a central hub for intracellular host defense and innate immune signaling in humans. To visualize real-time GBP1 coat complex formation by live 3D-SIM imaging, we deleted endogenous GBP1 in human HeLa CCL2 cells with CRISPR-Cas9 and replaced it with a functional monomeric red fluorescent protein (mRFP)–GBP1 reporter (GBP1–/–mRFP-GBP1) detected at physiological levels to avoid over- age and postprenyl processing (32) (fig. S3, A and B). LPS is the major constituent of gramnegative OMs (~75% in Stm) (33) and was recently reported to bind human GBP1 (15, 16). We found that Stm LPS captured farnesylated FLAG-tagged GBP1 at physiological pH and temperature in fluorescence anisotropy assays [dissociation constant (Kd), ~3.971 mM], whereas it failed to capture nonfarnesylated FLAGGBP1C589S, nondimerized or catalytic mutants, or farnesylated FLAG-GBP1R584–586A (fig. S3B). GBP1 assembly together with the farnesyl moiety therefore appears critical for Stm LPS engagement with the arginine patch strengthening these interactions electrostatically to maintain a stable coat (15, 16). This stability was in some cases very long-lived: Live imaging revealed that a single GBP1 coat can persist for up to 2 to 3 hours within the human cytosol (fig. S3C). Thus, thousands of GBP1 molecules generate a highly durable signaling platform once anchored through initial farnesyl and polybasic contacts to the bacterial OM. p Human GBP1 coat size, kinetics, and stability in cellulo expression artefacts (fig. S1A). When infected with Stm expressing enhanced green fluorescent protein (StmEGFP), mRFP-GBP1 completely encapsulated individual bacilli over a ~1- to 6-min time period (Fig. 1A and movies S1 and S2). Comprehensive coating was also observed in single-molecule 4Pi-SMS imaging of endogenous GBP1 and GBP2 on the bacterial surface in IFN-g–activated GBP1+/+ cells, which in some cases depicted colocalization (Fig. 1B and movie S3). Volumetric and kinetic measurements of GBP1 yielded 29,542 ± 5156 molecules per bacterium assembled at a rate of 103 ± 11.6 molecules per second (fig. S1, B and C). Such rapid kinetics required massive GBP1 cooperativity involving sequential hydrolysis of GTP and GDP for nucleotide-dependent self-assembly of GBP1 dimers on the bacterial surface, as revealed by loss-of-function mutants. GTPase (GBP1S52N), GDPase (GBP1DD103,108NN), or dimerization (GBP1D184N) mutants blocked coat formation and downstream IL-18 release plus pyroptotic cell death (as LDH release) in stably reconstituted GBP1–/– cells (10) (Fig. 1, C to H). Notably, these N-terminal mutants were still posttranslationally prenylated at a C-terminal CaaX motif (Fig. 1F and fig. S2, A and B), which may otherwise help anchor GBP1 to the bacterial outer membrane (OM). Indeed, mutating the CaaX box (GBP1C589S) prevented both C15 farnesylation and coat attachment inside human cells (Fig. 1, F to H). It did not, however, interfere with nucleotide-dependent dimer self-assembly as shown through size exclusion chromatography by using a transition state analog, GDP plus aluminum fluoride (AIF3–), in recombinant protein assays (Fig. 1E). Thus, GBP1 mutants uncoupled OM attachment from subsequent polymerization, revealing distinct steps in coat-complex formation during immunity to gram-negative infection. OM anchorage also required a polybasic patch (amino acids 584 to 586) that resembled lipid-binding motifs in small H-Ras GTPases (30) within the GBP1 C-terminal a-13 helix (20) (fig. S2, A and B). Alanine-scanning mutagenesis of all three arginines (GBP1R584–586A) (31) ablated coat formation and impaired downstream cytokine plus cell death signaling (Fig. 1H and fig. S2, C and D). Because GBP1R584–586A was heavily farnesylated inside human cells, the loss of coat complex assembly was not due to R584-to-586A substitution interfering with lipidation of the nearby CaaX motif (Fig. 1F). Instead, it appears that GBP1 farnesylation is necessary but not sufficient for OM anchorage, requiring a second site to stably engage the OM and help retain it on the bacterial surface. The bivalent nature of this C-terminal anchor was reinforced in lipopolysaccharide (LPS)– binding profiles for the GBP1R584–586A and GBP1C589S mutants purified from human embryonic kidney (HEK) cells lacking endogenous GBP expression to ensure correct farnesyl link-
RES EARCH | R E S E A R C H A R T I C L E A Fig. 1. Human GBP1 coat kinetics and functional determinants in cellulo. (A) Live 3D-SIM showing full encapsulation of EGFP-expressing Stm by mRFP-GBP1 in IFN-g–activated HeLa cells. GBP1 coat complex initiation, expansion, and completion are noted. Volume rendering through Imaris software. Maximum intensity projection of one of six similar 3D-SIM videos shown. Scale bar, 2 mm. (B) 4Pi-SMS nanoscopy of cytosolic Stm coated by endogenous human GBP1 and GBP2, detected by using rat anti-GBP1 and mouse anti-GBP2 antibodies, respectively, at 2 hours postinfection. Maximum intensity projection of one of eight similar 4Pi-SMS images shown. Scale bar, 1 mm. (C) Domain structure of farnesylated human GBP1 (PDB 6K1Z) depicting catalytic LG, MD, and GED. The polybasic patch and CaaX motif in the C-13 a helix are denoted. RRR, polybasic triplearginine patch. (D) TLC of 32[P]-GTP hydrolysis products for recombinant GBP1 and its mutants. Representative of four independent experiments. (E) Size exclusion chromatography profiles depicting GBP1 and its mutants in the absence or presence of the transition state analog, GDP plus AIF4–. Representative of three independent experiments. (F) Prenylation profile of EGFP-GBP1 and its mutants in HEK-293E cells, detected by using FPP-azide-biotin CLICK chemistry coupled to anti-GFP immunoprecipitation. SA, streptavidin–horseradish peroxidase (HRP); IgG, immunoglobulin heavy chains. One of three independent biological experiments. (G) Salmonella and GBP1 mutants used to examine determinants of coat complex function. Acyl chains removed through each mutation are depicted by colored brackets. c11088, StmDlpxRDPagLDPagP triple mutant. (H) Bacterial and host determinants in human GBP1 coat complex formation on Stm coating and downstream IL-18 release or cell death in IFN-g–activated wild-type or mutant HeLa cells infected with different bacterial strains. Mean ± standard deviations is shown for triplicates. Significant one-way analysis of variance (ANOVA) values with Bonferroni post hoc test are shown. NS, not significant. Representative of three to five independent experiments. B Live 3D-SIM Expansion Initiation 17:57:845 18:42:746 20:12:831 19:27:713 4Pi-SMS Cytosolic Stm GBP1 GBP2 Bacterial surface ~10-12nm 20:57:881 21:43:148 24:42:716 25:28:218 Colocalized GBPs Expansion C Completion 317 1 LG LG E 479 486 588 MD GED CaaX Buffer F GDP/AIFx kDa: 670 158 44 FPP-azide-biotin CLICK chemistry 17 Cell lysate MD ( 7- 11) IP:GFP 4-5 86 A GF GF P -G B GFP -GB P1 GF P -G P1 S5 GFP -G BP1 D 2N GF P-GBP1 D1D103.1 P- BP 84N 08N GB 1 C5 N P1 R 89S GF 58 4-5 P 86 GF -G A B GFP -GB P1 GF P -G P1 S5 GFP -G BP1 D 2N GF P -GBP1 D1D103.1 P- BP 84N 08N GB 1 C5 N P1 R 89S 58 rGBP1 rGBP1S52N GED ( 12, 13) D GBP1 mutants [32P]-GMP [32P]-GDP [32P]-GTP rGBP1DD103.108NN IB: SA Prenylated GBP1 GFP-GBP1 IgG rGBP1D184N rGBP1C589S IB: GFP rG r B BP GBP P1 1 DD 1 S52 10 N rG 3.108 NN BP rG 1 D18 4N rG B P BP 1 C58 1 R58 9S 4-5 86 A GFP (GBP1 prenylation in cellulo) rGBP1R584-586A rG Retention volume (mL) G g y P < 0.0005 P < 0.0005 P < 0.0002 P < 0.0004 P < 0.0012 P < 0.0003 P < 0.0001 A 86 P < 0.0007 P < 0.0002 P < 0.0001 P < 0.0006 P < 0.0002 03 4 -5 08 11 Zhu et al., Science 383, eabm9903 (2024) proteins LpxR, PagL, or PagP (that remove a 3′-acyloxyacyl moiety, remove a single R-3hydroxymyristate chain, or palmitoylate the hydroxymyristate chain, respectively) (40) failed to prevent GBP1 coating and caspase-4 activation (Fig. 1, G and H). CRISPR-Cas9 deletion of human acyloxyacyl hydrolase (AOAH–/–), which is expressed at low levels in HeLa CCL2 cells and removes secondary acyl chains from lipid 1 March 2024 A as a deactivation mechanism (41), or human E3 ubiquitin ligase ring finger protein 213 (RNF213–/–), which modifies lipid A through ubiquitinyation (42), also had no effect on coatdependent signaling (Fig. 1, G and H). Thus, functional coat formation on Salmonella was primarily governed by host GBP1 activities rather than lipid A modifications or other microbial determinants in cellulo (i.e., within 3 of 18 , P < 0.0002 NS P < 0.0001 NS NS 30 25 20 15 10 5 0 60 50 40 30 20 10 0 450 400 350 300 250 200 150 100 50 0 ,1 NS NS 8 NS NS 08 NN GB P1 D GB 184N P 1C GB P1 R 589S 58 NS 30 25 20 15 10 5 0 60 50 40 30 20 10 0 450 400 350 300 250 200 150 100 50 0 GB P GB GBP 1 P1 D 1 S 52N D1 NS y 30 25 20 15 10 5 0 60 50 40 30 20 10 0 450 400 350 300 250 200 150 100 50 0 P < 0.0001 H y g (13, 38)] revealed that OM truncations in StmDwzy, StmDwaaL, StmDwaaJ, StmDwaaI, or StmDwaaG did not block GBP1 coat formation and downstream innate immune signaling (Fig. 1, G and H). Beneath these truncations, we modified the lipid A module positioned at the base of the OM where it interacts with the phospholipid inner leaflet; lipid A is recognized and directly bound by caspase-4 (39). Mutations in Stm p Absorbance (100%) RRR CaaX
RES EARCH | R E S E A R C H A R T I C L E a living cell). Human GBP1 still targeted cytosolic Stm irrespective of bacterial size, shape, motility, or OM composition; the latter spanned LPS chains of different length, charge, and chemical structure. Such broad ligand promiscuity may help GBP1 combat gram-negative pathogens that modify their LPS moiety in an attempt to evade innate immune recognition and antimicrobial killing. Human GBP1 coat initiates a multiprotein platform for bacterial recognition y , 4 of 18 y g 1 March 2024 y How the GBP1 coat complex promotes LPS recognition by caspase-4, especially given that lipid A is buried at the base of the OM, remains a question. We initially probed LPS release by live bacteria in cellulo (Fig. 3, A and B). First, copper (Cu2+)–free CLICK chemistry was used to label Stm LPS with Alexa Fluor attached through KDO-azide derivatives adjacent to lipid A within the inner core (Fig. 3A). AntiSalmonella O-antigen antibody was used in conjunction to verify the KDO–Alexa Fluor signal, which decreases during transit to the cytosol. We likewise incorporated fluorescent D-alanine into the L-Ala-D-meso-diaminopimelateD-Ala-O-Ala pentapeptide through metabolic la- g Zhu et al., Science 383, eabm9903 (2024) GBP1 defense complex triggers bacterial LPS release in cellulo and in reconstituted systems beling of the underlying peptidoglycan (PG) scaffold in active bacteria (44) (Fig. 3A). 3D-SIM found that complete GBP1 coating triggered release of LPS but did not seem to disturb the Stm PG layer within the cytosol of IFN-g– activated HeLa cells (Fig. 3B), confirming that GBP1 can promote caspase-4 ligand availability in cellulo. Other exteriorized structures such as flagella were still evident on GBP1-coated bacteria (Fig. 3C); hence, GBP1 primarily affected OM disruption, leaving the underlying PG scaffold and flagellar apparatus intact. We next directly assayed lipid A release to test if GBP1 was indeed sufficient for LPS liberation. We used a cell-free reconstitution system to measure soluble lipid A, which cannot be undertaken in situ owing to contamination of the host cell cytosol by whole bacteria. Incubation of farnesylated recombinant RFP (rRFP)–GBP1 with axenic Stm found that >95% of bacteria were fully coated within 60 min after addition of GTP substrate (Fig. 3D). Bacterial encapsulation by rRFP-GBP1 followed a highly accelerated sigmoidal curve that yielded a half maximal value (“coat Km”) of 225 nM and a steep Hill slope of 5.122 (Fig. 3E). Notably, this all-or-none behavior did not arise from crossing a phase-transition boundary because rRFP-GBP1 does not phase separate, unlike plant GBPLs, which possess a C-terminal intrinsically disordered region to generate biomolecular condensates during infection (6, 7) (fig. S5A). Pronounced coating was evident irrespective of Stm size or LPS status; comparison with gram-negative Pseuodomonas aeruginosa and gram-positive Listeria monocytogenes showed that the latter two bacteria had lower levels of rRFP-GBP1 encapsulation (fig. S5, B and C). Notably, reconstituting the GBP1 coat complex triggered Stm LPS release, which was measured by limulus amebocyte lysate (LAL) assay that detects the soluble lipid A moiety. Unfarnesylated rRFP-GBP1C589S and farnesylated catalytic or assembly mutants that could not coat Stm failed to release LPS even after addition of GTP, mimicking the results seen inside human cells (Fig. 3F). Omission of GTP or substitution with nonhydrolyzable GTP analogs (GTP-g-S or GMPPNP) or transition-state mimics (GDP.AIF3– or GMP.AIF4–) also failed to trigger rGBP1-dependent LPS release because these analogs could not support hydrolysisdriven GBP1 coating on bacteria (Fig. 3F). The amount of lipid A released by GTP-dependent rGBP1 assembly on Stm greatly exceeded the Kd range of caspase-4 (39) yet comprised <1% of the total LPS present [based on 2 × 106 molecules of LPS per Stm (31)]. Hence, the GBP1 coat complex disrupts the LPS outer leaflet; depending on the extent of this disruption, it may coincide with inflammasome activation or even bacterial killing (13, 15). Indeed, p Broad multivalent GBP1 interactions with the bacterial surface provide a stable platform to recruit downstream protein partners for innate immune signaling (12, 13, 16). Previous work from us together with other groups found that GBP2 to GBP4 and caspase-4 form part of this GBP1 signaling platform in primary human intestinal organoids and cervical epithelial cell lines (12, 16). In this study, stable CRISPR-Cas9 deletions corroborated their importance with endogenous caspase-4 autoproteolysis (denoted by the active p30 subunit), IL-18 release, and pyroptotic cell death (as LDH release) significantly diminished in IFN-g– activated GBP1–/– and GBP2–/– single-knockout and GBP1–/–2–/– double-knockout cells (fig. S4, A to C). Single deletions of GBP3–/– and GBP4–/– had a lesser effect, however, en bloc removal of the entire 335-kb human GBP1 to GBP7 cluster through genome engineering on chromosome 1q22.2 (GBPD1q22.2) yielded almost complete loss of downstream signaling, underscoring concerted GBP action and phenocopying CASP4–/– and GSDMD–/– (Gasdermin D) cells (fig. S4, A to C). Complete GBP gene cluster deletion in the septuple GBPD1q22.2 mutant provided an ideal tool to reconstitute the entire coat complex on an empty background and test if GBP1 is the critical organizer of this hierarchical complex on the same bacilli in situ (fig. S4D). We included full-length GSDMD as a natural caspase-4 substrate with potential bactericidal activities (43) to see if it is brought into this new supramolecular platform as well. Each coat component was fused to one of seven fluorescent proteins [mAzurite, mSapphire, pmTurqouise2, pmEmerald, pmVenus, pmOrange, pmCardinal, or pmIFP24; fluorescence excitation and emission (Ex/Em) range, 384/450 to 684/708 nm] to identify compatible combinations for reconstituting GBPD1q22.2 cells, as exchange-PAINT lacked appropriate antibodies for detection of endogenous proteins (fig. S4, D and E). Our color-coded orthogonal matrix (GBP-COAT450–708) successfully resolved five-color objects to yield a complete signaling platform with GBP1 to GBP4 plus caspase-4 or GSDMD all coating the same bacilli after 90 to 120 min of infection (Fig. 2, A to C, and fig. S4, F and G). Notably, this multicolored coat was completely lost when GBP1 was omitted, indicat- ing that GBP1 establishes the entire signaling cascade at the outset (12, 14) (Fig. 2, A and D). Indeed, the GBP-COAT450–708 assay found human GBP1 was obligate for GBP2, GBP3, GBP4, and caspase-4 or GSDMD simultaneously sharing the same bacterial surface (Fig. 2D). Excluding caspase-4 had no effect on GBP1 to GBP4, placing them upstream, but it largely blocked full-length GSDMD targeting, positioning it downstream in this six-member signaling cascade as part of two-step hierarchical model (Fig. 2, C to F). Notably, N- or C-terminal GSDMD fragments mimicking the processed substrate failed to be recruited (Fig. 2E). Hence, caspase-4 appears to bring only its full-length GSDMD substrate to this location for cleavage once the protease is activated by lipid A after recruitment by GBP1; this was also corroborated in individually deleted CASP4–/– or GBP1–/– cells (Fig. 2F). By tracking the other major caspase-4 substrate in this pathway, pro–IL-18, we found that it largely failed to be recruited onto the coat. Hence, GSDMD is a new component of the GBP-CASP4 signaling complex as part of a two-step hierarchical model (Fig. 2F). Its interaction with caspase-4 likely occurs before reaching the GBP platform, as shown by coimmunoprecipitation assays in GBPD1q22.2 cells (Fig. 2G). This hierarchical model was further supported by LPS binding profiles (Fig. 2H). FLAG-GBP1, -GBP2, -GBP3, -GBP4, or –caspase-4C258A (preventing autoproteolysis) (39) were purified from human HEK cells to avoid bacterial contaminants and ensure proteins were posttranslationally modified; GBP1 (Kd, ~3.776 mM) and caspase-4C258A (Kd, ~313 nM) strongly interacted with Stm LPS as major OM binding proteins (13, 14, 39) (Fig. 2H). GBP1 therefore serves as the principal organizer of this multiprotein complex atop the coated bacterium in situ (12, 16). Its assembly facilitates bacterial recognition of the LPS lipid A moiety by caspase-4 that can recruit GSDMD as a subsequent step to activate cell death and cytokine release downstream.
RES EARCH | R E S E A R C H A R T I C L E Coat reconstitution in GBP pc D mI NA3 FP .1 mO 24 mV rang-GBP mEenuse-GB1 mT mer -GB P2 a P mT-Sap ld-G 3 -Sa phi BP pp re-C 4 hir A e-G SP SD 4 MD -CASP4 All 78 -100 -75 91 78 -100 -75 70 97 E Stm FL-GSDMD Inset P < 0.004 P < 0.002 P < 0.006 NS NS - GSDMD - CASP4 NS NS NS NS NS NS NS NS NS NS NS NS - GBP4 CTGSDM D NTGSDM D Stm FL-GSDMD Inset chr.1q22.2 NS NS All -GSDMD -GBP4 -GBP3 -GBP2 -GBP1 NS P < 0.0003 - GBP3 chr.1q22.2 IFP24- Orange- Venus- Emerald Sapphire Merge GBP1 GSDMD GBP3 -GBP4 -CASP4 -GAPDH NS NS NS NS P < 0.0003 -100 -75 70 -GSDMD - GBP2 GBP1 -/- CASP4 -/- 15 Stm coating (%) FL -G N T SD M D -G C T SD M -G D P < 0.0042 SD MD FL P < 0.0042 -G SD NT -G MD C T SD M NS -G SD D NS MD FL -G N T SD M -G D C T SD M NS -G D SD NS MD P < 0.00007 P < 0.0005 P < 0.0004 P < 0.0005 P < 0.004 P < 0.004 -100 -75 92 -CASP4 -GFP Coat reconstitution in GBP -100 -75 100 -GBP2 P < 0.0002 All 12 9 6 3 0 Recruitment onto bacteria GBP2 GBP3 GBP4 [FL-GSDMD]-CASP4 (Prebound) +- + ++ IgG -37 -50 -37 -50 Stm LPS Binding H Relative mP (%) .2 22 1q s9 GB P W T Ca Flag + Flag-GSDMDL192D - + ++ C258A Myc-CASP4 IP: IB: -Myc -Flag IB: -Flag Input IB: -Myc IB: -Flag CASP4 NT-GSDMD Activation and cleavage rGBP1 LPS only 120 90 60 Kd = 3.776 M 30 0 -3 -2 -1 0 1 2 3 4 120 0 rGBP2 LPS only 120 rCASP4C258A LPS only 90 90 90 600 K = >10 M d 300 60 Kd = >10 M 30 60 Kd = >10 M 30 60 Kd = 0.313 M 30 00 0 0 -3 -2 -1 0 1 2 3 4 -3 -2 -1 0 1 2 3 4 -3 -2 -1 0 1 2 3 4 Log 10 protein concentration (nM) 0 -3 -2 -1 0 1 2 3 4 5 of 18 , mediated killing (Fig. 3G). Thus, insertion of human GBP1 seems to disrupt lateral LPS-LPS interactions to compromise OM integrity. This not only activates the caspase-4 inflammasome y GSDMD fused to GFP reintroduced into GSDMD–/– cells activated with IFN-g and infected with Stm for 2 hours. The GFP channel is pseudocolored turquoise, and the targeting of FL-GSDMD to bacteria is indicated by a dashed circle. Nuclear staining was done with 4′,6-diamidino-2-phenylindole. Scale bar, 5 mm. (Bottom) Loss of full-length GSDMD targeting in GBP1–/– and CASP4–/– cells. Quantitation of GSDMD targeting in IFN-g–treated knockout cell lines. n = 74 to 124 events for each group. Micrographs and quantitation were from at least three independent experiments. NT, N-terminal fragment; CT, C-terminal fragment. (F) Two-step hierarchical model showing GBP1 dependency and recruitment of full-length GSDMD by caspase-4. (G) Coimmunoprecipitation of FLAG-GSDMDL192D by Myc-CASP4C258A [to reduce cytotoxicity (39)] in wild-type and GBPD1q22.2 mutant HeLa cells. One of two similar experiments is shown. (H) Binding curves for recombinant coat proteins to Salmonella LPS–Alexa Fluor 488 in fluorescence anisotropy assays under physiological pH and temperature. mP, maximal polarization. Mean ± SD determined in triplicate for each protein concentration. Representative of three independent experiments. Significant one-way ANOVA values with Bonferroni post hoc test shown in (D) and (E). Such dependency was confirmed by using nonhydrolyzable GTP-g-S or GDP.AIF3– that not only prevented rGBP1 coat formation and LPS release (Fig. 3F) but also subsequent rAPOL3- 1 March 2024 120 rGBP4 LPS only y g coincubating rGBP1 with human rAPOL3 led to loss of bacterial viability (Fig. 3G) because OM disruption by GBP1 allows APOL3 access to the Stm inner membrane underneath (13). 120 rGBP3 LPS only 900 Fig. 2. Human GBP1 initiates a multiprotein platform for cytosolic LPS recognition. (A) Multicolor confocal imaging of the reconstituted coat complex (GBPCOAT450–708) in GBPD1q22.2 mutant cells (chr, chromosome). Stepwise omission of each coat component revealed GBP1 dependence. Circles depict Stm targeting. IFN-g was added to ensure that sufficient caspase-4 was expressed endogenously when using mT-Sapphire-GSDMD. Micrographs are representative of at least three independent experiments. (B) Immunoblot of GBP1, GBP2, caspase-4, and GSDMD by specific antibodies. Anti-GFP was used to detect related fluorescent proteins fused to GBP3, GBP4, caspase-4, or GSDMD in reconstituted GBPD1q22.2 cells. (C) Caspase-4– dependent GSDMD recruitment shown by exchanging mOrange-GBP2 with mOrangeGSDMD because GBP2 is dispensable for reconstituted coat formation in nonactivated GBPD1q22.2 cells. Scale bar, 2 mm. One of three independent experiments is shown. (D) Quantitation of Stm targeted by each coat protein when all are present or after individual omission in reconstitution assays. Sapphire-GSDMD used throughout except when it was coexpressed with CASP4, where it was used as in panel (A). n = 156 to 208 events for each group from four to five independent experiments. (E) (Top) Widefield imaging of full-length (FL), N-terminal, or C-terminal fragments of human Zhu et al., Science 383, eabm9903 (2024) y G LPS binding GBP1 g GB GB P1 GBP2 GB P3 CA P4 GS S P 4 DM D GB GB P1 GBP2 G P3 CABP4 GS S P 4 DM D GB P GB 1 GBP2 G P3 CABP4 GS S P 4 DM D GB GB P1 GBP2 GB P3 CA P4 GS S P 4 DM D GB GB P1 GBP2 GB P3 CA P4 GS S P 4 DM D GB GB P1 GBP2 G P3 CABP4 GS SP4 DM D GB GB P1 GBP2 GB P3 CA P4 GS S P 4 DM D Stm coating (%) 30 25 20 15 10 5 0 C chr.1q22.2 p F -GBP1 Coat reconstitution in GBP - GBP1 GBP IFP24- Orange- Venus- Emerald Sapphire Merge GBP1 GBP2 GBP3 -GBP4 -GSDMD D All present B chr.1q22.2 NS NS NS Coat reconstitution in GBP chr.1q22.2 IFP24- Orange- Venus- Emerald Sapphire Merge GBP1 GBP2 GBP3 -GBP4 -CASP4 -CASP4 -GBP4 -GBP3 -GBP2 -GBP1 A
RES EARCH | R E S E A R C H A R T I C L E B A In cellulo 3D-SIM GBP1 LPS Merge PG Uncoated Coated C D rRFP-GBP1F (+ GTP) rRFP-GBP1F (- GTP) DNA rGBP1 (+ GTP) rGBP1 (- GTP) 20 m 20 800 600 400 200 2 -7 2 -6 2-5 2 2-3 2 2-1 2 21 -4 -2 0 rRFP-GBP1 F ( M) + GTP 0 - + - Zhu et al., Science 383, eabm9903 (2024) + + + + + 60 40 20 0 rAPOL3 GTP + + + + - + - - GTP (2 mM) imaged by confocal microscopy. Representative of 10 to 12 micrographs shown. (Bottom) rRFP-GBP1F coating across increasing diluents imaged by confocal microscopy. (E) Best-fit interpolation curve of means ± SD together with regression analysis revealed half maximal coat Km and Hill slope values. One of three similar experiments is shown. (F) Soluble lipid A release by LAL in rRFP-GBP1F coat reconstitution assays (triplicate ± SD) on live unfixed bacilli. Substrate analogs and GBP mutants are denoted. One of six independent biological experiments is shown. EU, Endotoxin Unit. (G) Stm killing assay by rAPOL3 requires LPS disruption by the GBP1 coat complex. Significant one-way ANOVA values with Bonferroni post hoc test are shown for (F) and (G). One of three independent experiments is shown. and insertion into the bacterial outer leaflet for triggering LPS disruption. GBP1 conformers could be delineated with powerful imaging tools such as cryo–electron microscopy (cryo-EM) and cryo-ET. We engineered bacterial minicells and outer membrane vesicles (OMVs) because they are considerably smaller than isogenic rod-shaped bacilli but retain 1 March 2024 80 NS intact features of the pathogen OM, unlike artificial liposomes or soluble LPS (Fig. 4A). More notably, the reduced sample thickness of minicells improves resolution in cryo-ET samples (34), and negative-stain EM initially confirmed that Stm minicells and OMVs are coated by rRFP-GBP1 like the parental Stm 1344 strain (fig. S6, A and B). 6 of 18 , Our reconstituted coat complex provided us with the opportunity to view GBP1 assembly - 100 y A bacterial minicell system enables cryo-EM and cryo-ET of the native GBP1 coat - 120 y g Fig. 3. The human GBP1 coat complex triggers LPS release in cellulo and in cell-free systems. (A) Fluorescent labeling strategy for LPS with copper-free CLICK chemistry with a DIBO alkyne intermediate. (B) 3D-SIM imaging of cytokine-activated HeLa cells (1000U IFN-g, 18 h). Images were collected at 2 hours postinfection with prelabeled Stm at an MOI of 20. Endogenous GBP1 was detected by anti-GBP1, and LPS was detected with anti–Sal-O antibody for verification (pseudocolored magenta). Maximum intensity projection of one of five similar 3D-SIM images. Scale bar, 2 mm. (C) GBP1-coated cytosolic bacteria harbor flagellin detected by anti–Fli-C antibody in 3D-SIM imaging. Maximum intensity projection of one of four similar 3D-SIM images. (D) (Top) Farnesylated rRFP-GBP1F (2 mM) coat assembly on Stm ± pathway but allows the passage of small antimicrobial proteins such as APOL3 to directly kill pathogenic bacteria (13). - rRF rRF rR P-G B rRF P-G FP-G P1 P-G BP1 BP rRF /GT 1 P BP P S rRF -GB 1/GM P P-G 1/G PP BP DP NP 1 .A rRF rR /GMP IF3 .A P-G FPBP GBP IF4 1 SD D 1 S52 rRF N 10 3 ,1 P 0 rRF -GBP 8N N rRF P-G 1 D 184 N P-G BP BP 1 C 589 1 R58 S GTP 0 Stm viability (% control) “Coat Km ” (225nM) P < 0.0001 1000 Substrate analogs rRF P-G rR rRF FP-GrRFP BP1 P-G BP -GB BP 1/G P1 1/G TP DP S .AI F3 - 40 1200 4 -5 Stm Lipid A (EU.mL -1) 60 G rGBP1 mutants y rRFP-GBP1 F coated Stm (%) Hill slope (5.122) 21 g rGBP Substrate GTP analogs GBP1 coat complex assembly 20 2-1 P < 0.002 2-2 p F E 80 2 m rRFP-GBP1F ( M) + GTP 2-3 100 rGBP1 (+ GTP) 20 m Endogenous coat A Flagellin 86 GBP1
RES EARCH | R E S E A R C H A R T I C L E A B Stm waaG::pBAD-ftsZ OMVs rRFP-GBP1 (+ GTP) rRFP-GBP1 (- GTP) Outer Leaflet of Outer Membrane (OLOM) Inner Leaflet of Outer Membrane (ILOM) GBP1 coat OLOM ILOM 50 nm 50 nm 1. Stm minicell 2. Stm (n = 11,889) minD minicell (n = 12,487) 3. Stm waaG::pBAD-ftsZ OMV (n = 6,107) G E waaG::pBAD-ftsZ minicell H 35 30 25 20 1 2 3 p Stm G rGBP1 length (nm) D waaG::pBAD-ftsZ 28 .0 6 27 ±1. 0 .9 6± 4 1 27 .8 .53 6± 1. 24 C NS IM OM F g 20 nm Inset Human GBP1 coat complex y OM IM 20 nm 1 March 2024 measurements found that GBP1 spanned ~25 to 27 nm, tightly juxtaposed over the entire bacterial surface (fig. S6E). In a recent crystal structure of farnesylated human GBP1 bound to the nonhydrolyzable GTP analog, GMPPNP (PDB ID 6K1Z), the protein is half this length (12.89 nm) (22), with the final a13 helix folded back onto the a12 C-terminal segment in a “closed” conformation (fig. S6, E and F). To span the ~25 to 27 nm measured with cryoEM, at least two “closed” GBP1 molecules vertically positioned on top of one another would be needed, or four to six molecules 7 of 18 , Zhu et al., Science 383, eabm9903 (2024) dimer near the point of OM insertion. Both O-antigen and outer core segments are also dispensable for GBP1 coat attachment and downstream signaling inside human cells because the lipid A region is still intact (Fig. 1, G and H). Our dual genetic strategy was therefore devised to limit nonspecific sample noise during collection of tilt images by cryo-ET. Cryo-EM at 200 kV revealed successful reconstitution of the GBP1 coat complex on StmDwaaG::pBAD-ftsZ minicells and OMVs in comparative samples with rRFP-GBP1 ± GTP (Fig. 4B and fig. S6, D and E). Preliminary EM y Minicells arise from abnormal asymmetric cell division (Fig. 4A); we found that overexpression of a septation gene, ftsZ, yielded the smallest Stm minicells (~150-300 nm) that could still be isolated intact by differential centrifugation along with OMVs (fig. S6C). We deliberately introduced ftsZ overexpression into a waaG-deficient background lacking the LPS O-antigen and outer core segment (StmDwaaG::pBAD-ftsZ) because these segments have unstructured density that interfere with subtomogram averaging (45) and removing it would allow us to see more of the native GBP1 (3. StmDwaaG::pBAD-ftsZ). (D) Violin plots of GBP1 conformer length (nanometers, mean ± SD) for each measured sample. NS across all groups; found using one-way ANOVA with Bonferroni post hoc test from three to four independent experiments. (E) Representative tomographic slice of StmDwaaG::pBAD-ftsZ minicell completely coated with rRFP-GBP1F after GTP hydrolysis. (F) Enlarged view of the boxed inset from (E). (G and H) 3D segmentation of the same rRFP-GBP1F–coated StmDwaaG::pBAD-ftsZ minicell shown in (E) and (F). Tomographic series collected over 102° tilt range. OM, outer membrane. IM, inner membrane. y g Fig. 4. Native GBP1 coat complex on the Salmonella surface observed by cryo-EM and cryo-ET. (A) Strategy for constructing StmDwaaG::pBAD-ftsZ minicells and OMVs missing LPS O-antigen and outer core for reduced noise detection of the native GBP1 coat complex. (B) GTP dependency of rRFP-GBP1F coat formation on the StmDwaaG::pBAD-ftsZ OMV surface shown in 200-kV cryo-EM images. Black dots are 6-nm diameter fiducial beads. (C) Measurement of coat length from 300 kV cryo-ET images by using computer script quantitation (yellow) for LPS-O antigen and outer core truncated minicell (1. StmDwaaG::pBAD-ftsZ), LPS wild-type minicell (2. StmDminD), and LPS-O antigen and outer core truncated OMV
RES EARCH | R E S E A R C H A R T I C L E arrayed horizontally and perpendicular to the outer leaflet (46). Alternatively, AlphaFold2 modeling (47) found that GBP1 may undergo dynamic C-terminal extension of its GED to present a fully unhinged C15 farnesyl group to the OM (fig. S6F). This “open” extended conformer had a predicted length of 278 Å, which also fits the EM measurements. Each potential configuration was probed by cryoET along with biochemical evidence to discern how GBP1 directly operates on the bacterial surface under native conditions in the presence of its bona fide substrate, GTP. Cryo-ET reveals thousands of open GBP1 conformers insert into the bacterial OM y , 8 of 18 y g 1 March 2024 y The conformationally dynamic model of human GBP1 was further validated by three separate approaches. Firstly, we devised sequential wash conditions to reduce protein crowding within the coat complex itself. It enabled us to observe isolated GBP1 dimers still attached to the surface of Stm OMVs and minicells in vitro (Fig. 6, A and B, and fig. S12, A and B). Tomographic images of 66 isolated GBP1 proteins found that all had the globular LG positioned at the perimeter with the extended C terminus anchored underneath at the base; these isolated dimers spanned 25.08 to 27.44 nm, sug- g Zhu et al., Science 383, eabm9903 (2024) A conformationally dynamic model for GBP1 defense complex assembly gesting an extended conformation (Fig. 5, D to F, and fig. S12, C and D). Secondly, nanogold labeling validated this orientation. We chose 1.8-nm Ni-NTA-nanogold particles to bind a histidine tag (His6) fused to the N-terminal LG of GBP1 for detecting its location within the mature coat. Labeling was observed exclusively at the outer border (Fig. 6C), which was consistent with the LG being positioned at the top of the coat, as seen for isolated dimers (Fig. 6, A and B). Notably, the exposed bacterial OM did not bind Nanogold particles in the absence of His6-GBP1, indicating that the labeling signal originated from the protein itself (Fig. 6C). Attempts to introduce a functional His6 sequence near the GBP1 C terminus proved impractical owing to the presence of the CaaX motif used for farnesylation and the polybasic R584 to 586A sequence needed for OM anchorage. Nonetheless, cryo-ET of both washed OMVs and nanogold labeling validated both the length and the orientation of the GBP1 dimer on the gram-negative bacterial surface. Lastly, a requirement for dynamic opening of the GBP1 GED was assessed through a cysteine replacement assay. Seven paired cysteine (Cys) mutants (I369C-E533C, E366C-G530C, I365C-H527C, R362C-E526C, I365C-G526C, G361C-S523C, and G389C-K520C) were generated spanning the C-terminal GED a12 helix and its spatially adjacent a7 MD helix to enable disulfide cross-linking of the “closed” conformer (fig. S13A); this prevented the C-terminal a12,13 region from opening to ~280 Å unless exposed to a reducing agent such as dithiothreitol (DTT). To ensure that the introduction of Cys-Cys pairs did not lead to gross structural alterations having effects beyond opening the C-terminal hinge, we first tested if they could still target Stm within the reducing environment of the human cytosol. All seven Cys-Cys pairs coated cytosolic Stm in HeLa cells (fig. S13B). Of these mutants, we chose the middle R362C-E526C mutant with the shortest Cys-Cys interbond length (2 Å) to make recombinant RFP-GBP1 for direct cell-free coating assays after confirming its normal activity in situ (Fig. 6, D and E and fig. S13, A and B). In the absence of DTT, the “closed” disulfide-linked R362CE526C conformer completely failed to coat Stm even when given its GTP substrate, unlike its wild-type rRFP-GBP1 control (Fig. 6F). Addition of DTT, however, fully restored bacterial encapsulation by the R362C-E526C mutant (Fig. 6F). Thus, biochemical evidence supports the requirement for dynamic opening of the human GBP1 dimer to ~280 Å for assembly on the bacterial surface. The C15 farnesylated tail anchors GBP1 to the OM with the catalytic LG domain positioned at the perimeter to generate this distinctive host defense platform. p We next used 300-kV cryo-ET to acquire highcontrast 3D images in dose-fractionated mode of a human GBP1 coat complex fully assembled on the bacterial surface (Fig. 4, C to H, and fig. S7, A to L). rRFP-GBP1 fluorescence initially helped us to locate coated bacilli within vitrified samples, and the linkage of RFP did not alter the overall length of GBP1 (fig. S6F). Mean conformer lengths of ~280 Å were found across 30,483 measurements of StmDwaaG::pBAD-ftsZ and StmDminD minicells plus OMVs (Fig. 4, C and D, and movies S4 and S5). Elongated GBP1 conformers radiating from the bacterial surface were discernible within multiple tomographs (Fig. 4, E to H, and fig. S7G). The 44,891 particles collected during coarse classification yielded 15,683 particles for 3D segmentation of this native host defense complex (Fig. 4, G and H). It resolved a massive coat fully surrounding StmDwaaG::pBAD-ftsZ minicells up to 384 nm in diameter (movie S6). Zoomed-in views revealed what appear to be vertically upright GBP1 conformers often aligned in register when attached to the OM (Fig. 5A). To verify individual protein configurations within this native coat, we next enlisted tagless rGBP1 to ensure that RFP was not interfering with lateral packing and applied tighter final masks on 12,858 particles for subtomogram averaging (STA) (Fig. 5B and fig. S8, A to C). Such refinement necessitated user-side scripting to accommodate the small 68-kDa size of untagged GBP1, its flexibility, and the dense array on the bacterial OM. Using this strategy, we were able to resolve the larger GBP1 dimer and its smaller monomeric subunit to ~9 to 17 Å directly on the bacterial surface (Fig. 5, C and D, and fig. S9, A to D). At these resolutions, the LG, MD, and GED regions could be delineated (Fig. 5D and fig. S9, A to C). Native GBP1 adopts an asymmetric dimer with the LGs twisted and tilted relative to each other when attached to the bacterial OM (Fig. 5D). This may resemble the tilted LGs found in the crystallized dimer of human GBP5 (PDB ID 7E5A) (23), although the a12 and a13 GED helices appear extended into the LPS inner core and lipid A regions for native GBP1, yielding a minimum length of 22.4 nm (Fig. 5, D and E). Hence, one possibility arising from our cryo-ET analysis is that human GBP1 operates as an “open” conformer in its functional state (Fig. 5E); this contrasts with all monomer or dimer GBP crystal structures reported so far, which position the GED in a “closed” conformation (Fig. 5E). Enumerating these native conformers and the bacterial surface area present within each subtomogram segment, along with overall size measurements of StmDwaaG::pBAD-ftsZ minicells, we found 11,760 ± 735 GBP1 proteins assembled on the OM, yielding a >1-GDa structure. For a mature rod-shaped Stm, this extrapolates to ~22,000 to 32,000 GBP1 molecules per bacterium, which is consistent with earlier light microscopy estimates in situ. Cryo-ET thus provided a new structural view of this giant immune complex in which thousands of GBP1 dimers may stretch their C-terminal GED domain to 280 Å for anchoring the farnesyl tail and insertion of the nearby polybasic patch. This mesoscale coat also appeared evident in situ. Focus ion beam (FIB)–milled lamella together with correlative light and electron microscopy (CLEM) found GBP1-coated bacteria inside human cells (fig. S10, A to D). Longer StmpBAD-ftsZ bacilli were needed to detect rare coating events in thin ~150- to 300-nm FIB-milled lamella, and EGFP-GBP1 expression in a GBPD1q22.2 background ensured that it was the only GBP family member targeting bacilli (fig. S10A). This dual strategy succeeded in resolving what appear to be GBP1 coat complexes on CLEM-validated bacteria that had escaped into the cytosol; vacuolar Stm were devoid of EGFP-GBP1 as a negative control (fig. S10, B to D, and fig. S11, A and B). Individual GBP1 dimers could not be delineated at this resolution; however, the ~30-nm EGFP-GBP1 boundary surrounding Stm closely resembled the length of reconstituted coats in cell-free assays (fig. S11A). Hence, the conformational changes seen in vitro probably operate in cellulo to generate this massive GBP1 defense complex.
RES EARCH | R E S E A R C H A R T I C L E A B 2D tomographic slice 2D tomographic slice C x,z slice x,y slice Dimeric mask LG MD 20 nm GED OM Human GBP1 coat complex Monomeric mask on dimer LG MD GED Human GBP1 coat complex 20 nm D Salmonella OM 20 nm OM STA dimeric mask C1 symmetry STA monomeric mask C1 symmetry 9.8 nm 5.7 nm p LG 4.5 nm Native GBP1 conformers Salmonella OM MD 7- 11 7.9 nm 22.4 nm 22.4 nm 20 nm g GED 12- 13 10.0 nm Native GBP1 conformers y Salmonella OM 20 nm Inner core Lipid A Salmonella OM E Crystallized monomer (+ GMPPNP) Crystallized dimer (+ GDP.AIF3-) GBP1 monomer subunit model (+ GTP) 147° rotation STA dock monomeric-dimeric masks of native GBP1 Dynamic GBP1 dimer model (+ GTP) LG 13 y g Fig. 5. Human GBP1 could adopt a dynamically “open” conformer when assembled on the bacterial OM following GTP hydrolysis. (A) 3D segmentation of the human GBP1 coat complex with multiple upright GBP1 conformers attached to the bacterial OM, shown at 31.2 Angstroms by cryo-ET in the presence of 2-mM GTP. A 2D tomographic slice is shown at the top. (B) Representative 2D tomographic slice of StmDwaaG::pBAD-ftsZ OMVs coated with tag-free GBP1 in the presence of GTP. (Inset) The yellow box highlights elongated GBP1 conformers containing dimers (yellow arrows, white boxes). Scale bar, 20 nm. (C) (Top) Asymmetric GBP1 dimer on the bacterial OM captured through a larger mask. Image shows the 182nd of 256 slices used for generating a 3D volume of the GBP1 dimer STA within 256×256×256 voxels. The tomogram was rotated counterclockwise at 45° to reveal both LGs of the dimer. (Bottom) Smaller mask on one monomeric subunit of the native GBP1 dimer, which yielded higher resolution. Image shows the 155th of 256 slices used for generating a 3D volume of the GBP1 STA within 256×256×256 voxels. (Right) Cross-sections (x,z slices) of the GBP1 STA at the LG, MD, and C-terminal GED in the original orientation. (D) STA of native human GBP1 directly on the bacterial outer membrane. Native dimer (17-Å final resolution) and monomeric subunit of the dimer (9.7-Å final resolution) show a12 and a13 helical domains extending down into the bacteria outer membrane. (E) (Left) Monomer and dimer of models of crystallographic GBP structures in the presence of substrate analogs. (Right) Computational GBP1 monomer subunit and dimer models that incorporate a tilted LG domain of the GBP5 dimer (PDB ID 7E5A) together with an extended GED on the bacterial membrane following hydrolysis of its natural substrate, GTP. Monomeric STA docked onto its dimeric counterpart from cryoET studies is placed in between for comparison. The positions of LG, MD, and GED are noted, along with the CaaX motif for C15-farnesyl attachment. CaaX MD 12 PDB:7E5A (Human GBP5) y PDB:6K1Z (Human GBP1) 12 , GED + GTP hydrolysis 13 CaaX Salmonella OM Discussion Higher-order protein assemblies help amplify innate immune signaling and spatially regulate signal propagation by localizing partners at the site of ligand recognition (1, 3). Such assemblies form on the host plasma membrane, mitochondria, peroxisomes, and chloroplasts (1, 48). They also occur in the cytosol, nucleus, endoplasmic reticulum, and Zhu et al., Science 383, eabm9903 (2024) endosomal network, in some cases yielding membraneless condensates through liquidliquid phase separation (49), as recently discovered for plant GBPLs during cell-autonomous defense against bacterial phytopathogens (7, 8). By contrast, human GBP1 builds a multiprotein complex upon a completely foreign object, the gram-negative bacterial OM. This 1 March 2024 huge nanomachine solicits GBP2 to GBP4, caspase-4, and full-length GSDMD as part of a six-member platform to propagate cytokine and cell death signaling in multiple human cell types (10, 16). We found that human GBP1 is the central organizer of this platform and enlists nucleotide-dependent hydrolysis to selfassemble like other members of the DLP superfamily of large GTPases (18). GTP-driven GBP1 9 of 18
RES EARCH | R E S E A R C H A R T I C L E Fig. 6. Validation of the dynamically “open” conformer model for the GBP1 coat complex. (A) Direct visualization of isolated GBP1 dimers on StmDMinD minicell after GTP hydrolysis followed by the sequential wash protocol to remove crowdedness. (Inset) A zoomed-in view showing isolated GBP1 conformers (yellow arrows). (B) 3D segmentation of the StmDMinD minicell after wash treatment. (Inset) Zoomed-in view of isolated GBP1 depicting the LG domain (dashed circles) at the periphery with helical stalk underneath. (C) Topological evidence of the His6-GBP1 upright conformer. Representative tomographic slice of StmDMinD minicell (top) with and (bottom) without the His6-GBP1 coat complex in the presence of GTP. (Insets) Zoomed-in views of top (red) and bottom (blue) images. His6-GBP1 GD is labeled at the outer perimeter of the coat with 1.8-nm Ni-NTA-nanogold particles are shown in red arrow. Scale bars, 100 nm (top and bottom), 20 nm (insets). One of three independent experiments. Tomographs denoised with cryoCARE software to delineate nanogold particles. (D) Cross-link design between a7 in the MD and a12 in the C-terminal GED. (Inset) Residues selected for cysteine substitution for forming a disulfide linkage. (E) In cellulo examination of mRFP-GBP1 with Cys replacements targeting onto the Salmonella surface, indicating that cysteine mutations do not grossly alter GBP1 function inside human cells. GFP-expressing bacteria targeted with RFP-GBP1R362C–E526C, indicated by arrows. The GFP channel is pseudocolored turquoise. One of two similar experiments is shown. (F) (Left) Release of the covalent a7 to a12 crosslinked cysteines (recombinant RFP-GBP1R362C–E526C) by DTT allows GTP-dependent assembly on the bacterial OM in reconstitution assays. (Right) Wild-type recombinant RFP-GBP1 is unaffected by the presence of DTT in GTP-dependent coat assays. Scale bar, 2 mm. One of three similar experiments is shown. Single-letter abbreviations for all the amino acid residues tested are as follows: A, Ala; C, Cys; E, Glu; G, Gly; H, His; I, Ile; K, Lys; R, Arg; and S, Ser. A B C p g D E y 7 F y g -DTT y , +DTT cooperativity gave a sigmoidal Stm coating curve on bacteria that steeply accelerated above 125 nM, resembling other “prionizing” proteins in which all-or-none responsivity occurs once a concentration threshold is reached (3). Anchorage to LPS may help accelerate GBP1 catalysis and oligomerization (16). Both GTPase and GDPase activities contributed to GBP1 reZhu et al., Science 383, eabm9903 (2024) sponsivity through GTP and GDP turnover as part of a two-step enzymatic process (15, 21). Because hydrolysis of GTP and GDP liberates large amounts of Gibbs free energy, the GBP1 coat conforms to a nanomachine by performing “work” in establishing this massive signaling platform. It may explain why transition-state analogs such as GDP.AIF3– fail to recapitulate 1 March 2024 +DTT the native coat on intact bacteria (15) despite helping GBP1 form dimers (20, 21). Instead, multiple rounds of GTP and GDP hydrolysis are needed to continually drive assembly of adjacent dimers that probably undergo lateral interactions to stabilize the coat in register. Cryo-ET suggests that these lateral interactions could result from GTP-induced changes 10 of 18
RES EARCH | R E S E A R C H A R T I C L E 1 March 2024 HeLa (CCL-2) and 293T (CRL-3216) cells were purchased from the American Type Culture Collection (ATCC). Cells were grown in DMEM supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS) at 37°C in a 5% CO2 incubator. Lentiviral (LentiCrisprV2; Addgene Plasmid #52961) or retroviral (pMSCV-puro; Takara 634401) transductions were done by incubating dilutions of 0.45 mm filtered supernatants from transfected 293T cells with 8 mg/ mL polybrene for 24 hours. For selection of stable transductants, 1 mg/ml puromycin was included. For transient transfections, TransIT®LT1 (MIRUS; MIR 2300) was used according to manufacturer’s instructions. To minimize toxicity in microscopy experiments, 200 ng of DNA was transfected per 24-well cover slip. HeLa cells were stimulated with 500 to 1000 U/mL IFN-g for 18 hours. 11 of 18 , GTP sodium salt (G8877), GTP-g-S (tetralithium salt; G8634), GDP sodium salt (GDP; G7127), GMP sodium salt (GMP; G8377), aluminum trifluoride (449628), chloramphenicol (220551), Ficoll (F5415), and biotin (B4501) (Sigma/ Millipore); Guanosine-5′-[(b,g)-imido]triphosphate (tetralithium salt)/GMPPNP/GppNHp (Jena Biosciences; NU-401-50); recombinant human IFN-g (285-IF/CF; R & D Systems; 285-IF); Salmonella minnesota LPS–Alexa Fluor 488 (ThermoFisher; L23356). Cell culture and transfection y Reagents y g Antibodies used were anti-Flag M2 (F1804, Sigma), anti-HA (16B12, Biolegend), anti-Myc (9E10, ThermoFisher), anti-GFP (11814460001, Roche; A0174, Genscript), anti-GST (1E5, Origene), anti-DsRed (sc-390909, SCBT), antiGBP1 (sc-53857, SCBT), anti-GBP2 (sc-10581, SCBT), anti-Salmonella O Group B antiserum (240984, BD), anti-flagellin (FliC-1, BioLegend), anti-b-actin (ab6276, Abcam), anti-GAPDH 41335; SCBT), anti-IL-18 (PM014; MBL), anticaspase-4 (clone 4B9; Enzo), and anti-GSDMD (NBP2-33422, Novus Biologicals). See table S1 for applications. Bacterial strains were generated in-house or kindly provided by the following groups: S. enterica serovar Typhimurium (Stm) strain 1344 and flagellin-deficient StmDflhD (Dr. Jorge Galan); Stm UK-1 wildtype, Dwzy, DwaaL, DwaaJ, DwaaI, DwaaG, DlpxR, DpagL, DpagP, and c11088 (StmDlpxRDpagLDpagP triple mutant) (Dr. Roy Curtiss III, Dr. Soo-Young Wanda) (38, 40); P. aeruginosa L2 strain (Dr. Barbara Kazmierczak), Bacillus subtilis (Dr. Farren Isaacs), and L. monocytogenes 140203S (Dr. Herve Agaisse). The following Stm strains were constructed on a 1344 isogenic background: StmDminD, StmpBAD::ftsZ, StmmreB(K27E), StmmreB(D78V), Stm mScarlet-I , and Stm eGFP . In addition, StmDWaaG::pBAD-ftsZ was generated on the UK-1 background for cryo-ET. See table S2 for details. To generate Stm MinD deletion and MinD/ waaG double deletion mutants in UK-1, the lambda red recombinase system was used. A kanamycin cassette with minD flanking sequences was amplified by primers minDKO-L (GTTTACGATTTTGTAAACGTCATTCAGGGCGATG CGACtgtgtaggctggagctgcttcg) and minDKO-R (GGAGATGTTCTTTAATCGGTTCTTCGCC ATTTTCTcatgggaattagccatggtcca) with pKD4 vector as the template. The polymerase chain reaction (PCR) product was gelextracted and electroporated into wild-type UK-1 and waaG-deletion UK-1 Stm competent cells, which were expressing lambda red recombinase. Kanamycin (Km)–resistant strains were plate selected, and kanamycin cassette insertion into the minD gene was checked by minD Km insert validation primers, minDKm-L (ATTTTGTAAACGTCATTCAGGGCG) and minD-Km-R (gcagttcattcagggcaccg). To check the deleted region of minD, primers minDWT-L (GCTGATCAAAGATAAGCGTACTGA) and minD-WT-R (CGATGCCAGAATACCCAG AATACG) were used. y Materials and Methods Antibodies and reagents Antibodies Bacterial strains g Zhu et al., Science 383, eabm9903 (2024) directly from human cells using fast protein liquid chromatography (FPLC) also ensured proper OM anchorage and insertion. C15 lipidation requires sequential addition by human farnesyltransferase, tripeptide removal by CAAX carboxypeptidase, and carboxy-group methylation by isoprenylcysteine carboxymethyltransferase (32). Postprenyl processing thus brings the fully modified farnesyl tail almost adjacent (three amino acids apart) to the triple-arginine patch, creating a powerful bipartite anchor. OM insertion of the polybasic motif likely undergoes electrostatic interactions with the negatively charged PO4– groups of lipid A and inner core saccharides, whereas farnesylation makes the tail more hydrophobic (15, 16). Together, these modifications enabled STA of human GBP1 bound to gram-negative bacteria. It should help annotate tomographic densities of FIB-milled human cells now that we have established initial conditions to detect GBP1-coated bacteria in cellulo. Our 3D reconstruction from cryo-ET elucidates the mesoscale architecture of a distinctive host defense structure, the massive GBP1 coat complex, that cooperatively functions on the surface of microbial pathogens inside the human cytosol. Our findings reinforce the importance of higher-order protein assemblies within the innate immune systems of animals and plants. These nanomachines concentrate signaling and effector proteins for rapid mobilization of cell-autonomous resistance to infection. p to the twisted LG itself, given that GBP1 dimers appeared slightly asymmetric when embedded within the native coat complex. The functional importance of GTP hydrolysis was further reinforced by its ability to trigger GBP1-dependent LPS release, which activates caspase-4 and sensitizes bacteria to APOL3mediated killing (13). Again, transition-state (GDP.AIF3–, GMP.AIF4–) or nonhydrolyzable analogs (GTPgS or GMPPNP/GppNHp) failed to elicit GBP1-dependent disruption of the OM to liberate LPS. These results highlight the limitation of using substrate mimics to probe GBP1 defense complex formation and functionality on the pathogen surface, despite their usefulness in earlier studies of isolated GBP1 (20, 21, 24). Cryo-ET provided us with structural information about GBP1 and its supramolecular architecture on the gram-negative Salmonella surface in its native state. Previous crystal structures of GBP1 used full-length recombinant protein produced in Escherichia coli to capture the monomeric (apo) state ± GMPPNP (20, 22). The N-terminal G-domain also produced in bacteria was crystallized as a homodimer in the presence of multiple nonhydrolyzable nucleotides (GMPPNP, GDP.AIF3–, GMP.AIF4–, and GMP) (21). Both full-length human GBP1 crystal structures position a12 and a13 GED helices tucked up against the a7 to a11 MD in a folded conformation, whereas under native conditions, we found that recombinant GBP1 produced in human cells is fully stretched with the a12 and farnesylated a13 helices inserting vertically into the bacterial outer leaflet. Identifying an “open” GBP1 conformer as the principal repetitive unit of the mature coat complex reinforces the capacity of cryo-ET to yield insights into the behavior of assembled proteins on their natural membrane targets and in the presence of their natural substrate, which is in this case GTP (50). Our attempts to resolve the GBP1 defense complex assembled on its physiological surface proved challenging across two scales: first, the small size of GBP1 dimers (~140 kDa), and second, the giant ~1.5-GDa size of the final polymer. Determining the length and orientation of individual GBP1 molecules to 9.7 Å among thousands of identical proteins benefitted not only from post-acquisition masking but also from bacterial genetics plus recombinant protein preparation. Purified 150to 300-nm minicells and OMVs with reduced thickness helped improve the quality of our tilt images. It was further aided by genetic removal of the O-antigen and outer core to prevent unstructured LPS density from interfering with GBP1 C-terminal resolution (45). Part of the GED of GBP1 otherwise hidden within the inner leaflet could be reconstructed from tomographs to help confirm the dynamically open model. Farnesylated GBP1 purified
RES EARCH | R E S E A R C H A R T I C L E CRISPR-Cas9 cell lines and stable complementation 1 March 2024 HeLa cells were grown on 12-mM high performance cover glass #1.5h (Thorlabs CG15KH1) for microscopy of fixed samples. For live imaging, cells were seeded on four-well chambers (Cellvis C4-1.5H-N) with 1.5 high performance cover glass. Here seeding occurred 48 hours prior to imaging to reach 80% confluency on the day of infection. They were treated with IFN-g for 18 to 24 hours prior to imaging. Bacteria were added to cells as described for infections at an MOI of 20. Images were analyzed on a DeltaVisionTM OMX SR Blaze microscopy system (GE Healthcare) or a laser scanning confocal model SP8 (Leica). For ultrafast live imaging, GBP1–/– HeLa cells were transfected with RFP-GBP1, induced with 1000-U/mL IFN-g for 18 hours, and infected with EGFP-Stm at MOI 20. After 40 min, the media was changed to DMEM with 30 ug/ mL gentamycin and the sample was imaged starting 60 min postinfection at 37°C, 5% CO2. Images were collected every 45 s using OMXSR Blaze microscope (GE) in 3D-SIM 512 × 512-pixel mode at ~180 frames sec−1. Images represent maximum intensity projections of deconvolved z-stacks of Moire fringe patterns (Softworx, GE). Postacquisition calculations for real-time voxel (boxed) assembly events used Imaris (Oxford instruments) software. When combined with 3D atomic structure volumes of GBP1 (PDB ID 1F5N) and RFP 12 of 18 , The KDO of log-phase Stm was labeled by using CLICK-mediated according to the manufacturer’s instructions (Jena Bioscience). Briefly, an azide modification of the C8-position of KDO with a biorthogonal azido group was introduced to prevent reverse metabolism by KDO-8-P phosphatase. This 8-azido-8-deoxyKDO modification enabled a biotin group within a DIBO alkyne dye intermediate (Jena Bioscience CLK-A105P4) to be introduced via Cu(I)-free CLICK chemistry for addition of the Alexa Fluor 594 tag (Jena Bioscience CLK-1295). For infection experiments, we conducted click chemistry reactions on bacteria that had already Microscopy 3D-SIM and multicolor confocal microscopy y KDO-azide Cu2+-free CLICK chemistry Fluorescent blue or red D-alanine analogs [HCC-amino-D-alanine, HADA (MCE HY131045); TAMRA 5-amino-D-alanine using 5Carboxytetramethylrhodamine (ab145438)] were incorporated as described (46). Infection of HeLa cells at MOI 20. After 40 min of infection the media was changed to DMEM with 100 mg/mL gentamycin after next 1 hour to 30 mg/mL gentamycin. Cells were fixed with PFA at 2 hours postinfection and immunestained for GBP1 or LPS. At least 10 GBP1positive and 10 GBP1-negative fields of view were collected using the DeltaVisionTM OMX SR Blaze microscopy system (GE Healthcare) in the 3D-SIM mode (512 × 512 pixels, 1-ms exposure, 125-nm step, 8 z slices, 15 images per slice). All images were subjected to processing to widefield image, deconvolution, and maximum intensity projection for semiautomatic analysis in CellProfiler (Broad Institute, Open Scholar, 2021). y g Zhu et al., Science 383, eabm9903 (2024) 293E cells (ATCC HEK CRL-1573) expressing GFP or GFP-GBP1 mutant constructs were plated at 2 × 105 cells in each well of a sixwell plate. Cells were then treated with 20-mM Azido farnesyl pyrophosphate (Cayman C10248) for 18 hours followed by cell lysis in 500 mL of 20-mM Tris (7.5), 100-mM NaCl, 1% TX-100 buffer containing Roche protease inhibitors. Cells were further sonicated (30% power Virtis Virsonic 600, three times for 1 min each) on ice to liberate membrane bound proteins. Lysates were centrifuged at 21,000g for 10 min. Supernatants were transferred to a new Eppendorf tube and were treated with 100-mM Biotin dibenzocyclooctynol (DIBO) (Thermo C10412) overnight at room temperature in the dark. 1 mg Roche monoclonal anti-GFP antibody was added to each IP followed by a 2 hours incubation at 4°C. 20 mL of preequilibrated Protein G Sepharose (Cytiva 17-0756-01) was added to each reaction for an additional 2 hours. Beads were pelleted at 4000 g for 5 min followed by eight washes in lysis buffer. Samples were subsequently eluted by 100 mL addition of 2X SDS-Sample Buffer followed by heating at 100°C for 20 min for immunoblotting. Immunoblots were performed with streptavidin-HRP and Roche anti-GFP. Metabolic labeling of Stm peptidoglycan and LPS release in cellulo y For Stm infections, overnight bacterial cultures were diluted 1:33 in fresh Luria broth (LB; Thermo 12780029), grown for 3 hours before being washed once in PBS, and used to infect HeLa cells at 80% confluence with a multiplicity of infection (MOI) of 20 to 50 as indicated. Plates were centrifuged for 10 min at 1000x g and incubated for 30 min at 37°C CLICK chemistry and metabolic labeling Farnesylpyrophosphate (FPP)–azide-biotin CLICK chemistry incorporated fluorescently labeled D-alanine into the underlying peptidoglycan scaffold using a pulse of 500 mM HCC-amino-D-alanine (HADA; MCE HY-131045). Unincorporated DIBO was removed through extensive washing in PBS. g Bacterial infections, LDH assay, and IL-18 ELISA to allow invasion. Extracellular bacteria were killed by replacing media with fresh DMEM (Thermo 11965092) containing 100 mg/ml gentamicin (Thermo 15710064) for 30 min. Cells were washed 3 times and incubated with 20 mg/ml gentamicin for the duration. To enumerate live bacteria, cells were lysed in PBS + 0.5% Triton X-100 and serial dilutions plated on LB agar. For LDH assay, cell death was measured by CytoTox 96® Non-Radioactive Cytotoxicity Assay (Promega G1780). IL-18 release in supernatants was detected via human IL-18 ELISA kit (Abcam; ab215539) per the manufacturer’s instructions with a detection sensitivity of 8.3 pg/mL. p To generate stable gene knockouts in HeLa CCL2 cells, single guide RNAs (sgRNAs) were cloned into pX459 (Addgene Plasmid #62988) per established protocols. Two to four sgRNAs targeting each gene (200 ng total DNA) were transfected in 24 well plates for 24 hours, followed by selection with 1 mg/mL puromycin for 48 hours. Surviving cells were expanded into media lacking puromycin for 48 hours, then subject to limiting dilution to obtain single colonies. Colonies were screened first by PCR, then by Western blot, and the genotype of each positive clone was determined by Sanger sequencing. The following 10 CRISPRCas9 mutants were generated: GBP1–/–, GBP2–/–, GBP3–/–, GBP4–/–, GBP1–/–GBP2–/– double mutant, GBPD1q22.2 septuple mutant (GBP1–/– GBP2–/–GBP3–/–GBP4–/–GBP5–/–GBP6–/–GBP7–/–), CASP4–/–, GSDMD–/–, AOAH–/–, and RNF213–/–. A complete list of guide RNAs (gRNAs) used to generate these CRISPR deletions are provided in Table S3. In addition, we generated a series of cell lines stably or transiently complemented with GBP mutants, affinity probes or reporters. These included GBP1–/– clonal lines complemented with either of the following: EGFP-GBP1, RFPGBP1, mNG-GBP1, EGFP-GBP1S52N, EGFPGBP1DD103,108NN, EGFP-GBP1D184N, EGFP-GBP1C589S, EGFP-GBP1a13ARR, EGFP-GBP1a13RAR, EGFPGBP1a13RRA, EGFP-GBP1a13ARA, EGFP-GBP1a13AAR, EGFP-GBP1a13AAA (R584-586A). Here alanine scanning mutations in the C-terminal polybasic patch (amino acid 584 to 586) of GBP1 were introduced according to Stratagene Quickchange (Agilent 200523) protocol and confirmed by DNA sequencing. Transfections of plasmids for complementation into GBP1–/– HeLa cells were performed using Mirus LTI according to manufacturer protocol. Briefly, 1 mL Mirus LTI was added to 50 mL serumfree DMEM followed by the addition of 500 ng of respective construct. The mixture was allowed to sit for 30 min followed by gentle mixing through pipetting. Cells were selected for hygromycin resistance on the puromycinresistant GBP1–/– HeLa cell background. We also complemented CASP4–/– with EGFPcaspase-4 and GSDMD–/– with either EGFP- FLGSDM EGFP-NT-GSDMD, or EGFP-CT-GSDMD. The latter plasmids were also introduced into CASP4–/– and GBP1–/– clonal lines as above for fluorescent microscopy.
RES EARCH | R E S E A R C H A R T I C L E 4Pi-SMS nanoscopy , 13 of 18 y The coding sequences of human GBP1 and its mutants were cloned into a customized vector pCMV-His10-Halo-HRV-mRFP-TEV for coating assays. HEK 293F suspension cells (a gift from Dr. James Rothman; mycoplasma-negative) was maintained at a concentration of 0.4 × 106~4 × 106 cells/m in Expi293 expression medium (ThermoFisher A1435101). 24 hours prior to transfection, cells were seeded at a concentration of 1.2 × 106 cells/ml. For transfection, cells were harvested and resuspended in fresh medium at a concentration of 2.5 × 106 cells/ml. Cells were transfected by adding pCMV-His10-Halo-HRV-mRFP-TEV–containing clones to a final concentration of 1 mg/ml in media containing PEI at a concentration of 5 mg/ml. 24 hours after transfection, cells were diluted 1:1 (v/v) with fresh medium containing 4-mM valproic acid and cultured for an additional two days. 2 × 109 cells were harvested via centrifugation (500 x g, 10 min), washed once in cold PBS, resuspended in lysis buffer (50 mM HEPES, pH 7.5, 500 mM NaCl, 1 mM MgCl2, 10% glycerol, 0.5% CHAPS, 1 mM TCEP) and lysed through sonication. Cells were cleared at 35,000 x g for 1 hour at 4°C. Supernatant was collected and incubated with 1 ml bed volume of HaloLink resin (Promega G1912) at 4°C overnight with gentle rotation. The resin was sequentially washed twice (10 min each) with wash buffer 1 (50-mM HEPES, pH7.5, 500 mM NaCl, 1 mM MgCl2, 10% glycerol, 0.5% CHAPS), wash buffer 2 (50 mM HEPES, pH7.5, 1 M NaCl, 10% glycerol) followed by wash buffer 1. To elute bound proteins, Halo resin was resuspended in lysis buffer and digested with homemade GST-HRV-His protease overnight at 4°C with gentle rotation. Resin was pelleted and the HRV protease was removed from the supernatant via Ni-NTA beads by affinity chromatography (QIAGEN 30210). Flow through was collected, concentrated, and further purified and buffer-exchanged via size exclusion y g 1 March 2024 Purification of recombinant proteins GBP1 to GBP4 and their mutants, caspase-4C258A, and RFP-AtGBPL1 y For 4Pi-SMS imaging, a customized microscope built using a vertical 4Pi cavity around two opposing high-NA objective lenses as detailed elsewhere (28) was used to capture high-resolution images of the GBP coat complex in IFN-g–activated HeLa cells. Cell samples were prepared on 25-mm diameter round precision glass cover slips (Bioscience Tools, San Diego, CA) that had been immersed in 1M KOH and sonicated for 15 min in an ultrasonic cleaner (2510 Branson, Richmond, VA). Sequential washes in Milli-Q water (EMD Millipore, Billerica, MA) and sterilization with 70% ethanol was followed drying and polylysine coating of coverslips. HeLa cells were grown on coverslips for 24 to 48 hours before fixation in 4% paraformaldehyde (PFA). AntiGBP1 (1B1; Santa Cruz; 1:500 dilution) and GBP2 (1E5; Origene; 1:200 dilution) antibodies were labeled for 2 hours at room temperature by goat anti-mouse Fab AF647 (Jackson ImmunoResearch, PA) and goat anti-rabbit IgG CF660C (Biotium, CA) at 1:200 dilution as described (29). 1B1 antibody was raised against the fulllength GBP1 protein whereas anti-GBP2 targets an N-terminal 17-amino acid peptide epitope. This enabled both antibodies to bind their endogenous GBP targets because the N-terminal LG is oriented toward the top of the coat complex. Specificity was confirmed in IFN-g–activated GBPD1q22.2, GBP1–/– or GBP2–/– HeLa cells as negative controls: all went unlabeled at the single molecule level. At least several hundred GBPs were detectable on cytosolic bacteria using this technique, typically ~400 to 800 molecules. Although this number represents <2 to 3% of the total enumerated by cryo-ET in cell-free systems, when 1B1 antibody staining was used on cell-free GBP1-coated bacteria it gave similarly low numbers. Hence, antibody accessibility (due to the densely packed nature of the coat) together with larger secondary antibody detection were limiting factors. Commercially available nanobodies do not currently exist for GBP1 or GBP2. Notably, however, this comparison discounted bacteria having fewer GBP coat proteins in cellulo compared with in vitro as both gave similar results when labeled with the same polyclonal antibody. Sample mounting, image acquisition, and data processing were mostly performed as previously described (29) except that the imaging speed was 200 Hz with 642-nm laser intensity of ~12.5 kW/cm2. Typically, 3000×100~200 frames were recorded. DME were used for drift correction. All 4Pi-SMS images were rendered using Point Splatting mode (20 nm particle size) with Vutara SRX 7.0.06 software (Bruker, Germany). g Zhu et al., Science 383, eabm9903 (2024) Stm SL1344 at MOI = 5~10 for 30 min and further incubated with 100 mg of Gentamycin for 50 min to eliminate extracellular bacteria. Five- or six-color fluorescence images were captured on Laser Scanning Confocal Microscope (SP8, Leica) with Z-stacks. A series of lasers were used to excite fluorescence across this broad wavelength and avoid bleed-through as shown in fig. S4E. The corresponding laser parameters (laser, % power, wavelength reception band) used were: pSapphire (Diode 405, 4, 424 to 444), pmEmerald (WLL 470, 20; 490 to 520), pmVenus (WLL 516, 6; 535 to 559), pmOrange (DPSS 561, 25, 566 to 593), pmIFP24 (HeNe 633, 75, 680 to 730). Images were analyzed by LAS X software (Leica) for 3D reconstruction. p (PDB ID 1GGX) calculated through the Voronoi cell algorithm (http://proteinformatics.org/ voronoia), the total number of spatially constrained RFP-GBP1 molecules per voxel were counted, along with coat kinetics. Euclidean Voronoi cell algorithms enable the packing densities of all atoms in a deposited protein structure (PDB) to be estimated, accounting for the volume inside an atom’s van der Waals sphere, the solvent excluded volume of the atom, and the position as well as approximate radius of every cavity that can accommodate a water molecule within the protein to yield complete volumetric information (51). In addition, a compensatory ratio of 3D-SIM fluorescence versus EM volumes of GBP1-coated bacteria was included since the former does not resolve objects to the same precision as EM. 3D-SIM volumes were on average 3.02 times larger (n = 17) than direct measurements by immuno-EM. Thus, 3D-SIM volumes were divided by 3.0 to correct for fluorescence enhancement. Long-term imaging used low light OMX-SR conventional mode for up to 2.5 hours continuous recording at 5-min intervals (fig. S3C). For examining the GBP-COAT450-708 complex, we constructed fluorescent fusion proteins GBPs1-4, caspase-4, and GSDMD across different spectral range to accommodate five or possibly six proteins simultaneously along with Stm. A color-coded matrix of 60 proteins was generated by fusing each of the six coat proteins to each of the following fluorescent reporters: mAzurite- c1 (Addgene Plasmid #54583), mT-Sapphire-c1 (Addgene Plasmid #54545), pmTurqouise2-c1 (Addgene Plasmid #60560), pmEmerald-c1 (Addgene Plasmid #53975), pmVenus-c1 (Addgene Plasmid #27794), pmOrange-c1 (Addgene Plasmid #54680), pmKeima-Red-c1 (Addgene Plasmid #54546), pmCardinal-c1 (Addgene Plasmid #54799), pmApplec1 (Addgene Plasmid #54631), and mIFP24-c1 (Addgene Plasmid #54820); Ex/Em range, 384/ 450 to 684/708 nm. In brief, GBP1,2,3 and 4 were amplified by PCR with each primer from IFNa-treated HeLa cell cDNA. Caspase-4 and GSDMD were amplified by PCR with each primer from caspase-4 cDNA (Sino Biologicals #HG11158-M) and pET-SUMO-hGSDMD (Addgene, Plasmid #111559), respectively. Amplicons were cloned into reporter plasmids using SalI/ BamHI restriction enzyme digestion. All constructs were sequenced for validation. Multiarrayed testing found five combinations of either pmIFP24-GBP1, pmOrange-GBP2, pmVenus-GBP3, pmEmerald-GBP4, Sapphirecaspase 4 or -GSDMD, or pmOrange-GSDMD could be used successfully with Stm. GBP-COAT450-708 combinations were transfected into the GBPD1q22.2 septuple mutant by TranslT-LT1 transfection reagent (Mirus Bio) according to manufacturer’s instructions. After 24 hours, cells were activated with IFN-g for 16 to 18 hours and infected with SPI1-induced
RES EARCH | R E S E A R C H A R T I C L E Reconstituted coat assays Wild-type Stm and Stm mutants were freshly streaked on LB plates. A single fresh colony of bacteria was cultured in LB medium overnight at 37°C. Before the coating assay, bacteria were diluted 1/60 in fresh LB medium, cultured for additional 2 hours and harvested via centrifugation (4000g, 5 min at 22°C). To remove shed LPS which inhibits rRFP-hGBP1 targeting, bacteria was washed twice in coating buffer [50 mM HEPES (pH 7.5), 150 mM NaCl, 1 mM MgCl2] and further diluted to an optical density (OD600) of 0.1 in coating buffer. Im- 1 March 2024 Reconstituted killing assays For bacterial killing assays, Stm were grown to mid-log phase in LB medium, washed, and incubated with 5 mM hGBP1 in coating buffer (50 mM HEPES pH 7.4, 150 mM NaCl, 5 mM MgCl2) with or without 2 mM GTP, 2 mM GTPgS or GDP.AIF4– (2 mM GDP, 200 mM AlCl3, 10 mM NaF). Stm was then pelleted and resuspended in Buffer A [50 mM MES pH 6.0, 100 mM potassium gluconate (KGluc)] containing 5 mM rAPOL3 and incubated at 37°C for 1 hour prior to plating on LB agar to enumerate colony forming units (CFU) in triplicate. In vitro phase separation Protein aliquots of rRFP-GBP1 and rRFP-GBPL1 (7) were thawed at room temperature, centrifuged at 14,000 × g for 5 min to remove any aggregated protein. Droplet formation was induced by diluting protein to low salt buffers (50 mM HEPES, pH7.5, 150 mM NaCl, 1 mM MgCl2) by mixing with various volumes of no salt buffer [20 mM HEPES (pH 7.5), 1 mM TCEP] and analyzed in chambered coverglass (Grace Bio-labs) using a Lecia SP8 laser scanning confocal at 63×/1.40 magnification. Addition of Ficoll at 5, 10, 15, and 20% w/v had no effect on rRFP-GBP1. Electron microscopy Negative-stain electron microscopy To visualize rRFP-GBP1 on minicells, 100 mL minicells were washed and dissolved in the 14 of 18 , Zhu et al., Science 383, eabm9903 (2024) Human GBP1, GBP2, GBP3, GBP4, GBP1 mutants (GBP1S52N, GBP1D184N, GBP1DD103,108LL, GBP1R53A, and GBP1C589S) and caspase-4C258A proteins were expressed as FLAG-tagged proteins in human embryonic kidney (HEK)-293E cells and isolated from large-scale adherent cell culture using Flag M2 beads as described above. Recombinant human proteins were further purified to single peak using FPLC. Fluorescence anisotropy assays were conducted at 37°C across different GBP concentrations in binding buffer [50 mM Tris, 150 mM NaCl, 5 mM MgCl2, 0.3 mM GDP and AlFX (10 mM NaF, 0.3 mM AlCl3), pH 7.0] and Flag- caspase4C258A (50 mM Tris, 150 mM NaCl, 1 mM DTT, pH 7.0) for 15 min followed by addition of Salmonella minnesota LPS–Alexa Fluor 488 to a final concentration 250 nM. After 1 hour incubation with LPS, fluorescent anisotropy values measured by SpectraMax i3x (Molecular Devices). y Thin layer chromatography (TLC) was used to separate GTP, GDP, and GMP and performed exactly as previously described (7–9). Briefly, a-[32P]GTP (Perkin Elmer BLU006H250UC) hydrolysis by purified recombinant proteins in reaction buffer [20 mM HEPES (pH 7.0), 150 mM NaCl, 5 mM KCl, 1 mM MgCl2, 100 mM GTP, 10 mCi a-(32P) GTP] was determined at 25°C before quenching the reaction with 142 mM LPS-binding assays y g Thin-layer chromatography Overnight-cultured Stm was preincubated with indicated inhibitors at 37°C with shaking for 2 hours. After centrifugation by 3500 rpm room temperature for 20 min, bacteria were washed three times by 10-fold volume of coating buffer [50 mM HEPES (pH 7.5), 150 mM NaCl, 1 mM MgCl2, and 1 mM DTT] and finally resuspended by 1 mL of coating buffer containing GTP (2 mM), GTPgS (2 mM), GMPPCP/ CppCp (10 mM), GDP.AIF4– (2 mM GDP, 200 mM AlCl4, 10 mM NaF) or GMP.AIF3– (2 mM GMP, 200 mM AlCl3, 10 mM NaF]. Bacteria aliquoted were incubated with or without 4 mM of recombinant GBP1 or its mutants at 30°C for 1 hour. Supernatants were carefully collected by centrifugation (8,000 rpm, 22°C for 2 min) and diluted 1:1000 to 1:5000. Released LPS was measured by ToxinSensor Chromogenic LAL Endotoxin Assay Kit (GenScript L00350) according to manufacturer’s instructions. y His6-tagged GBP1 or GBP1 mutant proteins were prepared as described above. FPLC was performed on an AKTA system equipped with a Superdex 200 10/300 GL size exclusion column (GE Amersham). After preequilibrating the column with five volume equivalents of buffer [20 mM Tris (7.5), 140 mM NaCl, 2 mM MgCl 2], 100 mg of each recombinant GBP1 protein was examined. Column buffer was then exchanged and equilibrated with 20 mM Tris (7.5), 140 mM NaCl, 2 mM MgCl2, containing 200 mM GDP-AlF4– to test GBP1 assembly in the presence of the transition state analog. Chromatographs were generated by absorbance measured at 280 nm over retention time. LAL for lipid A detection in OM disruption assays mediately before coating, rRFP-hGBP1 was thawed at room temperature and centrifuged at 12,000 g for 15 min to remove any insoluble aggregates. For coating, 2 mM rRFP-hGBP1 and 2 mM GTP were added to each 0.1 OD of bacteria, gently mixed and incubated for 1 hour at 22°C before imaging. To image rRFP-hGBP1-coated bacteria, coating reactions (20 mL) were transferred to 384well glass bottom plate (Cellvis; P384-1.5H-N). The plate was centrifuged at 2000g for 1 min to collect all liquid to the bottom of the well. All images were acquired using a Leica SP8 laser-scanning confocal microscope with a 63×/1.40 oil immersion objective. Focal plane was set to the bottom of the well. RFP was excited at 561 nm and detected at 590 to 610 nm. The optical slices were acquired in confocal mode (1 Airy unit) with an average of six scans. Images were collected in a 512 × 512 format. Image analysis was performed with FIJI/ImageJ. For coat complex assembly, samples were doubly diluted from 2 mM rRFP-GBP1 until loss of coating to establish a coating curve. The observed behavior was plotted with bestfit interpolation and a sigmoidal curve emerged. Curve fitting together with regression analysis found half maximal and Hill slope values using Graph Pad Prism 9.1.1. g Size exclusion chromatography EDTA after 7 hours. The resulting products were separated by PEI cellulose (Sigma, Z122882) with fluorescent indicator (UV 254) using 750 mM KH2PO4 (pH 3.5) as solvent and visualized by autoradiography. p chromatography (Superdex® 200 Increase; GE Healthcare) equilibrated with storage buffer [20 mM HEPES (pH 7.5), 150 mM NaCl, 1 mM MgCl2, 1 mM TCEP]. Fractions were analyzed by SDS-PAGE, pooled, concentrated and flash frozen in liquid nitrogen before storing at -80°C. Protein concentration of rRFP-tev-hGBP1 (abbreviated rRFP-hGBP1) was determined via BCA and SDS-PAGE electrophoresis with BSA standards running aside. Recombinant human GBP1, GBP2, GBP3, and GBP4 as well as the GBP1 mutants (hGBP1S52N, hGBP1D184N, hGBP1DD103,108LL, hGBP1C589S, and hGBP1R3A) were produced by cloning the respective genes into the mammalian expression vector, pCMV-3Tag1A (Agilent 240195), with an N-terminal FLAG tag. Human caspase-4 C258A was cloned into pcDNA 3.1/Hygro (Thermo V87020) for N-terminal FLAG attachment. Plasmids were transfected via Mirus LT1 into HEK-293 E cells. Cells were harvested after 14 hours and lysed for 2 hours in buffer 50 mM Tris, 150 mM NaCl, 5 mM MgCl2, 1 mM DTT containing 1% Triton X-100 and protease inhibitor. Supernatant containing the expressed protein passed through anti-Flag M2 affinity gel (Sigma A2220) and bound Flag protein eluted using Flag peptide 150 mg/mL in buffer 50 mM Tris, 150 mM NaCl, 5 mM MgCl2 and 1 mM DTT. Further chromatographic purification was undertaken on an AKTA FPLC (GE Amersham) instrument. All recombinant proteins made in human cells were subject to LAL (ThermoFisher A39552) to confirm the absence of LPS contamination (<0.01 EU/mL, lower detection limit).
RES EARCH | R E S E A R C H A R T I C L E HEPES buffer (pH 7.4) to the OD600 equal to 0.1. The minicell suspensions were incubated with rRFP-GBP1 with a final concentration of 2 mM in the presence or absence of GTP at 22°C for 1 hour. The mixture was concentrated to 10mL for further TEM observation. 5 mL RFP-GBP1 coated and noncoated minicells were loaded onto glow-discharged carbon film coated cooper EM grids (EMS, CF400Cu-50) for standing 1 min. The EM grid was washed and stained with 2% uranyl formate for 30 s. The grid was blotted by filter paper (Whatman FILTER PAPERS 2; 1002-090) and dried for 1 min. Grids were examined in JEOL1400 plus electron microscope with acceleration voltage of 80 kV. Cryo-ET Cell seeding on EM grids 15 of 18 , 1 March 2024 Tomography data for the FIB-milled lamella sample were collected using a Titan Krios G2 transmission electron microscope (Thermo Fisher Scientific) equipped with a 300 kV field-emission gun, a Volta phase plate (phase shift located around 1/2 pi), a Quantum post column energy filter (20-eV slit), and a Gatan K2/K3 summit direct detection camera. We first navigated the stage to the lamella and collected a montage at medium magnification (2250x); we used ImageJ to overlap the TEM montage with the map taken by a second CLEM. Three ice deposits as well as a doublemembrane vesicle on the lamella were used as shared markers to overlay these two maps. One of the successful targets with a GFP signal was located beneath the largest ice deposit and close to the lamella edge. The stage was moved to the right of the target with fluorescent signal to collect tilt series. The images were taken in a dose-fractionated mode at near focus using SerialEM software. The resulting physical resolution is 0.45 nm/pixel. A total dose of 80 e/Å2 distributed among 33 tilt images was undertaken covering angles from 39° to –57° at tilting step of 3° and starting the first tilt series at –9° in a continuous data y Cryo-CLEM demarcated grids were transferred into cryo-DualBeam microscope equipped with cryostage and cryotransfer shuttle systems (Thermo Fisher Scientific, Aquilos cryo-FIB focused ion beam/scanning electron microscope). The lamella was prepared according to Aquilos cryo-FIB protocols. The sample on the O-ring side of the grid was sputter-coated with platinum (1 kV, 30 mA, 10 pa, 15 s) to increase sample conductivity during FIB milling. MAPS Cryo-ET and image processing y g Milling lamella by FIB y EM grids seeded with EGFP-GBP1-expressing HeLa CCL2 cells were prescreened using fluorescent light microscopy, clipped on a custom manual plunger, blotted using Whatman #1 filter paper (GE, 1001-110), and frozen in liquid ethane by the plunger. Frozen grids were transferred onto a cryostage and clipped within the O-ring and C-ring (ThermoFisher Scientific, cryo-FIB autogrid and C-clip, respectively). Cryo-CLEM (Leica Microsystems EM CryoCLEM microscope) was performed as previously described (7). Grids were transferred into Leica-CLEM cartridge docked at a precooled shuttle docking station and then transferred onto a cryo-stage equipped with a pre-cooled 40x objective lens. A spiracle 4×4 grid region was selected, and 16 subregions were imaged. Montage EGFP-positive images were acquired on the selected area using the Z-stack mode within a stepwise of 0.35 mm. This montage served as the navigating map in subsequent milling assays by the focused ion beam method. g Zhu et al., Science 383, eabm9903 (2024) Vitrification and cryo–correlative fluorescence light microscopy (CLEM). software was used to capture an EM grid montage in the electron beam mode before importing the fluorescent montage from cryoCLEM to generate a merged map to establish potential targets for milling lamella. Eucentric height of the targeting area was refined and stage tilting angle determined at 16° for lamella. At target positions on the grid organometallic platinum coating was sprayed for 5 s by a gas injection system (ThermoFisher Scientific, GIS). Initially, rough milling was started from the topside with 300 pA current and continued in a small stepwise manner. Concurrently, SEM images were taken to observe intracellular elongated bacteria. Rough milling stopped on the topside when elongated bacteria were closely visible. Rough milling on the bottomside began with 300 pA current in a large stepwise manner. When the lamella thickness arrived to 1.5 mm distance, the milling current was changed to 100 pA until the lamella thickness was ~0.8 mm. Thereafter fine milling focused primarily on the bottomside at < 50 pA. An electron beam was used to monitor the milling process at 5 keV and 13 pA. A final fine milling was done on both sides of the lamella. Subsequently the grid was sputter-coated with platinum (15 mA, 10 Pa, 10 s) to increase conductivity of milled lamella. The grid was transferred from the FIB instrument using the transferring shuttle system and stored (SubAngstrom, Pin type grid box) in liquid nitrogen for further data collection or immediately re-confirmed by CLEM for correct positioning of GBP1-coated bacteria. p Pretreatment of EM grids. EM grids (Quantifoil R1/4 gold 200 mesh, Q250AR-14) were placed onto 18 mm2 cover-glass that had been washed and stored in 100% ethanol. They were then placed into glass bottom dishes (Cellvis, 35 mm dish with 20 mm microwell cover glass) and treated with 70% ethanol under UV illumination for 10 min at 22°C. EM grids were washed 6 times with sterile and degassed water before treatment with 0.05 mg/mL collagen I (Gibco, A10644-01) for 60 min in a 37°C incubator followed by washing in degassed/ distilled water. Collagen-coated grids were incubated in DMEM medium overnight at 37°C incubator with 5% CO2 for further use. The GBPD1q22.2 septuple mutant was cultured in 10 cm dish to the density of 4 × 106 cells per dish. HeLa cells were transfected with EGFP-GBP1 plasmid using Mirus LT1 kit for overnight expression. Cells were subsequently washed by PBS and treated with 0.05% TrypsinEDTA for detachment. Detached HeLa cells were centrifugated and resuspended with DPBS buffer before filtering via 40 mm nylon mesh filter (Fisher Scientific, 22363547) to remove larger debris. Filtered HeLa cell suspensions were transferred into 5 mL polystyrene round-bottom tube (Corning, 352235) with cell-strainer cap for FACS sorting. GFPpositive cells were sorted into collection tubes, centrifugated and resuspend to a final cell density of 2 × 104 cells/mL in DMEM supplemented with 10% fetal bovine serum plus 100 mg/mL Pen Strep (Gibco, 15140-122). EGFP-GBP1expressing cells were seeded onto pretreated EM grids and further incubated overnight. For the infection assay, StmpBAD-ftsZ induced by by 0.2% L-arabinose were cultured to a density of OD600 1.0 and infected at MOI 200. EM grids coated with GBPD1q22.2 HeLa cells and bacterial cells were further centrifuged at 800g for 5 min for spinning bacteria onto the HeLa cell surface. EM grids were transferred into 37°C incubator for additional 20 min before washing three times with DPBS and incubated with complete DMEM plus 100 mg/mL gentamycin for an additional 1 hour infection. For preparation of minicells from StmDminD, bacterial cultures were grown overnight at 37°C in LB medium in the presence of 100 mg/ mL ampicillin. 10 mL bacterial overnight cultures were added into 1 L fresh LB medium in the presence of ampicillin and were grown to late log phase. Batch cultures then underwent 3-step centrifugation at: (i) 6240g (Beckman coulter, Avanti JXN-26, rotor, JLA-8.1000) for 10 min to remove parental rod-shaped bacilli; (ii) 24,820g (rotor, JLA-16.250) for 10 min to collect minicell fractions which were resuspended in HEPES buffer (pH 7.4) and filtered by 0.45 mm PVDF membrane (Merck Millipore, SLJVM33RS); (iii) 20,000g (rotor, JA-25.50) for further 10 min. Minicell fractions were adjusted to OD600 1.0 for rRFP-GBP1 in vitro coating. For preparation of minicells from StmDwaaG::pBAD-ftsZ, fresh cultures were grown in LB medium containing 100 mg/mL ampicillin and 0.2% L-arabinose for a continuous FtsZ induction at 37°C for 20 hours. StmDwaaG::pBAD-ftsZ minicells were collected as described above.
RES EARCH | R E S E A R C H A R T I C L E A his-tag containing six histidine residues (His6) with a GSG linker was fused to the N terminus of GBP1. Purified His6-GBP1 diluted to 2 mM in the coating buffer with 1 mM GTP was a mixture with bacterial minicell suspension as the reconstitution assay described. After the full coatomers formed, the cell suspension was centrifuged at 6200g and 4°for 5 min. The pellets containing bacterial minicell and GBP1 coat were dissolved in the blockingbinding buffer (20 mM Tris-HCl, 150 mM NaCl, 0.1% Tween 20, 5% BSA, 1mM MgCl2) for 10 min incubation at room temperature. 1.8 nm Ni-NTA-Nanogold beads (Nanoprobes) diluted 1:10 were added in the blockingbinding buffer and incubated for 10 min. The suspension underwent centrifugation at 6200g for 5 min and was washed three times in 50 mM Tris-HCl, 100 mM Imidazole, 1 mM MgCl2, 0.1% Tween 20, and 300 mM NaCl (pH 7.4). The minicell pellets were finally dissolved into the coating buffer and transferred onto glow-discharged carbon-coated copper grids for cryo-ET sample preparation. Disulfide cross-linking assay For testing the open conformer model of GBP1, we undertook a Cysteine replacement strategy for cross-linking. Six residues (Glu-389, Ile-369, Glu-366, Ile-365, Arg-362, and Glu361) present in the GBP1 a7 helix of the middle domain and face toward the a12 helix in GED domain were chosen as prospective Cys-Cys pairs. We measured the distance between the Cb atoms of the above-selected residues and 16 of 18 , 1 March 2024 Ni-NTA-nanogold labeling y We enlisted AlphaFold2 to predict functional homologs of the human GBP protein family. Notably, the GBP5 protein (AF-A0A2K5PG15) exhibited an elongated conformer resembling some of the structural features revealed in the subtomogram averaging of human GBP1. Recent findings suggested that GBP5 lacking its C terminus can form dimers in the presence of GDP.AIF3- (PDB ID 7E5A). Based on this dimeric form of truncated GBP5, we constructed a pseudomodel representing dimeric GBP1 in its activated state. First, we aligned the N-terminal domain and MD region from the human GBP1 monomer x-ray crystal structure (6K1Z) using the MatchMaker function in the Chimera package; it revealed a 147° rotation and a –14.7 Å shift along the axis of the GTPase domain when compared to one of the monomer subunits of the GBP5 dimer (PDB ID 7E5A). Then we aligned the C-terminal region of GBP1 with the predicted GBP5 monomer (AF-A0A2K5PG15) using Chimera. Lastly, pseudomodels of an open GBP1 conformer were built via AlphaFold2 and docked into our low-resolution subtomogram averaged GBP1 structures using Chimera. It After reconstituting the coat complex, we collected untagged GBP1 coated minicells through centrifugation at 14,000g for 5 min (Eppendorf Centrifuge 5420, SN, 5420JQ303731) at room temperature. The minicell pellets were washed in the coating buffer [50 mM HEPES (pH7.5), 150 mM NaCl, 1 mM MgCl2] by gently pipetting the solution 10 times. The GBP1-coated minicells were then collected again via centrifugation as above and subjected to the same washing treatment. This was repeated one more time for a total of 30 pipette-aided washes and removal of the freed GBP1. The coated minicells were then dissolved in the coating buffer and ready for cryo-ET sample preparation. This method proved highly efficient, reducing crowdedness from ~12,000 GBP1 molecules per minicell to an estimated ~100 to 120 molecules per minicell (>100-fold depletion) based on direct counts of segmented tomograph series. y g Zhu et al., Science 383, eabm9903 (2024) Computational modeling of human GBP1 Sequential wash method for reducing GBP1 crowdedness y TomoSegMemTV and PySeg packages were used for subtomogram analysis. For initial membrane segmentation, 11 tomograms from StmDminD dataset and 27 tomograms from StmDwaaG::pBAD-ftsZ with a binning factor of 8 were selected for membrane segmentation by using TomoSegMemTV (54). PySeg package was used for tracing and picking the particles located on the membrane based on Discrete Morse theory (55). The initial orientation of the particles perpendicular to the membrane was determined by PySeg. The coordinates of picked particles were multiplied by four to obtain the particles coordinates information in the CTF corrected and weight back projection reconstructed tomograms within a binning factor of two. Subtomograms were extracted and were initially aligned based on the feature of outer membrane (OM) by Relion package v3 (56). After the OM was well aligned, general classification function in the PySeg was performed to distinguish membrane and nonmembrane features. Classes showing membrane features were merged to have a further general classification by applying a cylinder mask on the top of the membrane. The classification results yielded elongated GBP1 monomer and dimer models corresponding to native structures obtained from our monomer and dimer masks. g Subtomogram averaging showing the extra density of GBP1 on top of the membrane resulted in 21,587 particles obtained for further constrained refinement and classification by the Relion package. During the next step of Relion classification, 4 classes resulting in 12,858 particles were averaged by the constrained refinement with molecular masks that was used to remove overlapping density of GBP1 (fig. S8). During the postprocessing, the final density map was generated with Relion using a B-factor of –1000 and a low-pass filter of 10 Å. Resolution estimation and Fourier shell correlation for both dimeric and monomeric masks along with their controls are shown in fig. S9. For distance detection of the full coat complex of mRFP-GBP1, OM and GBP1 density were manually segmented through IMOD drawing contours. Mtk function was used to detect the shortest distance between the density of the GBP1 GTPase domain and the density of the LPS outer leaflet. 11,889 GBP1 protomers on the DminD minicell having wild type LPS; 12,487 GBP1 protomers on the DwaaG minicell having O-antigen and outer-core truncated LPS; 6107 GBP1 protomers on the DwaaG outer membrane vesicle (OMV) were detected and analyzed by the Graphpad Prism9 package. For distance detection of the washed coat complex of mRFPGBP1 on both minicells and OMVs, GBP1 density in the 3D tomogram was drawn using IMOD manually. Neural network–based segmentation on both washed minicell and washed OMV was performed by EMAN2.23 and further refined by UCSF Chimera. p collection mode. The dataset for the minicell was taken a dose symmetric scheme without using phase plate. The tilt series for minicells sample were taken at the physical resolution of 0.14 nm/pixel starting from 0° and covered angle ranges of 51° to –51° with 3° increments, resulting in a total dose of 100 e/Å2. Collected dose-fractioned data were subjected to motion correction for generating drift-corrected image stack files. Stack files were aligned using patch-tracking function of IMOD. 3D tomograms were reconstructed from aligned stack files by SIRT (Simultaneous Iterative Reconstruction Technique) method using Tomo3D. For reconstruction of binned tomograms, the aligned tilt series was scaled to 3.6 nm as pixel size. IMOD was used for visualizing the tomogram. Surface rendering of tomogram was done with EMAN2.23 and refined with UCSF chimera. Briefly, for ribosomes, a template-matching strategy was performed to determine all ribosome coordinates and orientations. A mammalian 80S ribosome structure (EMD-3418) determined by Volta phase plate cryo-ET, and bacterial ribosome cryo-EM structure (EMD-0076) (52) were low-pass filtered to 20 Å and scaled to 3.6 nm/voxel to match to the tomograms. EMAN2.3 was used to do segmentation on membrane, vesicles and GBP1 coat features. The cryoEM map of type 3 secretion system (T3SS) needle complex from Salmonella typhimurium (EMD-11781) (53) was scaled to 3.6 nm/voxel and fitted into the position of T3SS in the tomograms.
RES EARCH | R E S E A R C H A R T I C L E In silico protein sequence analysis Zhu et al., Science 383, eabm9903 (2024) 1 March 2024 17 of 18 , 1. F. Randow, J. D. MacMicking, L. C. James, Cellular self-defense: How cell-autonomous immunity protects against pathogens. Science 340, 701–706 (2013). doi: 10.1126/science.1233028; pmid: 23661752 2. J. D. Jones, R. E. Vance, J. L. Dangl, Intracellular innate immune surveillance devices in plants and animals. Science 354, aaf6395 (2016). doi: 10.1126/science.aaf6395; pmid: 27934708 3. M. Shi, P. Zhang, S. M. Vora, H. Wu, Higher-order assemblies in innate immune and inflammatory signaling: A general principle in cell biology. Curr. Opin. Cell Biol. 63, 194–203 (2020). doi: 10.1016/j.ceb.2020.03.002; pmid: 32272435 y RE FE RENCES AND N OT ES y g Data were analyzed by GraphPad Prism 9.1.1. and Excel v16.54 software. Unless otherwise indicated, statistical significance was determined by t test (two-tailed) or one-way ANOVA (Dunnett’s multiple comparison tests) with Bonferroni post-hoc test. y Statistics 26. S. Huang, Q. Meng, A. Maminska, J. D. MacMicking, Cellautonomous immunity by IFN-induced GBPs in animals and plants. Curr. Opin. Immunol. 60, 71–80 (2019). doi: 10.1016/ j.coi.2019.04.017; pmid: 31176142 27. K. Tretina, E. S. Park, J. D. Maminska, J. D. MacMicking, Interferon-induced guanylate-binding proteins: Guardians of host defense in health and disease. J. Exp. Med. 216, 482–500 (2019). doi: 10.1084/jem.20182031 28. F. Huang et al., Ultra-High Resolution 3D Imaging of Whole Cells. Cell 166, 1028–1040 (2016). doi: 10.1016/ j.cell.2016.06.016; pmid: 27397506 29. D. Xu et al., PLSCR1 is a cell-autonomous defence factor against SARS-CoV-2 infection. Nature 619, 819–827 (2023). doi: 10.1038/s41586-023-06322-y; pmid: 37438530 30. W. D. Heo et al., PI(3,4,5)P3 and PI(4,5)P2 lipids target proteins with polybasic clusters to the plasma membrane. Science 314, 1458–1461 (2006). doi: 10.1126/science.1134389; pmid: 17095657 31. C. J. Bradfield, “Sulfated DAMPs mobilize human GBPs for cellautonomous immunity against bacterial pathogens,” thesis, Yale University, New Haven, CT (2016). 32. M. Wang, P. J. Casey, Protein prenylation: Unique fats make their mark on biology. Nat. Rev. Mol. Cell Biol. 17, 110–122 (2016). doi: 10.1038/nrm.2015.11; pmid: 26790532 33. H. Nikaido, “Outer membrane” in Escherichia coli and Salmonella: Cellular and Molecular Biology, vol. 1, F. C. Neidhardt, R. Curtiss, J. L. Ingraham, Eds. (American Society for Microbiology Press, ed. 2, 1996), pp. 29–47. 34. B. Hu, M. Lara-Tejero, Q. Kong, J. E. Galán, J. Liu, In Situ Molecular Architecture of the Salmonella Type III Secretion Machine. Cell 168, 1065–1074.e10 (2017). doi: 10.1016/ j.cell.2017.02.022; pmid: 28283062 35. H. Shi, B. P. Bratton, Z. Gitai, K. C. Huang, How to Build a Bacterial Cell: MreB as the Foreman of E. coli Construction. Cell 172, 1294–1305 (2018). doi: 10.1016/j.cell.2018.02.050; pmid: 29522748 36. I. Hautefort et al., During infection of epithelial cells Salmonella enterica serovar Typhimurium undergoes a time-dependent transcriptional adaptation that results in simultaneous expression of three type 3 secretion systems. Cell. Microbiol. 10, 958–984 (2008). doi: 10.1111/j.1462-5822.2007.01099.x; pmid: 18031307 37. S. Okuda, D. J. Sherman, T. J. Silhavy, N. Ruiz, D. Kahne, Lipopolysaccharide transport and assembly at the outer membrane: The PEZ model. Nat. Rev. Microbiol. 14, 337–345 (2016). doi: 10.1038/nrmicro.2016.25; pmid: 27026255 38. Q. Kong et al., Effect of deletion of genes involved in lipopolysaccharide core and O-antigen synthesis on virulence and immunogenicity of Salmonella enterica serovar typhimurium. Infect. Immun. 79, 4227–4239 (2011). doi: 10.1128/IAI.05398-11; pmid: 21768282 39. J. Shi et al., Inflammatory caspases are innate immune receptors for intracellular LPS. Nature 514, 187–192 (2014). doi: 10.1038/nature13683; pmid: 25119034 40. Q. Kong et al., Palmitoylation state impacts induction of innate and acquired immunity by the Salmonella enterica serovar typhimurium msbB mutant. Infect. Immun. 79, 5027–5038 (2011). doi: 10.1128/IAI.05524-11; pmid: 21930761 41. J. A. Feulner et al., Identification of acyloxyacyl hydrolase, a lipopolysaccharide-detoxifying enzyme, in the murine urinary tract. Infect. Immun. 72, 3171–3178 (2004). doi: 10.1128/ IAI.72.6.3171-3178.2004; pmid: 15155618 42. E. G. Otten et al., Ubiquitylation of lipopolysaccharide by RNF213 during bacterial infection. Nature 594, 111–116 (2021). doi: 10.1038/s41586-021-03566-4; pmid: 34012115 43. X. Liu et al., Inflammasome-activated gasdermin D causes pyroptosis by forming membrane pores. Nature 535, 153–158 (2016). doi: 10.1038/nature18629; pmid: 27383986 44. E. Kuru, S. Tekkam, E. Hall, Y. V. Brun, M. S. Van Nieuwenhze, Synthesis of fluorescent D-amino acids and their use for probing peptidoglycan synthesis and bacterial growth in situ. Nat. Protoc. 10, 33–52 (2015). doi: 10.1038/nprot.2014.197; pmid: 25474031 45. A. von Kügelgen et al., In Situ Structure of an Intact Lipopolysaccharide-Bound Bacterial Surface Layer. Cell 180, 348–358.e15 (2020). doi: 10.1016/j.cell.2019.12.006; pmid: 31883796 46. B. Barz, J. Loschwitz, B. Strodel, Large-scale, dynamin-like motions of the human guanylate binding protein 1 revealed by multi-resolution simulations. PLOS Comput. Biol. 15, e1007193 (2019). doi: 10.1371/journal.pcbi.1007193; pmid: 31589600 g For lipid-binding motifs in human GBP1 compared with other related GTPases, evolutionary tree history was inferred using the Maximum Likelihood method and JTT matrix-based model. A bootstrap consensus tree inferred from 10,000 replicates was taken to represent the evolutionary history of the taxa analyzed. Branches corresponding to partitions reproduced in < 50% bootstrap replicates were collapsed. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the JTT model, and then selecting the topology with superior log likelihood value. A discrete Gamma distribution was used to model evolutionary rate differences among sites (5 categories (+G, parameter = 2.8088)). Evolutionary analyses were conducted in MEGA X. 4. H. Wu, Higher-order assemblies in a new paradigm of signal transduction. Cell 153, 287–292 (2013). doi: 10.1016/ j.cell.2013.03.013; pmid: 23582320 5. L. Xiao, V. G. Magupalli, H. Wu, Cryo-EM structures of the active NLRP3 inflammasome disc. Nature 613, 595–600 (2023). doi: 10.1038/s41586-022-05570-8; pmid: 36442502 6. J. Wang et al., Reconstitution and structure of a plant NLR resistosome conferring immunity. Science 364, eaav5870 (2019). doi: 10.1126/science.aav5870; pmid: 30948527 7. S. Huang, S. Zhu, P. Kumar, J. D. MacMicking, A phaseseparated nuclear GBPL circuit controls immunity in plants. Nature 594, 424–429 (2021). doi: 10.1038/s41586-02103572-6; pmid: 34040255 8. J. H. Kim et al., Increasing the resilience of plant immunity to a warming climate. Nature 607, 339–344 (2022). doi: 10.1038/ s41586-022-04902-y; pmid: 35768511 9. B.-H. Kim et al., A family of IFN-g-inducible 65-kD GTPases protects against bacterial infection. Science 332, 717–721 (2011). doi: 10.1126/science.1201711; pmid: 21551061 10. A. R. Shenoy et al., GBP5 promotes NLRP3 inflammasome assembly and immunity in mammals. Science 336, 481–485 (2012). doi: 10.1126/science.1217141; pmid: 22461501 11. S. D. Tyrkalska et al., Neutrophils mediate Salmonella Typhimurium clearance through the GBP4 inflammasomedependent production of prostaglandins. Nat. Commun. 7, 12077 (2016). doi: 10.1038/ncomms12077; pmid: 27363812 12. M. P. Wandel et al., Guanylate-binding proteins convert cytosolic bacteria into caspase-4 signaling platforms. Nat. Immunol. 21, 880–891 (2020). doi: 10.1038/s41590-0200697-2; pmid: 32541830 13. R. G. Gaudet et al., A human apolipoprotein L with detergentlike activity kills intracellular pathogens. Science 373, eabf8113 (2021). doi: 10.1126/science.abf8113; pmid: 34437126 14. D. Fisch et al., Human GBP1 is a microbe-specific gatekeeper of macrophage apoptosis and pyroptosis. EMBO J. 38, e100926 (2019). doi: 10.15252/embj.2018100926; pmid: 31268602 15. M. Kutsch et al., Direct binding of polymeric GBP1 to LPS disrupts bacterial cell envelope functions. EMBO J. 39, e104926 (2020). doi: 10.15252/embj.2020104926; pmid: 32510692 16. J. C. Santos et al., Human GBP1 binds LPS to initiate assembly of a caspase-4 activating platform on cytosolic bacteria. Nat. Commun. 11, 3276 (2020). doi: 10.1038/s41467-02016889-z; pmid: 32581219 17. E. Kravets et al., Guanylate binding proteins directly attack Toxoplasma gondii via supramolecular complexes. eLife 5, e11479 (2016). doi: 10.7554/eLife.11479; pmid: 26814575 18. G. J. Praefcke, H. T. McMahon, The dynamin superfamily: Universal membrane tubulation and fission molecules? Nat. Rev. Mol. Cell Biol. 5, 133–147 (2004). doi: 10.1038/ nrm1313; pmid: 15040446 19. B. H. Kim, A. R. Shenoy, P. Kumar, C. J. Bradfield, J. D. MacMicking, IFN-inducible GTPases in host cell defense. Cell Host Microbe 12, 432–444 (2012). doi: 10.1016/ j.chom.2012.09.007; pmid: 23084913 20. B. Prakash, G. J. Praefcke, L. Renault, A. Wittinghofer, C. Herrmann, Structure of human guanylate-binding protein 1 representing a unique class of GTP-binding proteins. Nature 403, 567–571 (2000). doi: 10.1038/35000617; pmid: 10676968 21. A. Ghosh, G. J. Praefcke, L. Renault, A. Wittinghofer, C. Herrmann, How guanylate-binding proteins achieve assembly-stimulated processive cleavage of GTP to GMP. Nature 440, 101–104 (2006). doi: 10.1038/nature04510; pmid: 16511497 22. C. Ji et al., Structural mechanism for guanylate-binding proteins (GBPs) targeting by the Shigella E3 ligase IpaH9.8. PLOS Pathog. 15, e1007876 (2019). doi: 10.1371/ journal.ppat.1007876; pmid: 31216343 23. W. Cui et al., Structural basis for GTP-induced dimerization and antiviral function of guanylate-binding proteins. Proc. Natl. Acad. Sci. U.S.A. 118, e2022269118 (2021). doi: 10.1073/ pnas.2022269118; pmid: 33876762 24. S. Shydlovskyi et al., Nucleotide-dependent farnesyl switch orchestrates polymerization and membrane binding of human guanylate-binding protein 1. Proc. Natl. Acad. Sci. U.S.A. 114, E5559–E5568 (2017). doi: 10.1073/pnas.1620959114; pmid: 28645896 25. B. H. Kim et al., Interferon-induced guanylate-binding proteins in inflammasome activation and host defense. Nat. Immunol. 17, 481–489 (2016). doi: 10.1038/ni.3440; pmid: 27092805 p their neighboring residues (Lys-520, Ser-523, Glu-526, His-527, Gln-530, and Glu-533) located in the a12 in the GED domain and picked the closest neighbor residues for crosslinking candidates (between 2 to 7 Angstroms apart). After mutating these residues to Cysteines, we directly visualized their targeting to cytosolic Stm in cellulo (Fig. S13A,B). This confirmed no gross structural alterations that would interfere with targeting. We chose the middle R362C-E526C mutant with the shortest Cys-Cys interbond length (2 Å) to make recombinant RFP-GBP1 for direct cell-free coating assays. It was examined by in vitro reconstitution assays in the presence or absence of DTT, a reducing agent. Specifically, Cys-paired GBP1R362C-E526C tagged with mRFP were purified and mixed with bacteria (OD = 0.1) in coating buffer (HEPES buffer with 150 mM NaCl, 1 mM MgCl2, pH 7.4). Reconstitution assays under reducing conditions was performed by adding a final concentration of 1 mM DTT into the coating buffer.
RES EARCH | R E S E A R C H A R T I C L E 180, 519–530 (2012). doi: 10.1016/j.jsb.2012.09.006; pmid: 23000701 57. S. Zhu, J. MacMicking, Native structure of a human GBP defense complex for cell-autonomous immunity to infection, v1, Zenodo (2021); doi: 10.1101/2021.08.26.457804 ACKN OWLED GMEN TS SUPPLEMENTARY MATERIALS science.org/doi/10.1126/science.adm9903 Figs. S1 to S13 Tables S1 to S4 MDAR Reproducibility Checklist Movies S1 to S6 Submitted 27 October 2021; resubmitted 12 September 2023 Accepted 17 January 2024 10.1126/science.abm9903 g We thank R. Gaudet, E. Groisman, X. Liu, A. Martinez-Sanchez, J. Nikolaus, G. Torrence, A. Tunaru, Z. Yu, and X. Zhao for experimental advice and technical help; S. Wu, M. Llaguno, J. Lin, Z. Yu, X. Zhao, and R. Yan for the help with cryo-ET data collection; and J. Galan, R. Curtis III, S. Y. Wanda, B. Kazmierczak, F. Isaacs, and H. Agaisse for bacterial strains. Funding: We acknowledge financial support from the NIH National Institutes of Allergy and Infectious Diseases (R01AI068041-13, R01AI108834-05) to J.D.M; and the National Institute of General Medical Sciences (R01 GM118486), National Institute of Diabetes and Digestive and Kidney Diseases (P30 DK045735), and Wellcome Trust (grant no. 203285/B/16/Z) to J.B. Author contributions: S.Z. performed all cryo-EM and cryo-ET sample preparation, data collection, and processing (3D reconstruction, segmentation, and subtomogram averaging); C.J.B. discovered the GBP coat complex on cytosolic Salmonella and GBP codependencies and undertook GBP1 mutational analysis; A.M. performed all live 3D-SIM and 4Pi-SMS imaging plus in situ LPS release and peptidoglycan and flagellin detection assays; E.S.P. and B.H.K. developed the entire GBP-COAT450–708 platform, bacterial mutant and reporter strains, CRISPR-Cas9 human cell lines and genetic complementation, cytokine and cell death assays, in vitro LPS release assays, and bacterial killing; P.K. and S.H. performed recombinant protein preparation and analysis; M.K. undertook 3D-SIM imaging on GBP Cys-Cys mutants; and Y.Z. undertook 4PiSMS imaging with J.B. as a collaborator. J.D.M. conceptualized the project and wrote the paper. All authors discussed the results and commented on the manuscript. Competing interests: J.B. declares financial interests in Bruker Corporation and Hamamatsu Photonics. Y.Z. and J.B. have filed a patent application on 4Pi-SMS (patent application no. 11209367). J.D.M is an Investigator of the Howard Hughes Medical Institute. Data and materials availability: Subtomogram averages of the native GBP1 dimer and monomeric subunit of the dimer have been deposited in the Worldwide Protein Data Bank (wwPDB) Deposition and Annotation system (EMD-43091 and EMD-43153). Raw EM images from tilt series and segmentation have been deposited in EMPIAR (EMPIAR-11822). AlphaFold2 rendering of extended GBP1 conformers have been deposited in Zenodo (accession code 10429400) (57). All other data are available in the main text or the supplementary materials. License information: Copyright © 2024 the authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original US government works. https://www.science.org/about/ science-licenses-journal-article-reuse. This article is subject to HHMI’s Open Access to Publications policy. HHMI lab heads have previously granted a nonexclusive CC BY 4.0 license to the public and a sublicensable license to HHMI in their research articles. Pursuant to those licenses, the Author Accepted Manuscript (AAM) of this article can be made freely available under a CC BY 4.0 license immediately upon publication. p 47. J. Jumper et al., Highly accurate protein structure prediction with AlphaFold. Nature 596, 583–589 (2021). doi: 10.1038/ s41586-021-03819-2; pmid: 34265844 48. S. W. Brubaker, K. S. Bonham, I. Zanoni, J. C. Kagan, Innate immune pattern recognition: A cell biological perspective. Annu. Rev. Immunol. 33, 257–290 (2015). doi: 10.1146/ annurev-immunol-032414-112240; pmid: 25581309 49. M. Du, Z. J. Chen, DNA-induced liquid phase condensation of cGAS activates innate immune signaling. Science 361, 704–709 (2018). doi: 10.1126/science.aat1022; pmid: 29976794 50. J. Mahamid et al., Visualizing the molecular sociology at the HeLa cell nuclear periphery. Science 351, 969–972 (2016). doi: 10.1126/science.aad8857; pmid: 26917770 51. R. Staritzbichler, N. Ristic, A. Goede, R. Preissner, P. W. Hildebrand, Voronoia 4-ever. Nucleic Acids Res. 49 (W1), W685–W690 (2021). doi: 10.1093/nar/gkab466; pmid: 34107038 52. M. Graf et al., Visualization of translation termination intermediates trapped by the Apidaecin 137 peptide during RF3-mediated recycling of RF1. Nat. Commun. 9, 3053 (2018). doi: 10.1038/s41467-018-05465-1; pmid: 30076302 53. S. Miletic et al., Substrate-engaged type III secretion system structures reveal gating mechanism for unfolded protein translocation. Nat. Commun. 12, 1546 (2021). doi: 10.1038/ s41467-021-21143-1; pmid: 33750771 54. A. Martinez-Sanchez, I. Garcia, S. Asano, V. Lucic, J. J. Fernandez, Robust membrane detection based on tensor voting for electron tomography. J. Struct. Biol. 186, 49–61 (2014). doi: 10.1016/j.jsb.2014.02.015; pmid: 24625523 55. A. Martinez-Sanchez et al., Template-free detection and classification of membrane-bound complexes in cryo-electron tomograms. Nat. Methods 17, 209–216 (2020). doi: 10.1038/ s41592-019-0675-5; pmid: 31907446 56. S. H. W. Scheres, RELION: Implementation of a Bayesian approach to cryo-EM structure determination. J. Struct. Biol. y y g y , Zhu et al., Science 383, eabm9903 (2024) 1 March 2024 18 of 18
RES EARCH RESEARCH ARTICLE SUMMARY ◥ PLANT SCIENCE Defective pollen tube tip growth induces neo-polyploid infertility Jens Westermann, Thanvi Srikant, Adrián Gonzalo, Hui San Tan, Kirsten Bomblies* 1 of 1 , 1 March 2024 y Westermann et al., Science 383, 964 (2024) y g ▪ y CONCLUSION: Our work shows that pollen tube tip growth is defective in newly formed A. arenosa and A. thaliana polyploids, providing a previously unexplored component of neo-polyploid sterility and a potential explanation for Stebbins’s nonmeiotic sterility factor. Our transcriptome work provides insights into what problems arise in neo-polyploid pollen tubes and shows that established tetraploids did not simply return pollen tube gene expression to the ancestral state during their evolution to overcome the neo-polyploid challenge. Notably, we identify two candidate genes and show genetically that derived tetraploid alleles associate with improved of pollen tubes. One grain has a pollen tube that burst immediately after pollen tube tip growth. We also germination. Several grains have just started germinating. Tubes are RATIONALE: We used a “reverse geshow that it is the gametophyte, stained with aniline blue, which marks callose, and the bright bands show nomics of adaptation” approach not the sporophyte, genotype that callose plugs. to identify what additional chalconditions these effects. The two lenges to fertility might be imporgenes we identify are promising perimentally induced neo-polyploids grow tant in newly formed polyploids. We did this candidates, motivating further studies to conslowly, with extensive abnormalities, includby focusing on a list of genes under selecfirm their mechanistic roles, find additional ing stalling, branching, bulging, premature tion that we had previously identified from players, and, importantly, test whether they bursting, disrupted calcium gradients, dea genome scan in a natural autotetraploid can be transferred to other species to imfective actin filament formation, and ectopic lineage of Arabidopsis arenosa. Among these prove neo-polyploid fertility. cell wall softening. In established tetraploids, genes, we found two with strong signals of which exist in A. arenosa but not A. thaliana, positive selection that are known, from muInstitute of Molecular Plant Biology, Department of Biology, ETH Zürich, Zürich, Switzerland. the physiology and morphology of pollen tant studies in Arabidopsis thaliana, to play *Corresponding author. Email: kirsten.bomblies@biol.ethz.ch tubes have returned to normal. The defects a bona fide role in pollen tube tip growth. Cite this article as J. Westermann et al., Science 383, seen in pollen tubes of neo-tetraploids are Given that pollen tube tip growth is esseneadh0755 (2024). DOI: 10.1126/science.adh0755 coupled with perturbations in gametophyttial for fertility across sexually reproducing READ THE FULL ARTICLE AT ic gene expression, including expression of seed plants, we aimed to test whether it might https://doi.org/10.1126/science.adh0755 several genes that could be involved in genindeed present a challenge for neo-polyploids g INTRODUCTION: Polyploidy arises from wholeand whether the novel alleles of the two cangenome duplication. It is implicated in evoludidate genes that led us to this hypothesis tion and adaptation and thus is of fundamental might play a role in solving it. interest in evolutionary biology. AdaptaRESULTS: We show that pollen tube tip growth is tion of polyploid lineages to their genomeseverely challenged in neo-polyploid A. arenosa duplicated state provides an interesting case and A. thaliana. The pollen tubes from exstudy for evolutionary cell biology: In newly formed polyploids, a diploidoptimized genome is suddenly in a novel cellular context to which it is not adapted, and this could necessitate evolutionary retuning of cellular functions. There is also increasing interest in using polyploidy as a crop improvement tool, because polyploids are often resistant to climate-relevant stresses— most prominently, drought. However, for understanding their evolution or using them in agriculture, the fact that most new polyploids have very low fertility remains a key stumbling block. Meiotic chromosome segregation is a well-known challenge for new polyploids, but we have recently shown that improving neo-polyploid meiotic stability does not rescue fertility on its own. This suggests, as G. L. Stebbins already proposed 75 years ago, that Abnormal pollen tubes from a neo-tetraploid A. arenosa plant. there is something else that afMicroscope image showing pollen grains and two defective pollen tubes fects polyploid fertility—what that from a neo-tetraploid A. arenosa plant growing in vitro. These defects show might be has, to date, remained that neo-tetraploids suffer a defect that disrupts the normal polar growth mysterious. p erating the observed phenotypes; many, but not all, of these return to the ancestral expression state in the evolved tetraploids. We tested genetically whether genotypes of the two strongly ploidy-differentiated genes we identified, which encode a kinase AGC1.5 and a calcium-exporting adenosine triphosphatase ACA8, correlate with pollen tube performance in tetraploids. We find that diploid pollen tubes homozygous for tetraploid alleles at both loci strongly outcompete pollen tubes carrying diploid alleles in vivo when used to fertilize tetraploid females. In segregating lines, homozygotes for tetraploid alleles at AGC1.5 and ACA8 loci produce pollen tubes with markedly improved growth compared with plants homozygous for diploid alleles, both in terms of growth rate and prevention of premature bursting. The two loci thus additively associate with improved growth of pollen tubes after whole-genome duplication and may represent good candidates for improving fertility of neopolyploids in other species.
RES EARCH RESEARCH ARTICLE ◥ PLANT SCIENCE Defective pollen tube tip growth induces neo-polyploid infertility Jens Westermann, Thanvi Srikant, Adrián Gonzalo, Hui San Tan, Kirsten Bomblies* Genome duplication (generating polyploids) is an engine of novelty in eukaryotic evolution and a promising crop improvement tool. Yet newly formed polyploids often have low fertility. Here we report that a severe fertility-compromising defect in pollen tube tip growth arises in new polyploids of Arabidopsis arenosa. Pollen tubes of newly polyploid A. arenosa grow slowly, have aberrant anatomy and disrupted physiology, often burst prematurely, and have altered gene expression. These phenotypes recover in evolved polyploids. We also show that gametophytic (pollen tube) genotypes of two tip-growth genes under selection in natural tetraploid A. arenosa are strongly associated with pollen tube performance in the tetraploid. Our work establishes pollen tube tip growth as an important fertility challenge for neo-polyploid plants and provides insights into a naturally evolved multigenic solution. 1 of 10 , We measured average in vitro PTGR for pollen from A. arenosa diploids (“2X,” SNO) and established autotetraploids from two genetically distinct populations (“est-4X,” TBG and SBG). We also created neo-tetraploids in the lab: “neo-4XC0” were generated by colchicineinduced whole-genome duplication of SNO, and “neo-4XC1,” which were used for most of our experiments, are next-generation neo-polyploids created by inter crossing neo-4XC0 plants. The latter are important because they have not been directly exposed to colchicine. The pollen tubes of neo-4XC0 and neo-4XC1 did not differ significantly for any of the traits measured, nor did those produced by 2X branches of chimeric colchicine-treated plants differ from untreated 2X, verifying that the defects observed here are not attributable to a toxic effect of colchicine. PTGR was similar for haploid pollen tubes from 2X plants and diploid pollen tubes from est-4X plants but significantly lower in diploid pollen tubes from neo-4XC0 plants (Fig. 1A; P < 0.001 for both, Kruskal-Wallis with Dunn’s multiple comparisons test). The same was true in a second experiment using neo-4XC1 (see the “Genetic analysis of ACA8 and AGC1.5 alleles” y 1 March 2024 Results and discussion Neo-tetraploids have slow pollen tube growth y g Westermann et al., Science 383, eadh0755 (2024) y *Corresponding author. Email: kirsten.bomblies@biol.ethz.ch g Institute of Molecular Plant Biology, Department of Biology, ETH Zürich, Zürich, Switzerland. Arabidopsis thaliana neo-tetraploids by reducing crossover numbers does not rescue fertility on its own (11). This result raised the question of what other factor (or factors) might contribute to the low fertility of neo-polyploids. We set out to identify what else might affect neo-polyploid fertility using a “reverse genetics of adaptation” approach (12) by reexamining lists of genes that we had previously identified as targets of directional selection in a natural autotetraploid lineage of A. arenosa (9, 13) that arose once, about 30,000 generations ago (14). Two genes among those most differentiated between diploids and established tetraploids encode proteins involved in pollen tube tip growth (a type of polar cell growth found across eukaryotes, which is essential for fertility in seed plants). One encodes AGC kinase 1.5 (AGC1.5), which in A. thaliana is expressed only in growing pollen tubes and controls Ca2+ homeostasis, actin dynamics, and vesicle transport (15, 16). The second encodes AUTOINHIBITED CA2+-ATPASE8 (ACA8). ACAs are Ca2+ exporters (17), and ACA8, although expressed broadly, is among several ACAs important in pollen tube growth (18, 19). These two genes were the only known pollen-related genes with strong evidence of selection in tetraploid A. arenosa. Therefore, we hypothesized that pollen tube tip growth might be a fertilitycompromising challenge for neo-polyploids and that these genes might contribute to solving it. To our knowledge, a failure in pollen tube tip growth has not been specifically connected to low fertility in neo-polyploids. There is, however, prior data that pollen tube growth rate (PTGR) is slow in neo-polyploids relative to diploid progenitors and that it recovers in established polyploids (20). One possible cause is that because genome duplication leads to increased cell and pollen grain size (2, 3, 21), cell wall deposition rates may not suffice for p G enome duplication, giving rise to polyploids, can arise spontaneously in nature through the fusion of unreduced gametes or can be induced, for example, by application of chemical treatments in the lab (1, 2). Polyploidy has important implications in evolution but also has potential as a powerful crop improvement tool because polyploids often have enhanced resilience to climate-relevant abiotic stresses (1–3). In one example, diploid and neo-tetraploid ryegrass tested under current and future climate conditions for southern Britain showed that while diploids currently perform better in terms of biomass production, in simulated future conditions with more frequent drought, tetraploids produced more biomass (4). However, newly formed polyploids (“neo-polyploids”) often have very low fertility; understanding why, and what solutions can evolve, is important both for understanding an evolutionarily important phenomenon and for better exploiting polyploidy in agriculture. Meiotic chromosome missegregation is a wellrecognized problem for neo-polyploids that can compromise fertility because the multiple available homologs can associate into multivalents that impair chromosome segregation (5, 6). We showed previously that at least eight meiosis genes are targets of directional selection in a natural autotetraploid lineage of Arabidopsis arenosa and, for at least three of them, that naturally evolved tetraploid alleles help stabilize polyploid meiosis (7–9). But fitting with G. L. Stebbins’s speculation from 75 years ago that there is also an “unexplained nonmeiotic factor” affecting neo-polyploid fertility (10), we recently showed that reducing multivalent frequency in larger pollen tubes of polyploids (22). Comparisons between diploid and established polyploid species of the genera Betula and Handroanthus show that polyploids have wider pollen tubes but grow at the same rate as those of diploids, suggesting that evolution can compensate for size changes (22). One direct comparison of diploids with both neo- and established polyploids showed that siring success of pollen from neotetraploid Chamerion angustifolium is lower than that of established autotetraploids (23), but whether reduced fertility was caused by pollen tube defects is unknown. We hypothesize that slow PTGR in neopolyploids, which on its own would not necessarily cause low fertility, is a symptom of broader physiological problems that do compromise fertility. Higher PTGR of evolved polyploids relative to neo-polyploids may thus arise as a by-product of solving physiological problems, as opposed to higher PTGR per se being targeted by selection. Consistent with this idea, morphological abnormalities have been reported in pollen tubes of several neo-polyploids (24–26). Modeling studies show that coordination of cell size, turgor, and cell wall properties is essential for maintaining steady polar growth of pollen tubes (27), so cellular defects could in principle underlie both low PTGR and morphological defects. Here, we show that pollen tube tip growth is indeed defective in neo-polyploids and then test whether the alleles of ACA8 and AGC1.5 that were under selection in established tetraploid A. arenosa might compensate for the defects seen in neo-polyploids.
RES EARCH | R E S E A R C H A R T I C L E 1 March 2024 Transcriptomic differences in growing pollen tubes To further understand the nature of the pollen tube defects in neo-tetraploids and the “rescue” in evolved tetraploids, we sequenced transcriptomes of growing pollen tubes from 2X (n = 2), neo-4XC1 (n = 3), and est-4X (TBG, n = 2). 2 of 10 , Across plant species, an intracellular tip-focused Ca2+ concentration gradient (highest [Ca2+] at tip) is critical for processes such as vesicle trafficking, pectin cross-linking, and signal transduction during pollen tube growth (28–30). We visualized intracellular [Ca2+] with Fluo4AM in actively growing pollen tubes in vitro and quantified the [Ca2+] gradient (“m”) (see materials and methods), where m < 0 indicates the expected “tip-focused” gradient. Pollen tubes from neo-4XC1 plants frequently lacked a tip-focused [Ca2+] gradient (mean m = 0.19; 22% of tubes m < 0; Fig. 2A). In contrast, tipfocused gradients were much more frequent in pollen tubes from 2X (mean m = −1.20; 82% with m < 0) and est-4X (mean m = −1.72; 76% y Pollen tubes of neo-tetraploids have physiological defects y g Westermann et al., Science 383, eadh0755 (2024) To test whether the pollen tube defects of neopolyploids we observed in vitro correlate with fertility problems in vivo, we pollinated pistils from est-4X and neo-4XC0 flowers with pollen from both types in all four combinations and then stained carpels with aniline blue after 24 hours to visualize pollen tubes. At time of harvest, the bulk of pollen tubes from neo-4XC0 covered a smaller range of the female transmitting tract than those of est-4X (Fig. 1H and fig. S6A). Although we cannot discern whether these tubes are bursting, or stalling for some other reason, the result does suggest that a high rate of pollen tube attrition also occurs in vivo for pollen from neo-4XC0. Unfertilized ovules were common in est-4X siliques pollinated by neo4XC0 plants (fig. S6B), and seed set per silique was low (fig. S6, C and D). Some pollen tubes from neo-4XC0 also showed evidence of not targeting ovules normally (fig. S6B). Seed set was not biased to apical ovules (fig. S6C), suggesting that some pollen tubes from neo-4XC0 do grow long enough to fertilize ovules at the base of the carpel, consistent with the few long tubes we saw in vitro (Fig. 1G and fig. S4). y We observed prominent defects in morphology of diploid pollen tubes from neo-4XC0 plants. When growing in vitro, pollen tubes from neo4XC0 burst prematurely at a high frequency compared to those of 2X or est-4X (P < 0.0001 in both cases, Kruskal-Wallis with Dunn’s multiple comparisons test, see table S4; Fig. 1, D to F; see movie S1 for an example); the same was true for neo-4XC1. PTGR and bursting rate per genotype or cytotype correlated negatively, suggesting that both may be symptoms of the same underlying defects (fig. S3). In addition, as opposed to the steady directional growth observed in pollen tubes from 2X and est-4X, pollen tubes from neo-4XC0 often showed bulging, branching, meandering (Fig. 1F), and reduced length (fig. S4). Nevertheless, a few pollen tubes from neo-4XC0 grew quite long, suggesting that defects arise stochastically (fig. S4). Constant ratios of pollen tube width between the tip (wt, widest point 0 to 10 mm from tip) and shank (ws, widest point 10 to 30 mm from tip) are fundamental to normal polar Neo-polyploids have low pollen fertility with m < 0) relative to neo-4XC1 (P values < 0.027 and 0.040, respectively, c2 test with Holm-Bonferroni correction; Fig. 2A, fig. S7, and movie S2). 2X and est-4X did not differ significantly for proportion of tubes with tipfocused gradients (P > 0.99 for both, c2 test with Holm-Bonferroni correction). In a second independent experiment, we saw similar trends, but puzzlingly, a hybrid between est-4X and neo-4XC0 (“hybrid-F1”) showed an even lower percentage of tubes with a tip-focused gradient (88%) than neo-4XC1 yet had intermediate PTGR and bursting rates between those of neo-4XC1 and est-4X (see the “Genetic analysis of ACA8 and AGC1.5 alleles” section). The often bright but even pattern seen in tubes from neo-4XC1 plants hints that there might be a problem with calcium export from the shank, rather than import at the tip. In A. thaliana pollen tubes, two features vital for tip growth are subapical actin filaments (“SA”) that transit tip-directed vesicle, and an apical actin ring (“AR”) that maintains directionality of turgor-driven growth (31). Neo-4XC1 had a reduced frequency of tubes with clearly visible SA (30%) compared with 2X and est-4X (78 and 73%, respectively; P < 0.0001 for both, c2 test adjusted with HolmBonferroni correction, table S4; Fig. 2B and figs. S7 and S10B), whereas 2X and est-4X did not significantly differ (P = 0.99, c2 test with Holm-Bonferroni correction, table S4). The frequency of AR in pollen tubes from neo-4XC1 was not significantly different from 2X (P = 0.22, c2 test with Holm-Bonferroni correction) but was significantly lower than est-4X (P = 0.0012, c2 test with Holm-Bonferroni correction; Fig. 2B and figs. S7 and S10B). The maximum length of visible actin fibers was also lower in pollen tubes from neo-4XC1 (fig. S10C). Cell wall softening is important in tip growth and is associated with the presence of acidic pectin esters (32). For 2X and est-4X, most in vitro–grown pollen tubes had the expected single tip–localized acidic pectin signal (86 and 90.4%, respectively), but pollen tubes from neo-4XC1 plants commonly had multiple sites (Fig. 2C), and significantly fewer had just a single signal at the tip (27.0%; P < 0.0001 for both, c2 test with Holm-Bonferroni correction). The multiple signals in pollen tubes from neo-4XC1 are associated with the bulging, branching, and bending points (Fig. 2C), but whether aberrant pectin acidification is a cause or consequence of these morphological problems is not clear. g Pollen tubes from neo-tetraploids have severe morphological defects growth and, when compromised, can lead to growth defects (27). The wt/ws ratios for growing pollen tubes from 2X and est-4X fall in a tight distribution around 1, as expected (s = 0.1; Fig. 1G). For pollen tubes from neo-4XC0, the mean also centered on 1, but the spread of ratios was significantly higher (s = 0.4; Fig. 1G; all P values < 0.001, F-test with Holm-Bonferroni correction, table S4). The extent to which wt/ws ratios deviated from 1 correlated negatively with PTGR (Pearson correlation coefficient r = −0.54). We also tested whether pollen tubes of neo4XC0 A. thaliana (neo-4XAt) show similar defects to those from neo-4X A. arenosa. Indeed, in vitro–grown pollen tubes from neo-4XAt individuals of the Col-0 accession also showed elevated bursting, bulging, branching, and growth cessation relative to 2X (fig. S5). p section). Many pollen tubes from neo-4XC0 and neo-4XC1 showed little or no growth, so to determine whether their calculated slow average PTGR reflects global problems or instead arises simply because a higher proportion of “zero or nearzero growth” tubes are included in calculating the mean, we analyzed just the 20% fastestgrowing tubes from the second experiment (which had sufficient sample sizes). Although the differences are less extreme, the fastest pollen tubes from neo-4XC1 plants still grew significantly slower than those of either 2X or est-4X plants (P < 0.0001 for both; KruskalWallis with Dunn’s multiple comparisons test; fig. S1). Viability of ungerminated pollen estimated by fluorescein diacetate/propidium iodide (FDA/PI) and Alexander staining was high for all genotypes, albeit lower for neo-4XC0 (fig. S2, A to C). There was no significant difference in pollen germination rate in vitro (fig. S2D). These results suggest that neo-4XC0 defects are mostly related to tube growth rather than resulting from a catastrophic loss of pollen grain viability. Pollen grains of neo-4XC0 plants were significantly larger than those of either 2X or est-4X (Fig. 1B), and pollen tubes from neo-4XC0 were also wider on average than those from 2X or one est-4X genotype (TBG; Fig. 1C). A second est-4X genotype (SBG), however, produced pollen tubes of equal width to those of neo-4XC0 (Fig. 1C) yet had PTGR comparable to that of the other est-4X (TBG versus SBG; Fig. 1A). Thus, even if increased tube width might initially be a problem for neo-tetraploids, reversing the size increase is apparently not essential for recovering from it, consistent with results from Betula and Handroanthus (22).
RES EARCH | R E S E A R C H A R T I C L E b 2 a 400 300 16 80 14 12 10 8 6 40 a a c 10 0 Est-4X (TBG) Est-4X (SBG) 2X Neo-4X C0 T S T S T S T S Est-4X (TBG) Est-4X (SBG) Neo-4X C0 0 2X Est-4X (SBG) Est-4X (TBG) 0 Neo-4X C0 0 2X 100 50 20 2 1 b 60 30 4 200 70 Est-4X (TBG) Est-4X (SBG) 4 c a 500 90 2X c 600 100 18 Bursting rate (%) Pollen grain size ( m 2 ) 5 3 b 700 c D 20 Tube width ( m) a 6 PTGR ( m/min) C 800 7 Neo-4X C0 B A E p g Neo-4XC0 2X F Est-4X Normal (2X) Neo-4X C0 morphology Est - 4X (SBG) 1 10 8 6 2 0 0 1 2 3 0 1 2 3 0 1 2 Tip to shank width ratio (w t /w s ) Fig. 1. Pollen defects in neo-tetraploids. (A) Pollen tube growth rate (micrometers per minute). n ≥ 95 tubes per genotype, five plants per cytotype. Different letters indicate significant differences (P < 0.05, Kruskal-Wallis, Dunn’s multiple comparison test). (B) Pollen grain size. n ≥ 95 tubes per genotype, five plants per cytotype. Different letters indicate significant differences (P < 0.05, Kruskal-Wallis, Dunn’s multiple comparison test). (C) Box plots of maximal tube width 0 to 10 mm from tip (T) and shank (S; 10 to 30 mm from tip; n ≥ 95 tubes per genotype). Whiskers indicate minimum and maximum (Q1-1.5IQR), and black dots are outliers. (D) Rate of bursting in vitro (n ≥ 532 grains per genotype). Different letters indicate significant differences (P < 0.05, c2 test, Holm-Bonferroni Westermann et al., Science 383, eadh0755 (2024) 1 March 2024 3 0 1 2 3 a a 80 60 b b 40 20 0 , 4 100 y PTGR ( m/min) 12 H Est - 4X x Est-4X Neo- 4XC0 x Est-4X Est-4X x Neo - 4XC0 Neo-4XC0 x Neo - 4XC0 Est-4X (TBG) Neo-4X C0 0.1 y g 2X 14 Range of transmitting tract covered (%) y G correction). Black dots in (A), (B), and (D) indicate individual means. Error bars in (A) and (B) show standard deviation. (E) Examples of in vitro–grown pollen tubes. Scale bar, 200 mm. Arrowheads indicate “bursting” tubes. (F) In–vitro grown pollen tubes from the diploid (far left panel) and neo-4XC0 (right panels). Scale bar, 50 mm. (G) Ratio of greatest width at tube tip versus shank (see methods), plotted against growth rate (micrometers per minute). Black horizontal lines indicate mean PTGR. (H) Box plot showing range of transmitting tract covered for pollen tubes from range measured in fig. S6A [a versus b, significantly differing groups (Welch’s ANOVA, Dunnett’s T3 multiple comparisons test)]. 3 of 10
RES EARCH | R E S E A R C H A R T I C L E A 2X Neo-4XC1 Est-4X [Ca2+] Fluorescence 180 m = -1.79 m = 0.19 m = -1.20 130 80 30 -20 0 10 20 30 0 10 3 0 0 20 10 20 30 Distance from tip ( m) B C F-actin Esterified pectin 2X 2X 4 of 10 , Neo-4XC1 Est-4X 1 March 2024 y Westermann et al., Science 383, eadh0755 (2024) of ectopic pectin acidification and frequent bursting in these tubes (Fig. 2C). AGP2 encodes an arabinogalactan protein important for cell wall deposition during pollen tube growth [e.g., (35)]. Of the nine DEGs in the neo-4XC1 versus 2X contrast, three (RBR1, AGP2, and RALFL11) were also DEGs between neo-4XC1 and est-4X. In the diploid pollen tubes of est-4X, RBR1 and AGP2 expression returned to levels seen in haploid pollen tubes of diploids. In contrast, RALFL11, a member of a peptide family that maintains cell wall integrity during pollen tube growth [e.g., (36, 37)], is expressed at an even higher level in pollen tubes of est-4X than in those of neo-4XC1 (Fig. 3E). Other notable genes on the list of 27 pollen or Ca2+-related DEGs include MIRO2, which encodes a mitochondrial guanosine triphosphatase associated with calcium signaling (38); CDI, which encodes a protein that affects male fertility by regulating pollen tube growth (39); ACA7, which is closely related to ACA8; and BON3, whose interaction y g Among 15,361 genes with sufficient read counts across all samples, 790 genes were differentially expressed in 2X versus neo-4XC1, or in est-4X versus neo-4XC1, or both. The contrast est-4X versus neo-4XC1 had the most differentially expressed genes (DEGs; Fig. 3, A to D). Among the 790 DEGs, we only found 27 whose A. thaliana orthologs were previously directly or indirectly associated with pollen tube growth and/or Ca2+ homeostasis (Fig. 3E and table S1). Nine of these 27 genes were DEGs comparing 2X versus neo-4XC1 (Fig. 3, B and E). Among these are several interesting genes: PMEI5, which is more highly expressed in neo-4XC1 than in 2X, encodes a pectin methylesterase inhibitor that regulates cell wall esterification (33). A similar protein in maize, ZmPMEI1, is localized to the tip and sites of bending in pollen tubes, and its external application induces cell wall destabilization and pollen tube bursting (34). Thus, overexpression of PMEI5 in pollen tubes from neo-4XC1 fits with our observation y Fig. 2. Physiological abnormalities in pollen tubes from neo-polyploids. (A) (Top) Example images of growing pollen tubes stained with Fluo4-AM to mark Ca2+. Scale bar, 20 mm. (Bottom) Average (mean) Fluo4-AM fluorescence intensity along first 30 mm of tube calculated from 26 growing pollen tubes per cytotype. Standard deviation shown in gray. m, mean inclination of signal (see methods). (B) Filamentous actin cytoskeleton visualized with Phalloidin-AlexaFluor405. Scale bar, 10 mm. (C) Ruthenium red staining of esterified pectins indicating expected tip-focused signal (white arrowhead) and ectopic sites (yellow arrowheads). Scale bar, 50 mm. Additional representative images are shown in fig. S7. All assays had five biological replicates per cytotype, with three technical replicates each. The results presented thus far support the hypothesis that defects in tip growth of diploid pollen tubes from neo-4X plants are associated with, and likely caused by, physiological perturbations including loss of the tip-focused [Ca2+]-gradient, abnormal patterns of cell wall softening, and cytoskeletal defects. The two tip growth–related genes that experienced directional selection in the tetraploid lineage, AGC1.5 and ACA8, are both implicated in regulating these processes. Both genes are strongly differentiated (i.e., have sharply different allele frequencies) among all 2X and est-4X A. arenosa populations tested, whereas other pollen tube–relevant genes show weaker differentiation (e.g., the two in Fig. 3E) or no evidence of selection (9, 13); thus, we chose to focus on AGC1.5 and ACA8 for genetic characterization. The diploid- and tetraploid-specific alleles of AGC1.5 differ only by one amino acid, D148Y (Asp148→Tyr), which, in a sample of nearly 300 A. arenosa individuals (43), is present at 90% frequency in natural (established) tetraploids and only 0.9% in diploids (fig. S9A). Amino acid 148 lies at the junction between a well-conserved kinase domain and an intrinsically disordered N-terminal region; its function is unknown (fig. S9, B and C). ACA8 has two differentiated amino acids (I424V and T493A), in the transmembrane and intracellular domains, respectively (fig. S9, A and D). The derived variants are found in diploids at about 7% frequency and in established tetraploids at 69 and 72%, respectively (fig. S9A), suggesting that for this gene, the tetraploid allele was likely selected from standing variation already present in diploids. The promoters do not show evidence of differentiation in either locus, which fits with their lack of differential expression. To test whether these genes affect diploid pollen tube performance in tetraploid plants, we generated F2 populations segregating the ancestral diploid (D) and derived tetraploid (T) alleles of both AGC1.5 and ACA8. We crossed neo-4XC0 plants (homozygous DDDD genotype at both loci) with est-4X plants (TBG, homozygous TTTT genotype at both loci) to generate hybrid-F1 plants (DDTT at both loci). We intercrossed hybrid-F1 plants to generate g Est-4X Genetic analysis of ACA8 and AGC1.5 alleles p Neo-4X C1 with ACAs is important in pollen tube growth (18). Among the 790 DEGs, there is a significant functional enrichment for genes encoding proteins involved in glutathione metabolism (n = 9) and components of the exocyst complex (n = 6) (Fig. 3, F to H, and fig. S8). Glutathione redox state affects pollen tube vigor and size (40). The exocyst complex is important for exocytosis during pollen tube tip growth (41, 42). Neither ACA8 nor AGC1.5 is among the 790 DEGs across our experiment, fitting with the observation that their differentiated sites are all in coding regions (see below).
RES EARCH | R E S E A R C H A R T I C L E B #DEGs 600 400 200 C 20 −log10(adjusted p-value) Downregulated Upregulated −log10(adjusted p-value) A 15 10 5 Downregulated Non−DEG Upregulated D 0 neo-4XC1 vs 2X Est-4X vs 2X Est-4X vs neo-4XC1 0 − − −30 −20 −10 0 10 20 log2 Fold Change (est-4X - neo4XC1) E F Genotype Cytotype DEGs unique to neo4XC1 vs 2X contrast (N=115) GGCT2.2 GSTL3 I Transformed read counts 15 12.5 10 7.5 5 y G Genotype Cytotype 2X SNO(4X) Neo-4XC1 SNO(2X) TBG (4X) Est-4X g Transformed read counts Shared DEGs* DEGs shared between neo-4XC1 vs 2X & Est-4Xvs neo-4XC1 contrasts p DEGs unique to Est-4X vs neo4XC1 contrast (N=584) Est-4X vs neo-4XC1 AT1G64980 / CDI AT5G01700 AT2G31430 / PMEI5 AT3G12280 / RBR1 AT4G09740 / GH9B14 AT2G22470 / AGP2 AT5G06970 / PATROL1 AT4G02730 / WDR5b AT3G20790 AT1G16300 / GAPCP-2 AT1G28220 / PUP3 AT2G18960 / AHA1 AT3G01280 / VDAC1 AT2G38720 / MAP65-5 AT5G35930 AT1G51450 / TRO AT5G01810 / CIPK15 AT1G53210 / NCL AT1G08860 / BON3 AT5G01820 / CIPK14 AT2G03150 / RSA1 AT3G63150 / MIRO2 AT5G51050 / APC2 AT4G30160 / VLN4 AT1G08450 / CRT3 AT2G19030 / RALF11 AT2G22950 / ACA7 Genes associated with Genes associated with pollen, Ca2+ homeostasis/signalling pollen-tube growth, gametogenesis Shared DEGs* (N=91) neo4XC1 vs 2X log2 Fold Change 10 5 log2Fold Change = NA 0 −5 −10 Identified as DEG K Genotype Cytotype neo4XC1 vs 2X Est-4X vs neo-4XC1 neo4XC1 vs 2X Est-4X vs neo-4XC1 AT4G31290 / GGCT2.2 GGT1 AT5G02780 / GSTL1 AT1G57720 GSTU12 AT5G42150 y g AT5G45020 GSTL1 AT3G47680 AT5G02790 / GSTL3 AT5G45020 AT5G42150 L Genotype Cytotype AT1G76850 / SEC5A AT1G71820 / SEC6 AT5G50380 / EXO70F1 AT1G21170 / SEC5B AT1G07000 / EXO70B2 AT5G52350 / EXO70A3 SEC5B SEC6 EXO70F1 Fig. 3. Pollen tube transcriptome variation. (A) Number of differentially expressed genes (DEGs) across contrasts. (B and C) Volcano plots showing log2 fold change and adjusted P value of 15,361 genes. Black lines indicate DEG cutoffs. (D) Expression levels of DEGs in different contrasts. Colors represent read counts. (E) Expression levels of 27 genes from (D) with known associations with pollen, pollen tube development, and/or Ca2+ signaling (see table S1). Genes with evidence of directional selection in tetraploid A. arenosa (9, 13) and highly ploidy-differentiated (43) are written in purple. Corresponding log2 fold changes across neo-4XC1 versus 2X and est-4X versus 2X contrasts are shown in the Westermann et al., Science 383, eadh0755 (2024) AT1G69920 / GSTU12 , EXO70A3 AT3G47680 J EXO70B2 SEC5A AT4G39640 / GGT1 y H AT1G57720 Transformed read counts 12.5 10 AT3G47680 7.5 1 March 2024 adjacent heatmap (F), where asterisks indicate significant DEGs. (G and H) STRING network of protein–protein interactions of genes enriched in the union of DEGs from transition 1 and transition 2 for glutathione metabolism (G) and exocytosis (H). (I and J) Expression levels of genes responsible for enrichment of glutathione metabolism and exocytosis, respectively, with the A. thaliana orthologs of each gene indicated for every row. Adjacent heatmaps (K and L) indicate log2 fold changes, with significant DEGs indicated with an asterisk. Dark gray indicates DEGs with high log2 fold change due to one or both samples having zero reads. 5 of 10
RES EARCH | R E S E A R C H A R T I C L E B a 20 PTGR ( m/min) 15 10 2 Est- 4X (TBG) Hybrid-F1 Neo - 4X C1 T ACA8 T AGC1.5 Calcium gradient inclination e 40 b a 8 6 4 2 0 -2 y -4 -6 -8 D D T D D T T ACA8 T AGC1.5 D T D T ACA8 D D T T AGC1.5 y g Est- 4X (TBG) -10 Hybrid -F1 2X 0 Neo -4X C1 10 Est- 4X (TBG) Bursting rate (%) c 30 D D 10 70 f Hybrid -F1 0 c 20 ab D T 1 90 d T D 1.5 D 50 bc 0.5 100 80 c b b 2X AGC1.5 (TTTT) ACA8 (TTTT) c 2.5 2X Neo -4X C1 b 0 60 a c 3 5 C a 3.5 Expectation (Mendelian) Frequency (%) 25 a 4 g statistically significant (P > 0.99 for neo-4XC1 versus AGC1.5-D ACA8-D; P = 0.47 for est-4X versus AGC1.5-T ACA8-T; Kruskal-Wallis with Dunn’s multiple comparisons test). For bursting rate, one comparison is statistically significant (P = 0.06 for neo-4XC1 versus AGC1.5-D ACA8D; P = 0.04 for est-4X versus AGC1.5-T ACA8-T; c2 test with Holm-Bonferroni correction). 1 March 2024 Diploid pollen tubes produced by AGC1.5-D ACA8-D plants frequently lacked tip-focused [Ca2+] gradients when grown in vitro (mean m = 0.78; 14.0% with m < 0) and did not differ significantly from neo-4XC1 (P > 0.99, c2 test adjusted with Holm-Bonferroni correction; Fig. 4D). In contrast, the diploid pollen tubes produced by AGC1.5-T ACA8-T (mean m = −1.15; 6 of 10 , Fig. 4. Genotypes of ACA8 and AGC1.5 strongly associate with ploidy-relevant differences in pollen tube growth and physiology. (A) Frequency of F2 individuals homozygous for T alleles from a cross of TTDD F1 plants compared with expected Mendelian frequency for an autotetraploid. Different letters indicate significant differences (c2 test, P < 0.0001). (B) PTGR of control and F2 individuals homozygous for different combinations of diploid (D) and tetraploid (T) alleles of ACA8 and AGC1.5 (n ≥ 110 pollen tubes per genotype). Each dot represents mean from a single biological replicate. Error bars show standard deviation. Different letters indicate significant differences (P < 0.05, Kruskal-Wallis, Dunn’s multiple comparisons test). (C) Pollen tube bursting rate (n ≥ 825 pollen tubes per genotype). Genotypes and cytotypes as in (B). Error bars show standard deviation. Different letters indicate significant differences (P < 0.05, c2 test, HolmBonferroni correction). (D) Box plots showing directionality of intracellular [Ca2+] gradient (n ≥ 26 pollen tubes per genotype). Horizontal bars represent mean per genotype. Biological replicates per genotype: 2X = 6; neo-4XC1 = 4; hybrid-F1 = 6; est-4X = 6; ACA8 D AGC1.5 D = 4; ACA8 T AGC1.5 D = 5; ACA8 D AGC1.5 T = 6; and ACA8 T AGC1.5 T = 6. For each biological replicate, there were two technical replicates. y Westermann et al., Science 383, eadh0755 (2024) A p tetraploid F2 populations segregating D and T alleles of both genes. We saw a significant overrepresentation in the F2 of individuals homozygous for T alleles for both AGC1.5 and ACA8 (especially AGC1.5) relative to autotetraploid Mendelian expectations (Fig. 4A), suggesting that for each locus, among possible diploid pollen grain genotypes produced by tetraploid hybrid-F1 plants (DD, DT, TT), TT pollen tubes had a substantial fertilization advantage over DD or DT pollen tubes. The T-biased segregation shows that it is the pollen (gametophytic) genotype at these loci, rather than the parental (sporophytic) genotype, that is associated with pollen tube performance and fertilization success in the tetraploids. This is consistent with work that has shown that growing pollen tubes contain almost exclusively gametophytegenerated mRNAs (44). Pollen from F2 plants homozygous for T versus D alleles of AGC1.5 and ACA8 did not differ significantly in germination rate (fig. S10A), but when pollen tubes were grown in vitro, PTGR and bursting rate differed significantly among genotypes (Fig. 4, B and C). Notably, the pollen tubes from plants homozygous for D alleles at both AGC1.5 and ACA8 (diploid pollen tubes with genotype DD at both loci, like neo-4X plants) had similarly slow PTGR (3.09 mm/min) and high bursting rate (38%) when grown in vitro as those from neo-4XC1 plants (0.89 mm/min PTGR: P > 0.99 KruskalWallis with Dunn’s multiple comparisons test; 37.5% bursting: P = 0.064 c2 test with HolmBonferroni correction). In contrast, the diploid pollen tubes from tetraploids homozygous for T alleles at both loci (pollen tubes TT at both loci) grew nearly as fast as (2.54 mm/min) and burst nearly as rarely as (14.5%) those of est-4X (3.03 mm/min PTGR, 9.4% bursting; PTGR: P = 0.47 Kruskal-Wallis test with Dunn’s multiple comparisons test; bursting: P = 0.042, c2 test with Holm-Bonferroni correction; Fig. 4, B and C). Pollen tubes from homozygotes for T alleles at only one of the two genes show intermediate PTGR and bursting rate, suggesting that these loci have additive effects on both traits (Fig. 4, B and C). Homozygotes for T alleles at either AGC1.5 or ACA8 individually (homozygous D at the other locus in each case) have nearly equal PTGR (1.65 and 1.68 mm/min, respectively), in both cases significantly higher than that of D homozygotes (P = 0.033 and P < 0.0001 Kruskal-Wallis with Dunn’s multiple comparisons test, respectively). Bursting is less frequent in pollen tubes homozygous for T alleles of AGC1.5 than ACA8 (18.9% for AGC1.5-T ACA8-D versus 29.5% for AGC1.5-D ACA8-T, P < 0.0001, c2 test with Holm-Bonferroni correction; Fig. 4, B and C). Small discrepancies remain in phenotypes of pollen tubes from AGC1.5-T ACA8-T versus est-4X, or AGC1.5-D ACA8-D versus neo-4XC1. For PTGR, these differences are not
RES EARCH | R E S E A R C H A R T I C L E Generation of neo-tetraploids To induce polyploidy, we treated apical meristems of 2X (SNO) seedlings grown in soil 7 of 10 , A. arenosa seedlings of the accessions SNO (2X), TBG (est-4X), and SBG (est-4X) [see (42) for full information on each accession] were grown on 50% soil and 50% sand under longday conditions [16 hours light, cool white, with photosynthetic photon flux density (PPFD) ~ 60 mmol m−2 s−1, 21°C; and 8 hours darkness, 12°C, 60% humidity each] for 6 weeks. Plants with fully developed rosettes were vernalized under short-day conditions (8 hours light, 6°C, cool white, PPFD ~ 50 mmol m −2 s −1 ; and 16 hours darkness, 6°C, and 60% humidity) for 6 weeks, after which plants were returned to long-day conditions (as above) to induce flowering within 2 to 3 weeks. All pollen-related assays were performed on pollen from plants within the first 2 to 4 weeks of their flowering period from recently opened flowers to avoid any defects that may be linked to plant or floral senescence. A. thaliana plants of the Col-0 accession were grown in the same conditions as A. arenosa, but without vernalization. y 1 March 2024 Materials and methods Plant cultivation y g Westermann et al., Science 383, eadh0755 (2024) We show here that pollen tube tip growth is a fertility-compromising challenge for neo-tetraploid A. arenosa and A. thaliana. Neo-polyploid pollen tubes show extensive physiological abnormalities, growth aberrations, and gene expression perturbations. Pollen tube growth phenotypes reported in other species [e.g., (24–26)] suggest that these phenomena are broadly relevant. Moreover, tip growth–related genes have appeared as outliers in genome scans for selection in other polyploid plants [see (3) for a review], suggesting that similar adaptations, although not necessarily the same genes, may be targeted in independent polyploidy events. Our work also provides insights into what might be the genetic basis of an evolved solution to the tip-growth challenge: In tetraploids, pollen tubes homozygous for tetraploid alleles of AGC1.5 and ACA8 that were under selection in the tetraploid lineage of A. arenosa outcompete and show more-normal pollen tube growth and morphology than pollen tubes carrying diploid alleles. This result supports y We generated transcriptome data for growing pollen tubes from plants homozygous for D or T alleles of ACA8 and AGC1.5 (fig. S11). When comparing transcriptomes of pollen tubes homozygous for T alleles for one or the other gene (D homozygote at the other) with neo-4XC1 (D homozygous for both) and est-4X (T homozygous for both), we observed expression differ- Conclusions the hypothesis that the tetraploid alleles of these genes likely contribute to polyploid pollen tube stabilization (neither gene is linked to other ploidy-differentiated loci or other pollen tube–related genes). AGC1.5 and ACA8 genotypes strongly correlate not only with the same morphological features we see differentiating pollen tubes of neo-4X and est-4X plants but also with gene expression differences. The overrepresentation of T alleles in the F2 population also shows that it is the gametophyte genotype that matters for their performance, consistent with prior work showing that pollen tube growth is driven by gametophytic gene expression (44). As we cannot formally rule out that linked variation could contribute to this trait by chance, we emphasize that functional studies will need to be done to confirm their mechanistic role. This was not feasible here, as transformation is currently prohibitive in A. arenosa, but in the future, careful followup in a heterologous system should be done. Although further work is needed to confirm their role and understand how these genes might control these effects, linking them to polyploid fertility makes them useful candidates for engineering solutions to rescue fertility of artificially generated neo-polyploids for plant breeding. Finally, an important aspect of this work is that it demonstrates that the “reverse adaptation genomics” approach we used, in which the identification of genes under selection in genome scans is used to generate new hypotheses about undiscovered adaptions (10), can work as a discovery tool. g Transcriptomes of AGC1.5 and ACA8 pollen tubes ences for 13 of the 27 DEGs described in Fig. 3E. In most cases, expression differences between neo-4XC1 and AGC1.5 or ACA8 T homozygotes mirrored the trend when comparing neo-4XC1 with est-4X (fig. S12), suggesting that T alleles of AGC1.5 and ACA8 contribute at least partially (directly or indirectly) to the expression levels characteristic of est-4X. Several patterns are evident when comparing expression levels among all genotypes tested: For AGP2 and MIRO2, the diploid pollen tubes of est-4X and ACA8 or AGC1.5 single T homozygotes show a return to expression levels characteristic of haploid pollen tubes of diploids. For CDI, AT5G35930, and TRO, est-4X and ACA8 or AGC1.5 single T homozygotes also “correct” divergent neo-4XC1 expression but overshoot the level seen in haploid pollen tubes of 2X. For AT3G20790, RALFL11, and CIPK15, est-4X and ACA8 or AGC1.5 single T homozygotes exacerbate a change that neo-4XC1 already exhibited relative to 2X. For GH9B14, GAPCP-2, and VLN4, a different expression level relative to that of the haploid tubes from 2X occurs in the diploid pollen tubes of est-4X (but not neo-4XC1), and ACA8 or AGC1.5 T homozygotes have either the same as est-4X or, more commonly, intermediate levels (fig. S12). Thus, while some genes that are misexpressed in diploid pollen tubes from neo-4XC1 plants return in diploid pollen tubes of est-4X or T homozygotes for either AGC1.5 or ACA8 to expression levels observed in haploid pollen tubes of 2X, many do not. This finding suggests that evolution in the polyploid lineage has tinkered with the novel situation created by genome duplication to create a new situation and did not simply return gametophyte gene expression to the haploid state. p 78.3% with m < 0) were more like haploid pollen tubes from 2X plants (m = −1.20; 82.8% with m < 0) or diploid pollen tubes from est-4X (mean m = −1.72; 77.1% with m < 0; frequencies: P > 0.99 in both cases, c2 test with HolmBonferroni correction). Subapical actin filaments were evident in a lower proportion of analyzed tubes from plants homozygous for D alleles at both loci (68%, AGC1.5-D ACA8-D) than those from 2X (94%, P = 0.015), est-4X (89%, not significant, P = 0.067), or F2 plants homozygous for T alleles at one or both loci (87%, P = 0.021; all three c2 test with Holm-Bonferroni correction; fig. S10B, table S4, and data S2). For the presence of the apical ring, results were more ambiguous: Pollen tubes from AGC1.5-D ACA8-D plants differed significantly in AR presence only from those of ACA8-D AGC1.5-T and ACA8-T AGC1.5-D plants (P = 0.14 and P > 0.99, respectively, c2 test with Holm-Bonferroni correction). The maximum length of subapical F-actin was low in pollen tubes from AGC1.5-D ACA8-D or neo-4XC1, whereas the remaining genotypes all had higher maximum F-actin length (fig. S10C). For pectin acidification, the frequency of single, tip-localized signals was significantly lower in pollen tubes from AGC1.5-D ACA8-D (39%) versus AGC1.5-T ACA8-T (65%, P = 0.01, c2 test with Holm-Bonferroni correction; fig. S10D). Although the frequency of normal pectin signals was higher for AGC1.5-D ACA8-D (39%) than for neo-4XC1 (27%), the difference was not statistically significant (P = 0.56, c2 test with Holm-Bonferroni correction). AGC1.5-T ACA8-T (65%) was significantly lower than est-4X (90%, P = 0.01, c2 test with HolmBonferroni correction; fig. S10D), suggesting that at least one additional gene is involved. The remaining differences in each trait value between AGC1.5-D ACA8-D and neo-4XC1, or AGC1.5-T ACA8-T and est-4X, suggest that one or more additional genes, albeit with smaller effects, are also involved in the stabilization of pollen tube growth in est-4X. Nevertheless, it is notable that AGC1.5-D ACA8-D versus AGC1.5-T ACA8-T have nearly as wide a difference in in vitro pollen tube performance (PTGR, bursting, etc.) as we observe between neo-4X and est-4X, suggesting that the alleles that came under selection in the tetraploids at these loci are likely major players in the evolution of improved pollen tube growth in polyploid A. arenosa.
RES EARCH | R E S E A R C H A R T I C L E To assess pollen viability, anthers collected from freshly opened flowers were kept for 30 min in a growth chamber (see above) at 100% humidity. Pollen grains were co-stained in 0.01% FDA and 0.02% PI in Millipore water. PI associates with cell wall pectins of living (i.e., intact) cells, remaining external to the cell, but it can enter through disordered membranes upon cell death, leading to red cytoplasmic fluorescence. Thus, cells with cytoplasmic PI signal were classified as dead cells. FDA is esterasedependent and causes green fluorescence of living cells, and it was used as a counterstain to confirm viability of PI-negative cells. Viability proportions were further verified with an alternative staining method using commercial Alexander’s solution (Morphisto), whose 1 March 2024 For comparisons of numerical variables between two groups, the t test was used (in Microsoft Excel), given that samples had a normal distribution (checked with KolmogorovSmirnov test in Prism GraphPad). For comparisons between multiple groups, if the samples did not have normal distribution (checked with Kolmogorov-Smirnov test in Prism GraphPad), the Kruskal-Wallis test was used followed by Dunn’s test to adjust the P value for multiple comparisons (in Prism GraphPad); whereas Welch’s analysis of variance (ANOVA; in Prism GraphPad) was used in the only case with normal distribution, because the groups were not homoscedastic (verified with F-test in Prism GraphPad). For comparisons of categorical variables, the Chi-square test was used (in Microsoft Excel), because the calculated expected values exceeded 5 in every case. A summary of statistical tests not reported in the figures is included in table S4, and all analyses are summarized in the corresponding tabs of data S2. Visualization and analysis of pollen tube subcellular features , Westermann et al., Science 383, eadh0755 (2024) Pollen viability analysis Statistical analyses of pollen and pollen tube features y To study pollen tube growth in vitro, freshly opened flowers were collected in the morning hours and kept under light at 100% humidity for 30 min to allow pollen grains to hydrate. Hydrated pollen was brushed onto a microscope slide covered with Arabidopsis pollen germination medium [5 mM KCl, 1 mM MgSO4, 0.01% H3BO3 (w/v), 5 mM CaCl2, and 10% sucrose (w/v), dissolved in deionized (Millipore) water, adjusted to pH 7.5 and solidified with 1% agarose, as previously described (46)]. Pollen germination was triggered by incubation at 28°C for 45 min, and pollen was subsequently grown at 21°C for 75 min in a growth chamber. Pollen samples were then imaged with a Leica Thunder Imager 3D Tissue microscope using differential interference contrast (DIC). Germination rates were calculated as the fraction of germinated Receptive pistils of both evolved tetraploid (TBG) and diploid (SNO) were crossed with pollen from diploids (SNO), neo-tetraploids (neo-4XC0), and established tetraploids (SBG). The purpose of using SBG pollen was to avoid erroneous results arising from the fact that A. arenosa is self-incompatible and partial or complete cross-incompatibilities have frequently been observed for TBG intrapopulation crosses (because TBG is quite inbred). Mature siliques were harvested 4 weeks after pollination and fixed in 25% acetic acid in ethanol. Cleared pistils were then imaged and dissected to enable reliable seed counts. y g In vitro pollen germination and growth assay To visualize pollen tubes in vivo, receptive pistils of mature flowers were pollinated with pollen from the donor plant of choice. After 24 hours, pistils were harvested and fixed in 25% glacial acetic acid in ethanol (v/v) overnight at 21°C. Then, pollinated pistils were subjected to an ethanol series (75, 50, and 25%; incubation under gentle shaking for 5 min each). Afterward, siliques were washed twice for 5 min in sodium phosphate buffer (100 ml: 9.3 ml of 1 M Na2HPO4, 6.8 ml of 1 M NaH2PO4, dissolved in double-distilled water; pH 8.0). Ovule clearing was performed by incubating siliques in 5% chloral hydrate (in 24 ml: 32 g chloral hydrate, 16 ml double-distilled water, and 8 ml glycerol) at 65°C for 5 to 10 min, and then washing three times in sodium phosphate buffer. Pistils were then incubated in 5 M NaOH at 65°C for 5 min, washed twice in sodium phosphate buffer, and then immediately mounted in staining solution [0.1% aniline blue in sodium phosphate buffer (w/v)] and imaged through epifluorescence microscopy (Leica Thunder Imager 3D Tissue). Seed set assay y Differentiation of ACA8 and AGC1.5 between A. arenosa diploid and tetraploid accessions was verified with recent whole-genome resequencing data from nearly 300 individuals (42). On the basis of ploidy-differentiated singlenucleotide polymorphisms (SNPs), two DNA markers were designed using the dCAPS method (45) (table S2). Hybrid-F1 plants were genotyped for ACA8 and AGC1.5 to verify heterozygosity at both loci and tetraploidy was confirmed by flow cytometry (fig. S13). F1 individuals from independent families were crossed to generate F2 progeny in which both allelic variants segregate. Three hundred thirty F2 individuals were genotyped to identify homozygous diploid and tetraploid individuals and to determine allelic segregation ratios. Aniline blue staining of fixed pollen tubes in vivo acid fuchsin and malachite components stain the cytoplasm and cell wall, respectively. Acid fuchsin–negative and malachite-positive pollen grains were counted as dead cells. g Identification of allelic variants and generation of homozygous plant lineages grains divided by the total number of grains, and bursting rates were calculated as the fraction of grains and tubes that burst during the 75-min experiment, divided by the sum of grains or tubes examined. PTGR was determined by tracking tube growth for 4 min and dividing the distance grown by time. Note that, as the length values are limited by microscope resolution, they are recorded in discrete pixel count values, resulting in some values being identical to a high number of decimal points [data S1 (47) and data S2] because discrete pixel values are divided by the same time value. Maximal width measurements of the tube apex and shank regions were performed on 40x close-up images. Maximal apex width was measured as the widest point from 0 to 10 mm from the tip, and shank width was measured as the widest point in the region 10 to 30 mm from the apex. p with a solution of 0.05% colchicine and 0.05% Silwet- L77 dissolved in water, at 15 to 21 days after sowing (when the second pair of true leaves started to emerge). Seedlings were allowed to recover under long-day conditions and were then transferred to single pots 7 days after treatment. After induction of flowering (see above,) ploidy was measured using flow cytometry of petal tissue to avoid effects of endoreduplication, which is common in leaves (fig. S13). Petals from three different flowers of each inflorescence were used. Only those stems that consistently yielded tetraploid flow cytometry profiles (fig. S13) were considered neo-tetraploid (neo-4XC0) and used for experiments. Neo-tetraploid individuals (neo-4XC0) were crossed (i) to each other to generate nextgeneration neo-tetraploids, which were also confirmed by flow cytometry (hereafter “neo4XC1”) and (ii) with est-4X TBG individuals to generate hybrid lineages (hereafter “hybrid-F1”) in which all genes with distinct diploid and tetraploid allelic variants should be heterozygous (DDTT). For Ca2+ live-imaging, pollen was germinated as described above and then stained by means of a previously described staining protocol using the intracellular Ca2+-dye Fluo-4 acetoxymethyl ester (Fluo-4/AM; ThermoFisher) (48). Fluorescence intensity was captured from actively growing pollen tubes in the first 30 mm from the tube tip using confocal microscopy [excitation(ex)/emission(em) at 488/516 nm; Zeiss LSM780]. Images were smoothed using mean normalization per neighboring pixel to reduce noise. A fluorescence profile was plotted along the longitudinal axis of each tube using ImageJ. Linear regression was performed, and the slope m of the corresponding function was determined as a proxy for presence (m < 0) or 8 of 10
RES EARCH | R E S E A R C H A R T I C L E DEG-calling and enrichment analyses Gene models of ACA8 (AL8G33030; scaffold_8:17902227..17911190; reverse strand) and AGC1.5 (AL3G24370; scaffold_3:5074347..5077333; reverse strand) were taken from the A. lyrata reference genome v2.1. Genomic and local 1 March 2024 9 of 10 , Protein structure predictions for diploid and tetraploid variants of ACA8 and AGC1.5 1. D. H. Touchell, I. E. Palmer, T. G. Ranney, In vitro ploidy manipulation for crop improvement. Front. Plant Sci. 11, 722 (2020). doi: 10.3389/fpls.2020.00722; pmid: 32582252 2. L. Comai, The advantages and disadvantages of being polyploid. Nat. Rev. Genet. 6, 836–846 (2005). doi: 10.1038/ nrg1711; pmid: 16304599 3. K. Bomblies, When everything changes at once: Finding a new normal after genome duplication. Proc. Biol. Sci. 287, 20202154 (2020). doi: 10.1098/rspb.2020.2154; pmid: 33203329 4. M. A. Lee, V. Howard-Andrews, M. Chester, Resistance of multiple diploid and tetraploid perennial ryegrass (Lolium perenne L.) varieties to three projected drought scenarios for the UK in 2080. Agronomy (Basel) 9, 159 (2019). doi: 10.3390/ agronomy9030159 5. L. Grandont, E. Jenczewski, A. Lloyd, Meiosis and its deviations in polyploid plants. Cytogenet. Genome Res. 140, 171–184 (2013). doi: 10.1159/000351730; pmid: 23817089 6. K. Bomblies, Learning to tango with four (or more): The molecular basis of adaptation to polyploid meiosis. Plant Reprod. 36, 107–124 (2023). doi: 10.1007/s00497-02200448-1; pmid: 36149479 7. C. Morgan, E. Knight, K. Bomblies, The meiotic cohesin subunit REC8 contributes to multigenic adaptive evolution of autopolyploid meiosis in Arabidopsis arenosa. PLOS Genet. 18, e1010304 (2022). doi: 10.1371/journal.pgen.1010304; pmid: 35830475 8. C. Morgan, H. Zhang, C. E. Henry, F. C. H. Franklin, K. Bomblies, Derived alleles of two axis proteins affect meiotic traits in autotetraploid Arabidopsis arenosa. Proc. Natl. Acad. Sci. U.S.A. 117, 8980–8988 (2020). doi: 10.1073/pnas.1919459117; pmid: 32273390 9. L. Yant et al., Meiotic adaptation to genome duplication in Arabidopsis arenosa. Curr. Biol. 23, 2151–2156 (2013). doi: 10.1016/j.cub.2013.08.059; pmid: 24139735 10. G. L. StebbinsJr.., Types of polyploids; their classification and significance. Adv. Genet. 1, 403–429 (1947). doi: 10.1016/ S0065-2660(08)60490-3; pmid: 20259289 11. A. Gonzalo, P. Parra-Nunez, A. L. Bachmann, E. Sanchez-Moran, K. Bomblies, Partial cytological diploidization of neoautotetraploid meiosis by induced crossover rate reduction. Proc. Natl. Acad. Sci. U.S.A. 120, e2305002120 (2023). doi: 10.1073/pnas.2305002120; pmid: 37549263 12. K. Bomblies, C. L. Peichel, Genetics of adaptation. Proc. Natl. Acad. Sci. U.S.A. 119, e2122152119 (2022). doi: 10.1073/ pnas.2122152119; pmid: 35858399 13. J. D. Hollister et al., Genetic adaptation associated with genome-doubling in autotetraploid Arabidopsis arenosa. PLOS Genet. 8, e1003093 (2012). doi: 10.1371/journal. pgen.1003093; pmid: 23284289 y For each sample, transcript counts and metadata were imported into the R software using the packages “tximport” and “tximportData” for creating a DESeq object of 13 samples (for processing with the “DESeq2” package). A total of 15,361 genes were retained after filtering genes with low read counts, and these were subjected to DESeq analyses, modeled by the sample genotype as a single factor, and using default parameters (nbinomWald test). DEGs were subsequently identified by generating various contrasts (sample groups) and identifying genes with an adjusted P ≤ 0.01 and |log2 fold change| > 1. For every A. lyrata gene identified as a DEG, the corresponding orthologs in A. thaliana (50) were provided as input to STRING (www.string-db.org). Functional enrichment results from STRING were plotted and visualized using R. Protein–protein interactions of certain enriched groups were exported from STRING and visualized using Cytoscape. REFERENCES AND NOTES y g Westermann et al., Science 383, eadh0755 (2024) RNA sequencing (RNA-seq) libraries were prepared by Novogene UK Ltd (Directional mRNA enrichment libraries) and subjected to NovaSeq paired-end sequencing (2 × 150 base pairs) at an average coverage of 32 million total reads per library. Fastq files of samples were aligned using bowtie2 to the Arabidopsis lyrata reference genome (50), prepared using the rsem-prepare-reference function of the RSEM software. Aligned bam files were sorted and indexed using samtools V1.9. Gene transcript counts for each sample were estimated using rsem-calculate-expression. y We collected 20 to 50 flowers from each plant in 50-ml falcon tubes. Twenty milliliters of 20% pollen germination medium (5 mM KCl, 1 mM MgSO4, 0.01% boric acid, 5 mM CaCl2, 20% sucrose, pH 7.5) was added to each tube, followed by vortexing at high speed for up to 4 min per sample. The tubes were centrifuged for 10 min at 4°C at 3000g. Floating flower tissue debris was removed using forceps, and 15 ml of the supernatant was discarded, leaving 5 ml of medium and a pellet of pollen in each tube. Centrifugation was repeated for 2 min at 3000g at 4°C. Debris and supernatant were removed again until 1 ml of medium was left in the tube. The pollen pellet was resuspended and added to petri plates containing 5 ml per well of 10% pollen germination medium (5 mM KCl, 1 mM MgSO4, 0.01% boric acid, 5 mM CaCl2, 10% sucrose, pH 7.5). The pollen suspension was split into two or more wells if the concentration of pollen was high (or if >25 flowers were collected per plant). The plates were incubated for 4 hours in a plant growth chamber (humidity 60%, illumination 3000 lux, 20°C). At two time points (before the incubation and then 2 hours into the incubation), the plates were briefly checked for pollen tube growth using a light microscope. After incubation, the pollen tube suspension in each well was filtered using 20-mm cell strainers, repeated once using the flow-through. The cell strainers carrying Library prep, sequencing, and read mapping positions of ploidy-differentiated SNPs, their allele frequency in diploids (AF2X) and tetraploids (AF4X), are based on SNP profiles from (42). For AGC1.5 protein structures of A. arenosa diploid and tetraploid allelic variants were inferred on the basis of SWISS-MODEL search (https://swissmodel.expasy.org/) using amino acid sequences of A. lyrata AGC1.5 (AL3G24370) and the A. arenosa 2X and 4X allelic variants as query. This yielded entry ‘4 gv1.1.A’ - RAC-alpha serine/threonine-protein kinase as best fit when building our protein model (QmeanDisCo score = 0.62 ± 0.05). Protein active sites for fig. S9, B and C, are based on prosite scan (https://prosite.expasy.org) using AL3G24370 modified to represent the A. arenosa 2X and est-4X alleles. ACA8 topological and transmembrane domains were inferred from UniProt entry Q9LF79 (https://www.uniprot. org/uniprotkb/Q9LF79/entry) from A. thaliana ACA8. The top five protein templates per query sequence were chosen on the basis of global model quality estimate (GMQE) score before modeling (table S3). g RNA extraction from pollen tubes the pollen tubes were flash cooled on dry ice or aluminum foil boats placed on liquid nitrogen. The frozen cell strainers were subsequently placed on new falcon tubes, and lysis buffer + B-ME mixture (from the Spectrum Plant Total RNA extraction kit–Protocol A) was directly added to the strainer. The flow-through was used for next steps of RNA extraction using the Sigma Spectrum Kit protocol. RNA from each sample was checked for quality using a Nanodrop spectrophotometer (Thermo Fisher). A maximum of 2000 ng of RNA was subjected to DNase I treatment (Thermo Scientific) at 37°C for 30 min, followed by cleanup using the Zymo RNA Clean & Concentrator kit. Eluted RNA concentration was measured using Qubit RNA BR reagents. p absence (m > 0) of a tip-focused Ca2+ gradient. For actin labeling, fixed pollen tubes were stained with Phalloidin-AlexaFluor405, an F-actin–specific probe, according to (49), followed by confocal microscopy (ex/em: 405/ 450 nm; Zeiss LSM780). A fluorescence profile was plotted longitudinally for the first 30 mm from the cell tip and transversely at three randomly chosen positions in the subapical region (defined as the 10- to 30-mm region measured from the cell tip). Presence of the subapical actin ring was defined as those cells that showed a maximum fluorescence intensity of ≥1.5× the median in the tube apex (0 to 10 mm from tip). Presence of subapical F-actin was defined as those cells that showed a maximum fluorescence intensity of ≥1.5× the median in one or more of the transverse profiles. Maximum F-actin length was measured manually using ImageJ. For esterified pectin staining, pollen tubes were incubated in 0.01% ruthenium red in germination medium (15) directly before (<2 min) microscopic analysis (Leica Thunder Imager 3D Tissue; Camera DFC9000 GT color). The number and location (tip-focused versus subapical or basal) of active growth sites (i.e., stained sites per tube) were manually determined. Specimens were counted as “normal” when displaying a single, tip-focused signal, as opposed to multiple signals or absence from the tip frequently observed in neo-tetraploids.
RES EARCH | R E S E A R C H A R T I C L E AC KNOWLED GME NTS We thank A. Widmer and C. Hughes for helpful comments on the manuscript, M. Dukic for SNP profiles, Y. Wijnand Revaz for help with genotyping, and I. Zurkirchen for plant cultivation. Funding: This work was supported by core funds from ETH Zürich and a grant from the Swiss National Science Foundation (310030192671; to K.B.), a grant from the Swiss National Science Foundation (217182; to T.S.), and funding from the European Union’s Horizon 2020 research and innovation program under Marie Skłodowska-Curie (MSC) grant agreement no. 101029732 (to A.G.). Author contributions: K.B., J.W., and T.S. designed the study and wrote the paper. J.W., T.S., A.G., and H.S.T. performed the experiments. J.W., T.S., and A.G. analyzed the data. All authors helped check and edit the paper. Competing interests: The authors declare that they have no competing interests. Data and materials availability: All images upon which these analyses were based and all primary data are freely and openly available through the ETH Research Collection (47). RNA-seq data generated for this study are available through the European Nucleotide Archive (https://www.ebi.ac.uk/ena/browser/home) under accession number PRJEB65902. Seeds available on request: kirsten. bomblies@biol.ethz.ch. License information: Copyright © 2024 the authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original US government works. https://www.science.org/about/sciencelicenses-journal-article-reuse. This research was funded in whole or in part by the Swiss National Science Foundation (Postdoctoral Fellowship 217182 and 310030-192671), a cOAlition S organization. The author will make the Author Accepted Manuscript (AAM) version available under a CC BY public copyright license. y g SUPPLEMENTARY MATERIALS y science.org/doi/10.1126/science.adh0755 Figs. S1 to S13 Tables S1 to S4 MDAR Reproducibility Checklist Movies S1 and S2 Data S2 10 of 10 , Submitted 8 February 2023; resubmitted 18 October 2023 Accepted 24 January 2024 10.1126/science.adh0755 y 1 March 2024 46. L. C. Boavida, S. McCormick, Temperature as a determinant factor for increased and reproducible in vitro pollen germination in Arabidopsis thaliana. Plant J. 52, 570–582 (2007). doi: 10.1111/j.1365-313X.2007.03248.x; pmid: 17764500 47. K. Bomblies, T. Srikant, J. Westermann, Dataset S1 for “A severe polyploidy-induced pollen defect rescued by evolved alleles of two tip-growth genes,” ETH Research Collection (2023); https://doi.org/10.3929/ ethz-b-000630044. 48. H. Qu, W. Xing, F. Wu, Y. Wang, Rapid and inexpensive method of loading fluorescent dye into pollen tubes and root hairs. PLOS ONE 11, e0152320 (2016). doi: 10.1371/journal.pone.0152320; pmid: 27055240 49. X. Qu, Q. Wang, H. Wang, S. Huang, Visualization of actin organization and quantification in fixed Arabidopsis pollen grains and tubes. Bio Protoc. 10, e3509 (2020). doi: 10.21769/ BioProtoc.3509; pmid: 33654717 50. V. Rawat et al., Improving the annotation of Arabidopsis lyrata using RNA-seq data. PLOS ONE 10, e0137391 (2015). doi: 10.1371/journal.pone.0137391; pmid: 26382944 g Westermann et al., Science 383, eadh0755 (2024) 31. A. Lovy-Wheeler, K. L. Wilsen, T. I. Baskin, P. K. Hepler, Enhanced fixation reveals the apical cortical fringe of actin filaments as a consistent feature of the pollen tube. Planta 221, 95–104 (2005). doi: 10.1007/s00425-004-1423-2; pmid: 15747143 32. P. K. Hepler, C. M. Rounds, L. J. Winship, Control of cell wall extensibility during pollen tube growth. Mol. Plant 6, 998–1017 (2013). doi: 10.1093/mp/sst103; pmid: 23770837 33. K. Müller et al., Overexpression of a pectin methylesterase inhibitor in Arabidopsis thaliana leads to altered growth morphology of the stem and defective organ separation. Plant Signal. Behav. 8, e26464 (2013). doi: 10.4161/psb.26464; pmid: 24675171 34. M. Woriedh et al., External application of gametophyte-specific ZmPMEI1 induces pollen tube burst in maize. Plant Reprod. 26, 255–266 (2013). doi: 10.1007/s00497-013-0221-z; pmid: 23824238 35. B. Levitin, D. Richter, I. Markovich, M. Zik, Arabinogalactan proteins 6 and 11 are required for stamen and pollen function in Arabidopsis. Plant J. 56, 351–363 (2008). doi: 10.1111/ j.1365-313X.2008.03607.x; pmid: 18644001 36. Z. Ge et al., Arabidopsis pollen tube integrity and sperm release are regulated by RALF-mediated signaling. Science 358, 1596–1600 (2017). doi: 10.1126/science.aao3642; pmid: 29242234 37. M. A. Mecchia et al., RALF4/19 peptides interact with LRX proteins to control pollen tube growth in Arabidopsis. Science 358, 1600–1603 (2017). doi: 10.1126/science.aao5467; pmid: 29242232 38. C. G. Sørmo, T. Brembu, P. Winge, A. M. Bones, Arabidopsis thaliana MIRO1 and MIRO2 GTPases are unequally redundant in pollen tube growth and fusion of polar nuclei during female gametogenesis. PLOS ONE 6, e18530 (2011). doi: 10.1371/ journal.pone.0018530; pmid: 21494602 39. H. M. Li, H. Chen, Z. N. Yang, J. M. Gong, Cdi gene is required for pollen germination and tube growth in Arabidopsis. FEBS Lett. 586, 1027–1031 (2012). doi: 10.1016/j.febslet.2012.02.046; pmid: 22569258 40. E. García-Quirós, J. D. Alché, B. Karpinska, C. H. Foyer, Glutathione redox state plays a key role in flower development and pollen vigour. J. Exp. Bot. 71, 730–741 (2020). doi: 10.1093/jxb/erz376; pmid: 31557297 41. D. Bloch et al., Exocyst SEC3 and phosphoinositides define sites of exocytosis in pollen tube initiation and growth. Plant Physiol. 172, 980–1002 (2016). doi: 10.1104/pp.16.00690; pmid: 27516531 42. R. A. Cole, L. Synek, V. Zarsky, J. E. Fowler, SEC8, a subunit of the putative Arabidopsis exocyst complex, facilitates pollen germination and competitive pollen tube growth. Plant Physiol. 138, 2005–2018 (2005). doi: 10.1104/pp.105.062273; pmid: 16040664 43. P. Monnahan et al., Pervasive population genomic consequences of genome duplication in Arabidopsis arenosa. Nat. Ecol. Evol. 3, 457–468 (2019). doi: 10.1038/s41559-0190807-4; pmid: 30804518 44. B. Nelms, V. Walbot, Gametophyte genome activation occurs at pollen mitosis I in maize. Science 375, 424–429 (2022). doi: 10.1126/science.abl7392; pmid: 35084965 45. M. M. Neff, J. D. Neff, J. Chory, A. E. Pepper, dCAPS, a simple technique for the genetic analysis of single nucleotide polymorphisms: Experimental applications in Arabidopsis thaliana genetics. Plant J. 14, 387–392 (1998). doi: 10.1046/ j.1365-313X.1998.00124.x; pmid: 9628033 p 14. B. Arnold, S. T. Kim, K. Bomblies, Single geographic origin of a widespread autotetraploid Arabidopsis arenosa lineage followed by interploidy admixture. Mol. Biol. Evol. 32, 1382–1395 (2015). doi: 10.1093/molbev/msv089 pmid: 25862142 15. E. Li et al., AGC1.5 kinase phosphorylates RopGEFs to control pollen tube growth. Mol. Plant 11, 1198–1209 (2018). doi: 10.1016/j.molp.2018.07.004; pmid: 30055264 16. Y. Zhang, J. He, S. McCormick, Two Arabidopsis AGC kinases are critical for the polarized growth of pollen tubes. Plant J. 58, 474–484 (2009). doi: 10.1111/j.1365-313X.2009.03792.x; pmid: 19144004 17. V. Demidchik, S. Shabala, S. Isayenkov, T. A. Cuin, I. Pottosin, Calcium transport across plant membranes: Mechanisms and functions. New Phytol. 220, 49–69 (2018). doi: 10.1111/ nph.15266; pmid: 29916203 18. Y. Li, J. Guo, Z. Yang, D. L. Yang, Plasma membrane-localized calcium pumps and copines coordinately regulate pollen germination and fertility in Arabidopsis. Int. J. Mol. Sci. 19, 1774 (2018). doi: 10.3390/ijms19061774; pmid: 29914054 19. M. Schiøtt et al., A plant plasma membrane Ca2+ pump is required for normal pollen tube growth and fertilization. Proc. Natl. Acad. Sci. U.S.A. 101, 9502–9507 (2004). doi: 10.1073/ pnas.0401542101; pmid: 15197266 20. J. B. Reese, J. H. Williams, How does genome size affect the evolution of pollen tube growth rate, a haploid performance trait? Am. J. Bot. 106, 1011–1020 (2019). doi: 10.1002/ ajb2.1326; pmid: 31294836 21. J. Doyle, J. Coate, Polyploidy, the nucleotype, and novelty: The impact of genome doubling on the biology of the cell. Int. J. Plant Sci. 180, 1–52 (2019). doi: 10.1086/700636 22. J. H. Williams, P. E. Oliveira, For things to stay the same, things must change: Polyploidy and pollen tube growth rates. Ann. Bot. 125, 925–935 (2020). doi: 10.1093/aob/mcaa007; pmid: 31957784 23. S. J. Baldwin, B. C. Husband, Genome duplication and the evolution of conspecific pollen precedence. Proc. Biol. Sci. 278, 2011–2017 (2011). doi: 10.1098/rspb.2010.2208; pmid: 21123263 24. I. Susín, J. M. Álvarez, Fertility and pollen tube growth in polyploid melons (Cucumis melo L.). Euphytica 93, 369–373 (1997). doi: 10.1023/A:1002904817971 25. Y. W. Rim, P. R. Beuselinck, Cytology of 2N pollen formation and pollen morphology in diploid Lotus tenuis (Fabaceae). Am. J. Bot. 83, 1057–1062 (1996). doi: 10.1002/ j.1537-2197.1996.tb12803.x 26. L. P. Lobanova, A. Y. Kolesova, Maize tetraploid pollen studies. Maize Genet. Coop. News Lett. 84, 37–38 (2010). 27. P. Fayant et al., Finite element model of polar growth in pollen tubes. Plant Cell 22, 2579–2593 (2010). doi: 10.1105/ tpc.110.075754; pmid: 20699395 28. H. Li, Y. Lin, R. M. Heath, M. X. Zhu, Z. Yang, Control of pollen tube tip growth by a Rop GTPase–dependent pathway that leads to tip-localized calcium influx. Plant Cell 11, 1731–1742 (1999). pmid: 10488239 29. P. K. Hepler, J. G. Kunkel, C. M. Rounds, L. J. Winship, Calcium entry into pollen tubes. Trends Plant Sci. 17, 32–38 (2012). doi: 10.1016/j.tplants.2011.10.007; pmid: 22104406 30. L. Steinhorst, J. Kudla, Calcium - a central regulator of pollen germination and tube growth. Biochim. Biophys. Acta Mol. Cell Res.1833, 1573–1581 (2013). doi: 10.1016/j.bbamcr.2012.10.009; pmid: 23072967
RES EARCH RESEARCH ARTICLE SUMMARY ◥ IMMUNOLOGY The immunopathological landscape of human pre-TCRa deficiency: From rare to common variants Marie Materna et al. INTRODUCTION: ab and gd T lymphocytes con- mice, only a few TCRab cells are detected in the lymph nodes (LNs) (5% of normal levels). In these studies, the mice remained healthy in pathogen-free conditions but were not challenged with pathogens. They did not develop overt phenotypes, but, to our knowledge, no data have been published for Ptcra−/− mice beyond the age of 2 months. y RESULTS: We studied 10 patients with rare biallelic loss-of-function PTCRA variants. These patients had small thymi, and their blood naive ab T cell counts had been low since childhood, but their memory ab T cell counts were normal. g RATIONALE: The pre-TCRa chain appears to be essential for ab T cell development in mice, but it is unknown whether this is also the case in humans. Immunological and clinical studies of humans with inherited pre-TCRa deficiency would address this question. p stitute two of the three lineages of adaptive immunity in jawed vertebrates. They are generated from progenitor stem cells that differentiate in the thymus. In mice, branching into the ab and gd T cell lineages occurs during early thymopoiesis, with rearrangements of TRD [encoding d T cell receptor (TCRd)], TRG (encoding TCRg), and TRB (encoding TCRb). Productive TRD and TRG rearrangements lead to maturation into gd T cells. Alternatively, following productive TRB rearrangement, expression of the pre-TCRa chain (encoded by PTCRA) leads to the surface expression of heterodimeric TCRb–pre-TCRa, which facilitates the TCRb selection of thymocytes during TRAD (TCRa) rearrangements, resulting in the development of ab T cells. In 4-week-old mice, preTCRa loss is associated with a >95% decrease in ab T cell precursor counts. Although peripheral T cells have not been extensively studied in these y g Their naive CD4−CD8− ab and gd T cell counts were high. Moreover, six of these patients remained healthy at ages ranging from 2 to 65 years. The other four patients had infections, lymphoproliferation, or autoimmunity beginning at ages ranging from 13 to 25 years. This relatively mild clinical phenotype reflected an age-dependent accumulation of normal counts of diverse functional memory ab T cells. These data raised questions about how ab T cells develop in the absence of pre-TCRa. TRAD rearrangements were biased in ab T cells from pre-TCRa–deficient individuals. The TCRa repertoire suggested that these TCRa rearrangements occurred preferentially with a TCRd1 template. Similar to controls, most ab T cell clones did not carry productive TRG rearrangements, suggesting that most of the patients’ ab T cells were unlikely to have differentiated directly from gd+ thymocytes. Moreover, TCRd1 could not act as a surrogate for pre-TCRa in pre-TCR formation with multiple TCRb. These findings call for alternative hypotheses that may account for ab T cell differentiation in the absence of pre-TCRa and be consistent with the associated rearrangement bias observed at the TRAD locus. Finally, we also identified two common PTCRA variants responsible for partial pre-TCRa deficiency in homozygotes. The hypomorphic p.Tyr76Cys PTCRA variant was found to be homozygous in about 1 in 73,000 individuals from Africa. Moreover, about 1 in 4000 individuals from the Middle East and South Asia were homozygous for the hypomorphic p.Asp51Ala variant. This missense was located in the extracellular domain and affected an acidic residue, which is important for the interaction between pre-TCRa and TCRb. Homozygotes for the p.Asp51Ala variant had high circulating naive gd T cell counts and a significantly higher incidence of autoimmunity when compared with the general population. CONCLUSION: Inherited complete pre-TCRa Functional ab T cells and late-onset immunological conditions in humans with complete or partial inherited pre-TCRa deficiency. Although complete pre-TCRa deficiency is very rare, partial pre-TCRa deficiency is common in South Asia and the Middle East, affecting about 1 in 4000 individuals. DN, doublenegative. [Figure created with BioRender.com.] Materna et al., Science 383, 966 (2024) 1 March 2024 All author names and affiliations are available in the full article online. *Corresponding author: Vivien Béziat (vivien.beziat@inserm.fr) Cite this article as M. Materna et al., Science 383, eadh4059 (2024). DOI: 10.1126/science.adh4059 READ THE FULL ARTICLE AT https://doi.org/10.1126/science.adh4059 1 of 1 , ▪ y deficiency is rare in humans. It is less severe than anticipated, as the patients have ab T cells and can survive into adulthood, often without clinical manifestations. Their TCRa repertoire is biased, which suggests that noncanonical thymic differentiation pathways can rescue ab T cell development. Additionally, a partial form of pre-TCRa deficiency was found to be less rare than anticipated, affecting about 1 in 4000 individuals in South Asia and the Middle East, where it is a monogenic etiology of autoimmunity with incomplete penetrance.
RES EARCH RESEARCH ARTICLE ◥ IMMUNOLOGY The immunopathological landscape of human pre-TCRa deficiency: From rare to common variants 1 of 18 , These 10 patients came from seven unrelated families and were of four different ethnicities (Fig. 1D, data S1, and supplementary text). Six of 10 patients with predicted pre-TCRa y 1 March 2024 Clinical features of patients with biallelic pLOF PTCRA variants y g Materna et al., Science 383, eadh4059 (2024) and, during a process known as b-selection, it promotes a burst of proliferation and differentiation into CD4+CD8+ double-positive (DP) thymocytes. The TRA loci on the DP thymocytes then undergo successive waves of rearrangement (5–8), leading to the expression of TCRab heterodimers on the cell surface, and downregulation of the pre-TCRa chain (8, 9). After undergoing negative and positive selection, TCRab+ thymocytes eventually differentiate into CD4+ or CD8+ single-positive (SP) mature T cells and migrate to the periphery (10, 11). In 4-week-old mice, pre-TCRa loss is associated with a >95% decrease in DP thymocyte counts (12). Although peripheral T cells have not been extensively studied in these mice, only a few TCRab cells are detected in lymph nodes (LNs) (5% normal levels), with the cells displaying normal TCR diversity (12, 13). In these studies, the mice remained healthy in pathogen-free y a b and gd T lymphocytes constitute two of the three cellular lineages of adaptive immunity in jawed vertebrates. In a process clarified in mice, they are generated from progenitor stem cells by differentiation in the thymus (1). Double-negative (DN) thymocytes, which lack both CD4 and CD8, are the most immature cells. They differentiate into mature ab T cell receptor (TCRab)– or TCRgd–expressing T cells. Cells branch off into these two lineages during early thymopoiesis, which occurs at the same time as TRD, TRG, and TRB locus rearrangements (2–4). Productive TRD and TRG rearrangements then lead to TCRgd expression on the cell surface, promoting maturation into gd T cells. Alternatively, after productive TRB locus rearrangement, a TCRb chain may dimerize with a pre-TCRa protein to generate a pre-TCR. This heterodimer is expressed on the cell surface PTCRA encodes two functional isoforms in humans and mice (15). Isoform B is 106 amino acids shorter than isoform A and lacks part of the extracellular domain (Fig. 1, A and B). We reanalyzed a public RNA sequencing (RNA-seq) dataset corresponding to eight sorted thymocyte subsets from healthy controls (Fig. 1C) (16) and found that isoform A was the principal preTCRa isoform in all human thymocyte subsets (supplementary text). Unless otherwise specified, we refer below to isoform A. We searched for biallelic predicted loss-of-function (pLOF) variants of the PTCRA isoform A, including large deletions, frameshift insertions or deletions, premature stop codons, and variants affecting essential splice sites or the start codon. No biallelic pLOF variants meeting these criteria have ever been reported in public databases (17–19). In our in-house database containing data for >25,000 patients, including four other unrelated patients identified by newborn screening (P1, P2, P9, and P10), we identified 10 patients from seven kindreds, all carrying biallelic pLOF variants (Fig. 1D; fig. S1, A to C; and supplementary text). The seven pLOF variants in these individuals were present in the homozygous state in five kindreds and in the compound heterozygous state in two kindreds. Five variants were private to the kindreds identified, and two were reported in major public databases but only in the heterozygous state, with a minor allele frequency (MAF) of <10−4 (17–19). Two variants were predicted to affect a splice site, two were small frameshift deletions, two led to premature stop codons, and one was a large deletion. The c.58G>C substitution was a missense variant (p.Gly20Arg) but was considered to be pLOF because it was predicted to impair splicing between exons 1 and 2. Apart from the seven pLOF variants identified, only 15 biallelic coding variants—all missense and not predicted to be LOF—were found in public databases or in the HGID in-house database (fig. S1A). g We describe humans with rare biallelic loss-of-function PTCRA variants impairing pre–a T cell receptor (pre-TCRa) expression. Low circulating naive ab T cell counts at birth persisted over time, with normal memory ab and high gd T cell counts. Their TCRa repertoire was biased, which suggests that noncanonical thymic differentiation pathways can rescue ab T cell development. Only a minority of these individuals were sick, with infection, lymphoproliferation, and/or autoimmunity. We also report that 1 in 4000 individuals from the Middle East and South Asia are homozygous for a common hypomorphic PTCRA variant. They had normal circulating naive ab T cell counts but high gd T cell counts. Although residual pre-TCRa expression drove the differentiation of more ab T cells, autoimmune conditions were more frequent in these patients compared with the general population. Identification of rare biallelic predicted loss-of-function PTCRA variants in seven kindreds p Marie Materna1,2, Ottavia M. Delmonte3†, Marita Bosticardo3†, Mana Momenilandi1,2†, Peyton E. Conrey4†, Bénédicte Charmeteau-De Muylder5‡, Clotilde Bravetti6,7‡, Rebecca Bellworthy8‡, Axel Cederholm9‡, Frederik Staels10‡, Christian A. Ganoza11‡, Samuel Darko12‡, Samir Sayed4‡, Corentin Le Floc’h1,2‡, Masato Ogishi13‡, Darawan Rinchai13‡, Andrea Guenoun14‡, Alexandre Bolze15‡, Taushif Khan14,16‡, Adrian Gervais1,2‡, Renate Krüger17, Mirjam Völler17, Boaz Palterer3, Mahnaz Sadeghi-Shabestari18, Anne Langlois de Septenville6, Chaim A. Schramm12, Sanjana Shah12, John J. Tello-Cajiao4,19, Francesca Pala3, Kayla Amini3, Jose S. Campos4, Noemia Santana Lima12, Daniel Eriksson20, Romain Lévy1,2,21, Yoann Seeleuthner1,2, Soma Jyonouchi4, Manar Ata14, Fatima Al Ali14, Caroline Deswarte1,2, Anaïs Pereira1,2, Jérôme Mégret22, Tom Le Voyer1,2, Paul Bastard1,2,13,21, Laureline Berteloot23, Michaël Dussiot2,24, Natasha Vladikine1,2, Paula P. Cardenas25, Emmanuelle Jouanguy1,2,13, Mashael Alqahtani26, Amal Hasan27, Thangavel Alphonse Thanaraj28, Jérémie Rosain1,2, Fahd Al Qureshah13, Vito Sabato29, Marie Alexandra Alyanakian30, Marianne Leruez-Ville31, Flore Rozenberg5,32, Elie Haddad33, Jose R. Regueiro25, Maria L. Toribio34, Judith R. Kelsen35, Mansoor Salehi36,37, Shahram Nasiri38, Mehdi Torabizadeh39, Hassan Rokni-Zadeh40, Majid Changi-Ashtiani41, Nasimeh Vatandoost37,42, Hossein Moravej43, Seyed Mohammad Akrami44,45, Mohsen Mazloomrezaei45, Aurélie Cobat1,2,13, Isabelle Meyts46,47, Etsushi Toyofuku48§, Madoka Nishimura49, Kunihiko Moriya50, Tomoyuki Mizukami49, Kohsuke Imai50, Laurent Abel1,2,13, Bernard Malissen51,52, Fahd Al-Mulla28, Fowzan Sami Alkuraya26,53, Nima Parvaneh54, Horst von Bernuth17,55,56,57, Christian Beetz11, Frédéric Davi6,7, Daniel C. Douek12¶, Rémi Cheynier5¶, David Langlais8¶, Nils Landegren9,58¶, Nico Marr14,59¶, Tomohiro Morio48#, Mohammad Shahrooei45,60#, Rik Schrijvers10#, Sarah E. Henrickson4,61,62#, Hervé Luche52#, Luigi D. Notarangelo3#, Jean-Laurent Casanova1,2,13,63,64#, Vivien Béziat1,2,13*# conditions but were not challenged with pathogens. They did not develop overt phenotypes but, to our knowledge, no data have been published for Ptcra−/− mice beyond the age of 2 months (12–14). The consequences of preTCRa deficiency in humans remain unknown. We therefore searched for patients with biallelic germline PTCRA variants likely to cause preTCRa deficiency.
RES EARCH | R E S E A R C H A R T I C L E velopment or medullary thymic epithelial cells (20–24). Patient alleles cause mRNA decay or premature translational termination Patient variants are LOF, and two variants from public databases are severely hypomorphic We assessed the ability of the pre-TCRa variants to stabilize TCRb and CD3 at the cell surface in the TCRa-deficient JR3.11 Jurkat cell line (25, 26). The transduction of these cells with the WT isoform A of pre-TCRa restored the expression of TCRb and CD3 at the cell surface (Fig. 2, F to I, and fig. S3, C to F). As expected, none of the cDNAs encoding variants from the patients except the cDNA encoding the p.Gly20Arg (c.58G>C) variant restored the 1 3 2 of 18 , 1 March 2024 y Materna et al., Science 383, eadh4059 (2024) y g *Corresponding author. Email: vivien.beziat@inserm.fr †These authors contributed equally to this work. ‡These authors contributed equally to this work. §Present address: Department of Rheumatology and Allergology, St. Marianna University School of Medicine, Kawasaki, Japan. ¶These authors contributed equally to this work. #These authors contributed equally to this work. y Laboratory of Human Genetics of Infectious Diseases, Necker Branch, INSERM, Necker Hospital for Sick Children, Paris, France. 2Imagine Institute, University of Paris-Cité, Paris, France. Laboratory of Clinical Immunology and Microbiology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD, USA. 4Division of Allergy Immunology, Department of Pediatrics, Children’s Hospital of Philadelphia, Philadelphia, PA, USA. 5University of Paris, Institut Cochin, INSERM U1016, CNRS UMR8104, Paris, France. 6Department of Biological Hematology, Hôpital Pitié-Salpêtrière, Assistance Publique–Hôpitaux de Paris (AP-HP) and Sorbonne Université, Paris, France. 7Sorbonne University, Paris Cancer Institute CURAMUS, INSERM U1138, Paris, France. 8Deptartment of Human Genetics, Dahdaleh Institute of Genomic Medicine, McGill University, Montreal, QC, Canada. 9Science for Life Laboratory, Department of Medical Biochemistry and Microbiology, Uppsala University, Uppsala, Sweden. 10Allergy and Clinical Immunology Research Group, Department of Microbiology, Immunology and Transplantation, KU Leuven, Leuven, Belgium. 11Centogene GmbH, Rostock, Germany. 12Human Immunology Section, Vaccine Research Center, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD, USA. 13St. Giles Laboratory of Human Genetics of Infectious Diseases, Rockefeller Branch, The Rockefeller University, New York, NY, USA. 14Department of Human Immunology, Sidra Medicine, Doha, Qatar. 15Helix, San Mateo, CA, USA. 16The Jackson Laboratory, Farmington, CT, USA. 17Department of Pediatric Respiratory Medicine, Immunology and Critical Care Medicine, Charité - Universitätsmedizin Berlin, corporate member of Freie Universität Berlin, Humboldt-Universität zu Berlin, and Berlin Institute of Health (BIH), Berlin, Germany. 18 Immunology Research Center, TB and Lung Disease Research Center, Mardaniazar Children Hospital, Tabriz University of Medical Science, Tabriz, Iran. 19Department of Pathology, Children’s Hospital of Philadelphia, Philadelphia, PA, USA. 20Department of Immunology, Genetics and Pathology, Uppsala University and University Hospital, Section of Clinical Genetics, Uppsala, Sweden. 21 Pediatric Immunology, Hematology and Rheumatology Unit, Necker Hospital for Sick Children, AP-HP, Paris, France. 22Cytometry Core Facility, SFR Necker, INSERM US24-CNRS UAR3633, Paris, France. 23Department of Pediatric Radiology, University Hospital Necker-Enfants Malades, AP-HP, Paris, France. 24Laboratory of Molecular Mechanisms of Hematological Disorders and Therapeutic Implications, INSERM UMR 1163, Paris, France. 25Department of Immunology, Ophthalmology and ENT, Complutense University School of Medicine and 12 de Octubre Health Research Institute (imas12), Madrid, Spain. 26Department of Translational Genomics, Center for Genomic Medicine, King Faisal Specialist Hospital and Research Center, Riyadh, Saudi Arabia. 27 Department of Translational Research, Research Division, Dasman Diabetes Institute, Dasman, Kuwait City, Kuwait. 28Department of Genetics and Bioinformatics, Research Division, Dasman Diabetes Institute, Dasman, Kuwait City, Kuwait. 29Department of Immunology, Allergology and Rheumatology, University of Antwerp, Antwerp University Hospital, Antwerp, Belgium. 30 Immunology Laboratory, Necker Hospital for Sick Children, Assistance Publique-Hôpitaux de Paris (AP-HP), Paris, France. 31Necker Hospital for Sick Children, AP-HP, Paris, France. 32Virology, Cochin Hospital, AP-HP, APHP-CUP, Paris, France. 33Department of Pediatrics, Department of Microbiology, Immunology and Infectious Diseases, University of Montreal, CHU Sainte-Justine, Montreal, QC, Canada. 34Immune System Development and Function Unit, Centro de Biología Molecular Severo Ochoa, Consejo Superior de Investigaciones Científicas (CSIC), Universidad Autónoma de Madrid (UAM), Madrid, Spain. 35Division of Gastroenterology, Hepatology and Nutrition, Children’s Hospital of Philadelphia, Philadelphia, PA, USA. 36Cellular, Molecular and Genetics Research Center, Isfahan University of Medical Sciences, Isfahan, Iran. 37Department of Genetics and Molecular Biology, Medical School, Isfahan University of Medical Sciences, Isfahan, Iran. 38 Department of Pediatric Neurology, Children’s Medical Center of Abuzar, Jundishapur University of Medical Sciences, Ahvaz, Iran. 39Golestan Hospital Clinical Research Development Unit, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran. 40Department of Medical Biotechnology, School of Medicine, Zanjan University of Medical Sciences (ZUMS), Zanjan, Iran. 41School of Mathematics, Institute for Research in Fundamental Sciences (IPM), Tehran, Iran. 42Pediatric Inherited Diseases Research Center, Research Institute for Primordial Prevention of NonCommunicable Disease, Isfahan University of Medical Sciences, Isfahan, Iran. 43Neonatal Research Center, Shiraz University of Medical Sciences, Shiraz, Iran. 44Medical Genetics Poursina St., Genetic Department, Medical Faculty, Tehran University of Medical Sciences, Tehran, Iran. 45Dr. Shahrooei Laboratory, Tehran, Iran. 46Laboratory for Inborn Errors of Immunity, Department of Microbiology, Immunology and Transplantation, Department of Pediatrics, University Hospitals Leuven, KU Leuven, Leuven, Belgium. 47Department of Pediatrics, University Hospitals Leuven, KU Leuven, Leuven, Belgium. 48Department of Pediatrics and Developmental Biology, Tokyo Medical and Dental University, Tokyo, Japan. 49Department of Pediatrics, NHO Kumamoto Medical Center, Kumamoto, Japan. 50Department of Pediatrics, National Defense Medical College, Saitama, Japan. 51Immunology Center of Marseille-Luminy, Aix Marseille University, Inserm, CNRS, Marseille, France. 52Immunophenomics Center (CIPHE), Aix Marseille Université, Inserm, CNRS, Marseille, France. 53Department of Anatomy and Cell Biology, College of Medicine, Alfaisal University, Riyadh, Saudi Arabia. 54Division of Allergy and Clinical Immunology, Department of Pediatrics, Tehran University of Medical Sciences, Tehran, Iran. 55Berlin Institute of Health at Charité – Universitätsmedizin Berlin, Berlin, Germany. 56Berlin-Brandenburg Center for Regenerative Therapies (BCRT), Charité - Universitätsmedizin Berlin, Berlin, Germany. 57Labor Berlin GmbH, Department of Immunology, Berlin, Germany. 58Center for Molecular Medicine, Department of Medicine (Solna), Karolinska Institute, Stockholm, Sweden. 59College of Health and Life Sciences, Hamad Bin Khalifa University, Doha, Qatar. 60Clinical and Diagnostic Immunology, Department of Microbiology, Immunology, and Transplantation, KU Leuven, Leuven, Belgium. 61 Institute for Immunology and Immune Health, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA, USA. 62Department of Microbiology, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA, USA. 63Department of Pediatrics, Necker Hospital for Sick Children, AP-HP, Paris, France. 64Howard Hughes Medical Institute, The Rockefeller University, New York, NY, USA. g We then investigated the impact of the pLOF variants on PTCRA mRNA and protein. We were unable to test primary cells from the patients because pre-TCRa is expressed only in the thymus. First, using an artificial construct containing the genomic DNA (gDNA) sequence of PTCRA from the 5′ untranslated region (5′UTR) to the end of exon 2 (Fig. 2A), we demonstrated that two of the seven pLOF variants (c.58G>C and c.58+5G>A) severely impaired pre-TCRa expression in vitro by mRNA decay (Fig. 2, B to D; fig. S3A; and supplementary text). Second, we transfected HEK293T cells with C-terminally DDK-tagged complementary DNAs (cDNAs) encoding the wild-type (WT) pre-TCRa, one of the six coding pLOF variants identified in the patients, or one of the 15 non-pLOF missense variants identified in the homozygous state in public databases or in our in-house cohort (fig. S1A). Cell extracts were subjected to SDS– polyacrylamide gel electrophoresis (SDS-PAGE) followed by immunoblotting and immunodetection with a monoclonal antibody against DDK- or the N terminus of pre-TCRa (Fig. 2E, fig. S3B, and supplementary text). All variants found in the homozygous state in public databases or in our in-house HGID cohort were normally expressed in this system. By contrast, cDNAs encoding pLOF variants yielded a truncated protein or no protein at all, except for the p.Gly20Arg (c.58G>C) variant, which produced normal amounts of protein in this cDNA overexpression system (Fig. 2E) but was subject to mRNA decay in our artificial gene system (Fig. 2, B to D). Thus, the pLOF variants identified in the patients impair PTCRA expression by mRNA decay or premature translation termination. p deficiency, including the four identified by neonatal screening, were clinically asymptomatic at their most recent evaluation (at the ages of 2, 2, 4, 7, 8, and 65 years). The other four patients (13, 24, 31, and 66 years of age) displayed infection, lymphoproliferation, and/or autoimmunity with an onset during their teens or in adulthood (age at onset: 13, 13, 15, and 25 years, respectively). One of these patients died from severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) pneumonia at the age of 24 years. P9 had a small thymus on magnetic resonance imaging (MRI) at the age of 2 years, whereas P5 and P6 had no visible thymus at the ages of 13 and 8 years, respectively (Fig. 1E). Three of the nine patients with pLOF PTCRA variants tested were found to produce autoantibodies, several of which were associated with clinical manifestations (fig. S2, A to E, and supplementary text). Antithyroid autoantibodies and/or clinically overt thyroiditis were found in three of the nine patients. P7, who suffered from recurrent herpes infections, had autoantibodies against type I interferons (IFNs) (fig. S2A). All known genetic etiologies of these antibodies disrupt T cell tolerance as a result of mutations affecting thymocyte de-
RES EARCH | R E S E A R C H A R T I C L E A B C p g y D E y g y , Fig. 1. Autosomal recessive pre-TCRa deficiency. (A to B) Schematic representations of the isoform A (A) and isoform B (B) proteins encoded by PTCRA. (C) Abundance of the indicated pre-TCRa isoforms in transcripts per million (TPM) across thymocyte developmental stages (DN1, DN2, DN3, ISP, DP early, DP late, SP8, and SP4). The proportion of total PTCRA transcripts corresponding to isoform A in each thymocyte subset is indicated on the graph (dashed gray line). (D) Pedigree of the seven unrelated families displaying familial segregation of the mutant PTCRA alleles. The indicated mutant alleles, Materna et al., Science 383, eadh4059 (2024) 1 March 2024 each with a specific color code, are labeled “M” in the pedigree. Individuals of unknown genotype are labeled “E?”. Clinically asymptomatic individuals are annotated with a vertical bar. (E) MRI on axial sections at the level of the aortic arch: T1-weighted sequences after gadolinium injection (P5) and T2-weighted sequences (P6, P9, and controls), for P5, P6, P9, and age- and sex-matched controls. In patients, the thymic lodge, located between the sternum and the aortic arch (asterisk), appears empty (P5 and P6) or small (P9). By contrast, the thymus is clearly visible in controls, even after the onset of puberty (14-year-old girl). 3 of 18
RES EARCH | R E S E A R C H A R T I C L E p g y y g y , Fig. 2. Patient mutations and two mutants from gnomAD are LOF or severely hypomorphic. (A) Schematic representation of the artificial gene created to study the splicing between exons 1 and 2 of PTCRA. The two mutations tested are depicted. TSS, transcription start site. (B to D) HEK293T cells were transfected with an empty vector (EV) or with plasmids encoding the artificial gene with the WT or mutant PTCRA sequence described in (A). (B) The RNA was subjected to RT-qPCR for PTCRA with a probe spanning the splice junction between exons 1 and 2. Data are displayed as 2−DCt values after normalization relative to an endogenous control (DCt). The bar graphs show the means ± SEMs of three technical replicates and are representative of three Materna et al., Science 383, eadh4059 (2024) 1 March 2024 independent experiments. (C) Exon trapping. The bar graphs show the proportion of canonical or noncanonical PTCRA transcripts in the transfected HEK293T cells. (D) Total protein extracts were subjected to immunoblotting with an antibody against the DDK tag or GAPDH. Data are representative of three independent experiments. (E) HEK293T cells were transfected with an empty plasmid or with a plasmid carrying a C-terminal DDK-tagged cDNA encoding the WT or the indicated variants of PTCRA isoform A. Total protein extracts were subjected to immunoblotting with an antibody against the DDK tag, pre-TCRa, or vinculin. Data are representative of four independent experiments. (F to K) TCRa-deficient Jurkat cells were transduced with an EV or with a plasmid 4 of 18
RES EARCH | R E S E A R C H A R T I C L E encoding the WT isoform A, the WT isoform B, or the indicated variant of pre-TCRa. The expression of TCRb [(F) and (G)], CD3e [(H) and (I)] or CD69 [(J) and (K)] at the cell surface was evaluated by flow cytometry on the transduced cell lines. Data are representative of three independent experiments. (F, H, and J) Histograms showing the mean fluorescence intensity (MFI) of 5 of 18 , The asymptomatic pre-TCRa–deficient patients (P1, P2, P6, P8, P9, and P10)—like the patient with a mild clinical presentation (P5)—had normal or near-normal distributions of leukocyte subsets other than T cells and normal antibody responses to antigens (data S1, fig. S5, and supplementary text). By contrast, patients with clinical autoimmunity (P3, P4, and P7) were diagnosed with common variable immunodeficiency (CVID) and presented progressive cytopenia for multiple cell types. Pre-TCRa deficiency affects thymocyte differentiation in mice. We consequently investigated the blood T cell compartment of the patients. Except for P10, all patients (P1, P2, and P9) followed from birth displayed T cell lymphopenia early in life (Fig. 3A). Their total T cell counts remained stable over time, reaching counts at the low end of the normal range by the age of 3 years, when a physiological decline of CD3+ T cell counts is observed in normal individuals. Relative to age-matched controls, all patients other than P3 and P7 (aged y 1 March 2024 Low CD3+ T cell counts in newborns with complete pre-TCRa deficiency y g Materna et al., Science 383, eadh4059 (2024) We investigated the impact of the p.Asp51Ala variant on immunological phenotypes by analyzing the reported phenotypes of individuals homozygous and heterozygous for this variant among the South Asians included in the UK Biobank. The frequencies of autoimmunity (~20%) and hypothyroidism (~10%) codes were similar in individuals heterozygous for p.Asp51Ala and in controls (table S4). By contrast, three (75%) homozygous carriers had autoimmunity-related codes, and one (25%) had a hypothyroidism-related code. Homozygote 1 suffered from hypothyroidism and lichen planus at the ages of 48 and 52 years, respectively. Homozygote 2 presented with thrombocytopenia and Henoch–Schönlein purpura at the age of 50 years, and homozygote 3 suffered from rheumatoid arthritis at the age of 50 years. No autoimmunity was reported in homozygote 4, but he suffered from hypoxemic COVID-19 pneumonia at age 61. No lymphoproliferation was reported in any of the four homozygotes. We also analyzed the phenotype of the homozygotes identified in other cohorts (table S1). One of the two homozygotes in the Qatar Biobank was asymptomatic at the age of 46 years, and the other suffered from hypothyroidism with autoantibodies against thyroid peroxidase (TPO) at the age of 31 years. Two homozygotes were identified in a Saudi database, and clinical data were available for only one—an otherwise healthy 38-year-old man with vitiligo. His 40-year-old sister was y The p.Asp51Ala and p.Tyr76Cys variants identified in gnomAD affect residues interacting with TCRb (fig. S4A) (27). The p.Asp51Ala variant affects a charged residue in the extracellular domain. In the mouse, knock-in mutations of such residues impair the interaction between pre-TCRa and TCRb, which leads to a decrease in the count of DP thymocytes and an increase in gd T cell counts (28, 29). The p.Asp51Ala and p.Tyr76Cys variants may, therefore, impair dimerization between pre-TCRa and TCRb. In gnomAD v2.1.1 and the Centogene Biodatabank, the pTyr76Cys variant was most frequent in subSaharan Africans, with a MAF of ~0.0037 versus 0.0003 in the global population from gnomAD V2.1.1 (fig. S4B and tables S1 to S3). Thus, ~0.001% of Africans would be expected to have a partial deficiency of pre-TCRa (~1/ 73,000 individuals). In various databases, the p.Asp51Ala variant is more frequent in individuals from South Asia and the Middle East, whose MAF is ~0.01. By contrast, the MAF for the global population from gnomAD V2.1.1 is ~0.002 (fig. S4C and tables S1 to S3). In these populations—which together account Homozygosity for the Asp51Ala allele is a risk factor for autoimmunity shown, by Sanger sequencing, to be homozygous for the variant but was asymptomatic. In an Iranian database of individuals recruited on the basis of neurological phenotypes and Sanger sequencing data for the relatives of the proband, we identified three homozygous carriers of the p.Asp51Ala variant (P11, P12, and P13) (fig. S4D and supplementary text). None of these individuals presented unusual susceptibility to infection. However, two of the three children suffered from hypothyroidism. The thymic compartment of P11 (9 years old) contained tissue with abnormal properties on MRI, which suggested that the content of the thymus was abnormal (fig. S4E). Thus, evidence of autoimmunity was obtained for seven of the 11 (64%) homozygotes for whom clinical information was available. Finally, using the Centogene cohort, we identified 51 additional individuals homozygous for p.Asp51Ala (tables S5 and S6 and supplementary text). In this cohort, the association between autoimmunity and homozygosity for the p.Asp51Ala variant was confirmed, with an odds ratio (OR) of 5.02 relative to heterozygotes and WT subjects (95% CI, 1.750054 to 11.816898; adjusted P = 0.009965). Thus, homozygosity for the p.Asp51Ala variant appears to be a significant risk factor for the development of autoimmune disease in individuals of Middle Eastern and South Asian origin. g Population genetics of the Asp51Ala and Tyr76Cys variants for almost 2 billion individuals—the p.Asp51Ala allele can be regarded as “common” (MAF > 1%). Thus, 1/1000 to 1/10,000 Middle Eastern and South Asian individuals would be predicted to have a partial form of recessive preTCRa deficiency. We analyzed the exomes of two Iranian kindreds carrying the homozygous p.Asp51Ala variant and estimated that the most recent common ancestor (MRCA) carrying the variant lived about 8000 years ago [95% confidence interval (CI), 2511 to 29,430 years]. This finding suggests that there is no strong depletion of individuals homozygous for the p.Asp51Ala variant in these populations. Thus, considering only the p.Asp51Ala and p.Tyr76Cys alleles, ~1/180,000 individuals worldwide may have a partial form of pre-TCRa deficiency. In particular, the p.Asp51Ala variant is found in the homozygous state in 1/1000 to 1/10,000 individuals in the populations of South Asia and the Middle East. p cell-surface expression of TCRb and CD3. By contrast, 13 of the 15 biallelic variants reported in public or in-house databases restored the expression of TCRb and CD3. The p.Asp51Ala and p.Tyr76Cys variants induced only very low levels of TCRb and CD3 expression (Fig. 2, F to I, and fig. S3, C to F). Pre-TCR can signal autonomously when expressed at the cell surface. Its successful expression is, therefore, associated with cell-surface expression of the CD69 activation marker (25). Accordingly, all the pre-TCRa– encoding constructs that restored the expression of TCRb and CD3 at the cell surface also induced weak CD69 expression (Fig. 2, J and K, and fig. S3, G and H). Neither the pLOF variants from the patients nor the p.Asp51Ala and p.Tyr76Cys variants from the public Genome Aggregation Database (gnomAD) V2.1.1 induced CD69 expression on JR3.11 Jurkat cells. Similar findings were obtained when the deleterious variants were tested for their impact on isoform B (Fig. 2, F to K, and fig. S3, C, D, and G). Thus, the seven alleles from the patients are biochemically LOF, and the patients are predicted to have an autosomal recessive complete form of pre-TCRa deficiency. Moreover, two missense variants (p.Asp51Ala and p.Tyr76Cys) found in the homozygous state in the general population are highly deleterious for pre-TCRa function. cells transduced with the indicated PTCRA allele normalized against the MFI for EV. (G, I, and K) Representative flow cytometry histogram plot for the indicated PTCRA alleles. Cells transduced with the PTCRA alleles (black line, unshaded area) are compared with the cells transduced with the EV (shaded).
RES EARCH | R E S E A R C H A R T I C L E p g y y g y , Fig. 3. T cell immunophenotyping for patients with pre-TCRa deficiency. (A and B) CD3+ T cell counts as a function of age. The control range is represented by the gray area. (C) Thymic function was assessed in pre-TCRa– deficient patients (red and blue dots) and healthy local controls (black dots; n = 101). The concentration of sjTRECs in the blood (sjTRECs per 105 PBMCs) is presented as a function of age. (D) TCRab+ T cell counts as a function of age for naive and memory T cells. (E) TCRgd+ T cell counts as a function of age. The control range is represented by the gray area. (F) TCRgd+ T cell counts as a function of age for naive and memory T cells. (G) Frequency of TCRgd+ T cells among total naive (CD3+CD45RA+CCR7+) and memory (defined as non-naive Materna et al., Science 383, eadh4059 (2024) 1 March 2024 CD3+) T cells from patients (P3 to P6 and P8) and controls (n = 46). (H) Frequency of TCRgd1+ and TCRgd2+ T cells among naive TCRgd+ T cells from patients (P4, P8, and P9) and controls (n = 8). (I) Cell counts as a function of age for CD4+CD8− T cells and CD4−CD8+ T cells. The control range is represented by the gray area. (J) Naive ab T cell counts as a function of age for CD4+CD8− T cells and CD4−CD8+ T cells. ab T cells are defined here as CD3 + TCRgd− cells. (K) Frequency of CD4−CD8− cells in ab (defined here as CD3 + TCRgd−) naive (right) and memory (left) T cells from patients (P3 to P6 and P8) and controls. (L to N) Phenotyping of individuals homozygous for the p.Asp51Ala mutation (D51A) and controls (n = 12 to 18). (L) Frequency of TCRgd+ 6 of 18
RES EARCH | R E S E A R C H A R T I C L E T cells among total naive and memory T cells. (M) TCRgd+ T cell counts for naive and memory T cells. (N) Frequency of CD4−CD8 − cells among ab (defined here as CD3+TCRgd−) naive (right) and memory (left) T cells. (B, D, F, and J) P3 suffered from severe enteropathy and was 1 March 2024 We assessed the impact of the patients’ PTCRA genotype on the early stages of T cell differentiation by isolating blood CD34+ cells from 7 of 18 , Materna et al., Science 383, eadh4059 (2024) Pre-TCRa deficiency impairs the generation of TCRab+ but not TCRgd+ T cells in vitro y We then investigated the ab T cell compartment in more depth. The infants had low total CD4−CD8+ and CD4+CD8− T cell counts (Fig. 3I), which normalized between childhood and Blood gd T cells typically have a CD4−CD8−/lo phenotype, defining a T cell lineage that does not pass through the CD4+CD8+ DP stage in the thymus. In TCR-transgenic mice expressing TCRab at the DN stage in the thymus, a small abnormal population of TCRab cells with a CD4−CD8− phenotype is observed in the periphery (4, 30–32). Fate mapping has shown that these cells do not pass through the CD4 + CD8+ DP stage. Instead, they are thought to use the gd differentiation pathway, despite their expression of a TCRab (33). We therefore investigated whether a fraction of TCRab+ cells in the periphery in pre-TCRa deficient patients harbored the same phenotype. We found no difference in the frequency of CD4−CD8− cells among memory T cells from controls and patients (Fig. 3K). However, the frequency of CD4 −CD8− DN cells among naive TCRab+ T cells from pre-TCRa–deficient patients was higher (median = 4.2%; range, 2.5 to 8.9%) compared with that in age-matched controls (median = 0.6%; range, 0.2 to 1.5%) (Fig. 3K). We tested the hypothesis that homozygosity for the hypomorphic p.Asp51Ala variant affects T cell differentiation. We determined the sjTREC levels of three patients (P11 to P13). These levels were low in the two youngest patients (Fig. 3C). We also performed extensive immunophenotyping on these two children, which showed their counts and proportions of myeloid, B, and NK cells to be normal (fig. S7, A to D). The T cell counts of these patients were within the normal range for age-matched controls, as were the proportions of naive and memory T cell subsets, and other TH subsets, Treg cells, iNKT cells, and MAIT cells (fig. S7, E to I). Nevertheless, the counts and proportions (among naive T cells) of blood gd T cells were higher in the p.Asp51Ala homozygotes compared with controls (Fig. 3, L and M). In contrast to the findings for patients with complete pre-TCRa deficiency (Fig. 3K), the proportion of CD4−CD8− cells in the naive ab T cell compartment was normal (Fig. 3N). Compared with patients with complete preTCRa deficiency, p.Asp51Ala homozygotes generally had a narrower but still distinctive immunological phenotype, with higher proportions of gd T cells among naive T cells. This was reminiscent of mice with mutations that affect similarly charged residues of pre-TCRa (28, 29). y g Patients with complete pre-TCRa deficiency have normal memory ab T cell counts and low mucosal-associated invariant T cell counts Patients with complete pre-TCRa deficiency have a high proportion of CD4−CD8− DN ab T cells among naive T cells Low TREC levels and a high proportion of gd T cells among the naive T cells of p.Asp51Ala homozygotes y The mouse pre-TCRa is essential for ab T cell development but is dispensable for gd T cell development (12). We therefore studied the impact of complete human pre-TCRa deficiency on the two major T cell lineages. Patients had lower blood counts of naive ab T cells compared with age-matched controls but normal counts of memory ab T cells (Fig. 3D). Total gd T cell counts were high from early childhood (Fig. 3E). In children and adults, both naive and memory gd T cell counts remained normal to high (Fig. 3F). Accordingly, the proportion of gd T cells among naive T cells was higher in patients (median = 32.3; range, 3.7 to 62.3) compared with controls (median = 0.6; range, 0.1 to 2.2) (Fig. 3G). However, the proportion of gd T cells among memory T cells was above the upper limit of the control range only in P4, P5, and P10. The proportions of d1+ and d2+ gd T cells among naive T cells were normal in patients with pre-TCRa deficiency (Fig. 3H). Thus, preTCRa deficiency has different impacts on the thymic outputs of ab and gd T cells, impairing the production of ab T cells and favoring the production of gd T cells. Nevertheless, most circulating T cells (including naive T cells) were TCRab+. These CD4−CD8− DN cells did not have high levels of HLA-DR or CD38 expression and were, therefore, probably not chronically activated (fig. S6I) (34). Moreover, only small proportions of naive CD4−CD8−TCRab+ T cells from the preTCRa–deficient patients expressed MAIT cells (CD161+TCRVa7.2+), iNKT cells (TCRVa24-Ja18+), Treg cells (CD127−CD25+), or intraepithelial lymphocyte (IEL) markers (CLA, CD103, NKG2C, and NKG2A), which suggests that most DN ab T cells from the patients do not belong to an unconventional ab T cell subset (fig. S6J). Thus, pre-TCRa deficiency is associated with an approximately eightfold increase in the proportion of CD4−CD8− T cells in the naive TCRab+ T cell compartment. As in mice (4), DN ab T cells in humans may therefore develop through an alternative T cell differentiation pathway. g Patients with complete pre-TCRa deficiency have high naive gd and low naive ab T cell numbers adulthood (fig. S6A). However, as expected from their low naive ab T cell counts, pre-TCRa– deficient children and adults had low counts of naive CD4+ and CD8+ T cells (Fig. 3J). The low naive T cell counts of the patients were accompanied by a higher proportion of both CD4 and CD8 effector memory T cells (fig. S6, B and C). The proportion of regulatory T cells (Treg cells) among CD4+ T cells was in the range of controls for all patients (fig. S6D). Within the memory CD4+ T cell compartment, the frequencies of T helper (TH) subsets were within or near the control range (fig. S6E). Accordingly, comparisons with controls revealed no major differences in the production of TH1 (IFN-g), TH2 (IL-13), and TH17 (IL-17A) cytokines by the patients’ memory CD4+ T cells after stimulation (fig. S6F). In addition, pre-TCRa–deficient patients had lower levels of CD161+TCRVa7.2+ mucosal-associated invariant T (MAIT) cells compared with controls and normal frequencies of invariant natural killer T (iNKT) cells among T cells (fig. S6G). The frequency of TCRVa7.2+ cells was low among memory ab T cells but normal among naive ab T cells (fig. S6H), which suggests that the low frequency of MAIT cells was not because of impaired V(D)J rearrangement. Thus, patients with complete pre-TCRa deficiency have low total naive ab T cell counts, normal ab T memory-cell counts from childhood onward, and a low frequency of MAIT cells. p 31 and 66 years, respectively, both displaying progressive pancytopenia) had normal or nearnormal blood counts of total CD3+ T cells at their most recent follow-up visit (Fig. 3, A and B). Moreover, all patients under the age of 30 years had low proportions of single-joint TCR excision circles (sjTRECs) among peripheral blood mononuclear cells (PBMCs), suggesting poor thymic output (Fig. 3C). These data suggested that pre-TCRa deficiency impairs T cell development, resulting in low T cell counts in infancy, facilitating detection by newborn TREC level screening. However, the total T cell counts of the patients gradually increased, eventually reaching the normal range for age-matched controls (Fig. 3A). Moreover, these T cells proliferated normally upon mitogen stimulation in vitro (data S1). on rituximab treatment. P7 received chemotherapy for lymphoma. These two patients are therefore depicted with triangles. C, controls; LOF, patients homozygous for LOF variants; D51A, individuals homozygous for the p.Asp51Ala mutation.
RES EARCH | R E S E A R C H A R T I C L E p g y Fig. 4. Impaired generation of TCRab+ T cells in pre-TCRa–deficient ATOs. In vitro T cell differentiation from positively selected peripheral blood CD34+ cells obtained from five healthy controls, three patients with the p.Asp51Ala variant (D51A), and three patients with LOF PTCRA mutations (P1, P5, and P6) after 5 weeks of culture in the ATO system. (A) Flow cytometry plots showing the expression of early and late T cell differentiation markers (CD7, CD5, CD1a, The unexpectedly modest impact of pre-TCRa deficiency on ab T cell development in vivo raised the question of how these cells devel- 1 March 2024 8 of 18 , Sequencing of the TRAD locus in ab T cells reveals an enrichment in proximal TCRd1 and a depletion of distal MAIT cell rearrangements oped in the absence of a major TCR component during the b-selection process. In patients with complete pre-TCRa deficiency, the circulating ab and gd TCR repertoire diversities were slightly low and normal, respectively, (Fig. 5, A and B; fig. S8A; table S7; and supplementary text). We then investigated whether the patients displayed preferential usage of productive V-J rearrangements at the TRAD locus in gDNA from purified naive and memory ab T cells. The most common productive V-J recombination at the TRAD locus in the naive and memory ab T cells of the patients was TRDV01:TRDJ01 (i.e., TCRd1) (Fig. 5C and fig. S8B). The percentages of productive and nonproductive TRD rearrangements among total TRAD rearrangements were significantly higher and lower, respectively, in the patients’ naive ab T cells compared with those of the controls (Fig. 5D). Productive TRD rearrangements (involving any TRDV) consequently accounted for ~70% of the total TRD rearrangements detected in the ab T cells of patients with complete pre-TCRa y Materna et al., Science 383, eadh4059 (2024) TCRgd+ cells in the three pre-TCRa–deficient patients studied, relative to controls (Fig. 4, A and B). In particular, the ratio of TCRgd+ cells to TCRab+ cells was markedly higher in the pre-TCRa–deficient patients (~5) compared with controls (~0.1) (Fig. 4C). Finally, ATOs generated with CD34+ cells from the three patients homozygous for the p.Asp51Ala variant had a phenotype intermediate between those of the controls and pre-TCRa–deficient patients (Fig. 4). Thus, complete pre-TCRa deficiency almost completely abolishes human ab T cell differentiation in vitro, whereas partial deficiency due to p.Asp51Ala homozygosity has a milder impact. y g three pre-TCRa–deficient patients and five healthy controls and inducing their differentiation in vitro in an artificial thymic organoid (ATO) system (Fig. 4) (35). After 5 weeks of culture, control CD34+ cells remained highly viable (~74%) (Fig. 4A). Efficient differentiation into CD4+CD8+ DP cells (mean, ~52% of CD45+CD56− cells), TCRab+CD3+ SP cells (~23%), and TCRgd+CD3+ cells (~1.8%) was observed. By contrast, after 5 weeks of culture, viability was much lower for the CD34+ cells isolated from all three pre-TCRa–deficient patients (7 to 39%). The differentiation of these cells into T cells was impaired, with a block at the CD7+CD1a + CD4−CD8b− DN stage and an almost total absence of CD4+CD8+ DP cells (mean, ~2% of CD45+CD56− cells) and TCRab+CD3+ SP cells (~0.5%). However, a significant fraction of the cells were TCRgd+CD3+ (~3.5%). A determination of absolute counts per ATO of cells at various stages of differentiation confirmed the deficit of CD4+CD8b+ DP and TCRab+CD3+ cells and the presence of a significant number of CD4, CD8b, TCRab, TCRgd, and CD3) after gating on LIVE/DEAD–CD45+CD56– cells. The data shown correspond to one control, one p.Asp51Ala patient, and P1. (B) Plots of absolute counts per ATO for the various stages of T cell differentiation, for the cells isolated from the ATOs. (C) Bar graphs showing the ratio of absolute counts of TCRgd+ cells to absolute counts of TCRab+ cells per ATO.
RES EARCH | R E S E A R C H A R T I C L E p g y y g Materna et al., Science 383, eadh4059 (2024) to TRDV01 (TRAV01 to TRAV23) were enriched in the patients’ ab T cells (Fig. 5C and fig. S8B). TCRd1 accounted for ~70% of total naive gd T cells (Fig. 3H), so such a pattern would be expected for TCRa repertoires preferentially rearranged from a TCRd1 template, with TRAV23 becoming the most proximal TRAV gene after successful TCRd1 (TRDV01:TRDJ01) rearrangement (fig. S8D). Thus, our TRAD repertoire an- 1 March 2024 alysis suggests that, in absence of pre-TCRa, TCRa rearrangements preferentially occur from a productive TCRd1 template. TCRd1 is not a surrogate for pre-TCRa Having excluded the possibility that most ab T cells preferentially differentiate from gd+ thymocytes in the absence of pre-TCRa (Fig. 6, A and B; tables S8 and S9; and supplementary 9 of 18 , deficiency but only ~20% of those in healthy controls (P < 0.0001) (Fig. 5E and fig. S8C). An analysis of the TRAD locus from purified naive and memory ab T cells showed a depletion of the TRAV genes removed during TCRd1 rearrangement (TRAV24 to TRAV41) in the productive TRAD rearrangements in the ab T cells of patients relative to controls (Fig. 5, C, F and G, and fig. S8B). As a result, TRAV genes distal TCRd1 (TRDV1:TRDJ1) rearrangement is indicated with a black circle. (D) Fraction of TCRd rearrangements in total productive TRAD rearrangements from sorted naive and memory ab T cells from controls (black; n = 4) and pre-TCRa–deficient individuals (red; P1, P2, P4, P8, and P9). (E) Fraction of productive TCRd rearrangements among total TCRd rearrangements in naive and memory ab T cells from controls (black; n = 4) and pre-TCRa–deficient individuals (red; P1, P2, P4, P8, and P9) (red). (F) Schematic representation of the TRAD locus before and after TCRd1 rearrangement. (G) Percentage of productive TRA rearrangements involving TRAV24-41 in sorted naive and memory ab T cells from controls (black; n = 4) and pre-TCRa–deficient individuals (red; P1, P2, P4, P8, and P9). Unpaired t tests were used for comparisons in (A), (B), (D), and (E). y Fig. 5. Biases in the TRAD rearrangement repertoire indicate that TCRa chains are mostly generated by rearrangement of a TCRd1 template in pre-TCRa–deficient individuals. (A) Shannon’s entropy for TCRg rearrangements in naive and memory gd T cells from controls (black; n = 4) and preTCRa–deficient individuals (red; P1, P2, P4, and P8). (B) Shannon’s entropy for TCRa and TCRb rearrangements in naive and memory ab T cells from controls (black; n = 4) and pre-TCRa–deficient individuals (red; P1, P2, P4, P8, and P9). (C) Heatmap of paired gene rearrangements at the TRAD locus for naive ab T cells from four controls compared with five pre-TCRa–deficient individuals (P1, P2, P4, P8, and P9). The red color highlights V-J gene pairings overused in patients and the blue color highlights V-J gene pairings overused in controls. The
RES EARCH | R E S E A R C H A R T I C L E p We found that the peripheral ab T cell counts of pre-TCRa–deficient humans normalized with age as a result of the physiological decrease in T cell counts with age in healthy individuals and an accumulation of memory ab T cells in the patients. Four-week-old Ptcra−/− mice have been reported to have 5% normal T cells in the LNs (12). However, T cell dynamics in the thymus and periphery have not been studied during aging. We therefore sought to reassess and extend mouse immunophenotyping longitudinally by studying the thymus, blood, spleen, and LNs of 1-, 4-, 12-, and 24-week-old Ptcra−/− 1 March 2024 10 of 18 , Longitudinal study of peripheral T cells in 1- to 24-week-old Ptcra−/− mice and control mice. The skewed thymocyte differentiation observed in pre-TCRa–deficient mice remained stable in the aging thymus between the ages of 1 month and at least 6 months (Fig. 7, A to C, and supplementary text). Contrasting with the previous report of 5% normal T cells, we found that the CD4+ and CD8+ ab T cell counts in the LNs of 4-week-old mice corresponded to 23% and 14% of the normal level, respectively (Fig. 7D) (12). CD4+ ab T cell counts were 39% and 26% of the normal values in 12- and 24-week-old Ptcra−/− mice, respectively, whereas CD8+ ab T cell counts were 14% and 45% of the normal values in 12- and 24-week-old Ptcra−/− mice, respectively. Circulating CD4+ ab T cell counts in Ptcra−/− mice were 2%, 11%, and 15% of the normal level, whereas circulating CD8+ ab T cell counts were 1%, 5%, and 15% of the normal levels in 4-, 12-, and 24-week-old mice, respectively (Fig. 7D). Splenic CD4+ ab T cell counts in Ptcra−/− mice were 17%, 18%, and 40% of the normal values, whereas splenic CD8+ ab T cell counts were 3%, 5%, and 19% of the normal values in 4‐, 12‐, and 24‐week-old mice, respectively (Fig. 7D). y the rearrangement frequently found in pre-TCRa– deficient patients and a TCRb chain previously suggested to stabilize TCRd1 expression (36). By contrast, pre-TCRa or TCRa stabilized CD3 expression at high levels on the cell surface after cotransduction with any TCRb construct (Fig. 6D). Thus, in this system, TCRd1 and TCRg are unable to replace the pre-TCRa to stabilize TCRb expression at the cell surface. y g Materna et al., Science 383, eadh4059 (2024) and P8). The red color highlights V-J gene pairings overused in patients, and the blue color highlights V-J gene pairings overused in controls. (D) TCRab-deficient Jurkat cells were stably transduced with an empty plasmid or with a plasmid encoding TCRa, pre-TCRa, TCRd1, or TCRg. Each of the resulting cell lines was then cotransduced with another empty plasmid or with a plasmid encoding one of eight selected TCRb chains. The expression of CD3 at the cell surface was evaluated by flow cytometry. Representative flow cytometry histogram plot for three independent experiments is shown. Representative flow cytometry data are shown on the left. A recapitulative bar graph of the MFI for CD3 for each cell line is shown on the right. y text), we hypothesized that TCRd might act as a surrogate for pre-TCRa in the formation of a pre-TCR complex with specific TCRb rearrangements and CD3. Consistent with this hypothesis, we found that the TCRb repertoire was biased in patients with pre-TCRa deficiency, with an enrichment in rearrangements involving the middle TRBV genes and any TRBJ gene or involving the distal TRBV02-1 gene and any TRBJ02 gene (Fig. 6C and fig. S8, E and F). We transduced TCRab-deficient Jurkat cells with TCRd1, pre-TCRa, TCRa, or TCRg cDNA. These stable cell lines were cotransduced with an empty vector or one of eight selected TCRb chains, and CD3 stabilization at the cell surface was assessed by flow cytometry. TCRd1 and TCRa alone stabilized low amounts of CD3 on the cell surface, whereas neither pre-TCRa, TCRb, nor TCRg alone could stabilize CD3 expression at detectable levels on the cell surface. Relative to transduction with single chains, we observed no enhancement of CD3 stabilization after cotransduction with TCRd1 or TCRg together with any of the tested TCRb chains, including the TCRb chain with g Fig. 6. gd+ thymocytes do not preferentially differentiate into ab T cells in the absence of pre-TCRa, and TCRd1 cannot act as a surrogate for pre-TCRa. (A) Fraction of productive TCRg among total TCRg templates in sorted naive and memory ab (left) or gd (right) T cells from controls (black; n = 4) and pre-TCRa–deficient individuals (red; P1, P2, P4, and P9). Unpaired t tests were used for all comparisons. (B) Fraction of expanded ab T cell clones from two controls and two pre-TCRa–deficient individuals with a productive TRG rearrangement at the gDNA level. Notably, ~90% of these clones were CD4+CD8−. (C) Heatmap of paired gene rearrangements of the TRB locus for naive ab T cells from controls compared with five pre-TCRa–deficient individuals (P1, P2, P4,
RES EARCH | R E S E A R C H A R T I C L E p g y y g Materna et al., Science 383, eadh4059 (2024) mice were higher than those of control mice at all time points, with a greater increase in the spleen [10- to 20-fold between weeks 4 and 24 (W4 and W24)] and the LNs (7- to 16-fold between W4 and W24) compared with in the blood (2- to 10-fold increase between W4 and W24) (Fig. 7D). As in humans, circulating ab CD4−CD8− DN T cells were more abundant in 1 March 2024 Ptcra−/− compared with WT mice (Fig. 7D). Splenic and LN ab CD4−CD8− DN T cell counts did not significantly differ between Ptcra−/− and mice, however. Thus, CD4+ and CD8+ ab T cell counts increase in aging Ptcra−/− mice mostly because of an expansion of the memory T cell compartment. These findings are consistent with our pre-TCRa–deficient patient 11 of 18 , Treg cell counts mirrored the counts of total CD4+ ab T cells in the LNs and the blood (Fig. 7D). The increase in CD4+ and CD8+ ab T cell counts in the periphery in aging Ptcra−/− mice was driven by an accumulation of memory T cells, except for blood CD8+ T cells, which remained mostly naive in 24-week-old mice (Fig. 7, E and F). The gd T cell counts of Ptcra−/− (CD3+TCRgd−CD4−CD8+), DN (CD3+TCR−gd−CD4−CD8−), Treg (CD3+TCRgd−CD4 CD8−CD25+), and gd (CD3+TCRgd−CD4+CD8−). (E) Representative flow cytometry plots of naive and memory cell staining for CD4 and CD8 ab T cells from the spleen and LNs of 12-week-old WT (black) and Ptcra−/− mice (red). EM, effector memory; CM, central memory; N, naive. (F) Frequency of naive cells among CD4-SP and CD8-SP ab T cells, and of gd T cells in the indicated tissue of Ptcra−/− mice (red) and WT mice (black) from 0 to 24 weeks of age. (B, D, and F) The data shown are the means and standard deviations of four to six animals at each age. + y Fig. 7. Longitudinal studies of Ptcra−/− mice. (A) Schematic representation of thymocyte differentiation stages in mice. (B) Cell counts per thymus in Ptcra−/− mice and WT mice aged 0 to 24 weeks for the various thymocyte developmental stages. mut, mutant. (C) Intracellular (IC) and membrane (Mb) expression of TCRb for the indicated thymocyte subsets from Ptcra−/− mice (bottom) and WT mice (top). Cytometry data are representative of six Ptcra−/− mice, and six WT mice are shown. (D) Counts of cells per microliter of blood or per spleen or per LN for Ptcra−/− mice (red) and WT mice (black) aged 0 to 24 weeks for the indicated T cell subsets, including CD4-SP (CD3+TCRgd−CD4+CD8−), CD8-SP
RES EARCH | R E S E A R C H A R T I C L E data, which highlights the importance of studying aging animals when exploring thymic phenotypes. Discussion Founder effect analysis for the p.Leu99Hisfs*68 and p.Asp51Ala variants We used the UK Biobank plink-formatted population-level exome original quality functional 12 of 18 , Analysis of the UK Biobank data y The occurrence of homozygosity for the p. Leu99Hisfs*68 and p.Asp51Ala variants in different kindreds suggested a founder effect. An analysis of the whole-exome sequencing data revealed that P4 (kindred C) and P5 (kindred D), both of whom are homozygous for p.Leu99Hisfs68*, have a homozygous haplotype around PTCRA and encompassing a 1.38 Mb region corresponding to 73 single-nucleotide variants (SNVs) in common. The ESTIAGE method estimated the age of the MRCA of the two patients at 60 generations (95% CI, 19 to 258 generations) (47). Assuming a generation time of 27 years (48), the MRCA of these patients with the p.Leu99Hisfs68* mutation would have lived about 1600 (513 to 6966) years ago. Similarly, an analysis of the whole-exome sequencing data of P11 (kindred H) and P13 (kindred I), both homozygous for p.Asp51Ala, showed that they had a homozygous haplotype around PTCRA encompassing a 580 kb region corresponding to 39 SNPs in common. The ESTIAGE method estimated the age of the MRCA of these two patients at 301 generations (95% CI, 93 to 1090 generations) (47). Assuming a generation time of 27 years (48), the MRCA of these patients with the p.Asp51Ala mutation would have lived about 8000 (2511 to 29,430) years ago. y g 1 March 2024 P1, P9, and P10 underwent whole-exome sequencing as part of clinical care after a presumptive positive result for neonatal SCID screening. As a sibling of P1, P2 underwent neonatal SCID screening (presumptive positive result) and confirmatory testing for the familial mutations identified in P1. Commercial wholegenome sequencing (Macrogen) was performed for P3, P4, P5, and P7, due to their clinical history of immunodeficiency or autoimmunity. P6 and P8 were identified by regular Sanger sequencing for familial segregation analysis. The frequency of the p.Asp51Ala [Chr6(GRCh37):g.42890858A>C)] variant was evaluated in different cohorts including the South Asians from the UK biobank (44), 800 Qataris from the Qatar Genome Program (QGP) and Qatar Biobank (QBB) longitudinal study (45), Kuwaitis (46), Iranians (neurological phenotypes only), and Saudis (patients with suspected Mendelian diseases and their parents). y Written informed consent was obtained from legally authorized representatives in accordance with the Declaration of Helsinki. The study was approved by the ethics committee of INSERM (RCB 2010-A00634-35 et 2008-A01078-47), the UZ/KU Leuven ethical committee for research (reference number s58466), the Children’s Hospital of Philadelphia Institutional Review Board, and Tokyo Medical and Dental Univer- Whole-exome sequencing, whole-genome sequencing, and Sanger sequencing g Materna et al., Science 383, eadh4059 (2024) Materials and methods Informed consent sity (G2000-103). For studies of in vitro T cell differentiation and high-throughput sequencing of TCR repertoires, patients gave consent to participate in protocol 18-I-0128 approved by the NIH IRB and registered at www.clinicaltrials.gov as protocol NCT03610802. p The mouse and human PTCRA genes were discovered in 1994 and 1995, respectively, and the first pre-TCRa–deficient mice were described in 1995 (12, 37, 38). We report 10 humans from seven kindreds and three distant ancestries with autosomal recessive complete pre-TCRa deficiency. Given the severity of ab T cell deficiency in pre-TCRa–deficient mice (12), it seemed likely that pre-TCRa–deficient humans would suffer from life-threatening infections in infancy. To our surprise, this was not the case, and six of our 10 patients, aged 2 to 65 years, have remained healthy. The remaining four patients have exhibited severe infection, lymphoproliferation, or autoimmunity beginning between the ages of 13 and 25 years. This relatively mild clinical phenotype is likely the result of an agedependent accumulation of normal numbers of diverse, functional memory ab T cells. With hindsight, these findings do not conflict with the reported role of pre-TCRa in mice. The impact of the Ptcra−/− genotype on thymocytes and peripheral T cells has not been studied in aging mice and young mice, which survived in pathogen-free conditions and have not been challenged with pathogens. As in humans, we observed a progressive increase in mouse blood ab T cell counts with age, driven by memory cell accumulation. These findings highlight the need for caution when extrapolating phenotypes from mutant mice, which are often studied at a young age and in a narrow range of experimental conditions, to humans (39, 40). They also suggest that it can be productive to revisit mouse phenotypes on the basis of human studies. In both mice and humans, ab T cells can develop in the absence of pre-TCRa. These findings raise questions about how diverse naive ab T cells develop in the absence of pre-TCRa. Our first hypothesis was that early productive proximal TRA rearrangements may permit ab T cell development (41). However, we observed a depletion of productive TRAD rearrangements involving proximal TRAV genes (TRAV24 to TRAV41) and an enrichment in rearrangements involving distal TRAV genes (TRAV1 to TRAV23) in the patients’ naive ab T cells. Moreover, an abnormal enrichment in the productive TCRd1 (TRDV01:01-TRDJ01:01) rearrangement was observed in ab T cells from patients. Because TRAV segments preferentially recombine with symmetric TRAJ segments (proximal V with proximal J, distal V with distal J) (42, 43), the TCRa repertoire observed in the absence of pre-TCRa—with a depletion of rearrangements involving proximal TRAV and an enrichment in rearrangements involving distal TRAV—suggests that these TCRa rearrangements occurred preferentially with a TCRd1 template (fig. S8D). We therefore tested the hypothesis that TCRd permits ab T cell development. However, we found that TCRd1 was unable to act as a surrogate for pre-TCRa in the formation of a pre-TCR. Moreover, similar to controls, most CD4+ SP ab T cell clones from the patients did not carry a productive TRG rearrangement, which suggests that most of the patients’ T cells were unlikely to have differentiated directly from gd+ thymocytes. These findings call for alternative hypotheses that may account for ab T cell differentiation in the absence of pre-TCRa, which are consistent with the associated rearrangement bias observed at the TRAD locus. We also identified two alleles affecting residues interacting with TCRb responsible for partial pre-TCRa deficiency in homozygotes. Homozygosity for the p.Tyr76Cys variant affects about 1/76,000 individuals in sub-Saharan Africa. Homozygosity for p.Asp51Ala is more common, affecting between 1/1000 and 1/10,000 individuals in South Asian and Middle Eastern countries. The p.Asp51 residue was previously identified as potentially crucial for pre-TCRa function owing to its conservation and negative charge (28). We show that this amino acid plays a crucial role in pre-TCRa dimerization with TCRb. Humans homozygous for p.Asp51Ala have a partial form of pre-TCRa deficiency. They have normal cell counts of blood ab T cell subsets but high counts of naive gd T cells and low sjTREC levels. This phenotype is reminiscent of that of transgenic mice with substitutions in the extracellular domain of pre-TCRa, which have a phenotype intermediate between those of WT and Ptcra−/− mice (29). The clinical phenotype of individuals with partial pre-TCRa deficiency is milder than that of individuals with complete pre-TCRa deficiency. The patients are asymptomatic or display isolated autoimmune manifestations. Homozygosity for hypomorphic mutations of PTCRA should be considered in patients with isolated autoimmunity, particularly the p.Asp51Ala substitution in individuals of South Asian or Middle Eastern origin. Collectively, our findings demonstrate that human pre-TCRa is largely redundant for ab T cell development, but its complete or partial deficiency can result in late-onset clinical manifestations (including autoimmunity in particular) with incomplete penetrance.
RES EARCH | R E S E A R C H A R T I C L E Sanger sequencing and TA cloning The C-terminally Myc/DDK-tagged pCMV6 empty vector and the human PTCRA expression vectors were purchased from Origene (NM_138296; no. RC215794). Constructs carrying mutant alleles were generated by direct mutagenesis with the CloneAmp Hifi premix and polymerase (no. 639298, Takara). The resulting PCR products were digested with DpnI (no. R0176L, New England Biolabs) for 1 hour at 37°C, amplified in competent E. coli cells (no. C3019H, New England Biolabs), and purified with a Maxiprep kit (no. 12663, Qiagen). Isoform B of pre-TCRa and the mutant allele lacking exons 1 to 3 were obtained by opening the Isoform A WT vector by PCR with primers flanking the region to be deleted and then using the Quick Blunting Kit (no. E1201L, New England Biolabs) and the Quick Ligation Kit (no. M2200S, New England Biolabs) as recommended by the manufacturer. Lentiviral plasmids carrying the various PTCRA variants were generated by inserting the cDNA from the pCMV6 plasmids into an empty pTripSFFV-DNGFR vector (modified pTRIP-SFFVmtagBFP-2A; addgene, plasmid no. 102585). This was achieved by digesting the empty pTripSFFV-DNGFR vector with XhoI and BamHI for 1 hour at 37°C. The cDNA of interest was amplified by PCR and inserted into the vector by homologous recombination with the In-Fusion HD Cloning Kit according to the manufacturer’s instructions (no. 638911, Takara). Lentiviral plasmids pTrip-SFFV-DNGFR encoding TCRa, TCRd, TCRg, or TCRgd and pTrip-SFFV-GFP encoding various forms of TCRb were synthesized by TwistBioscience, after onboarding our empty vector plasmid. HEK293T cells were transiently transfected in the presence of the X-tremeGENE 9 DNA Transfection Reagent 13 of 18 , 1 March 2024 Plasmids and transient transfection y Genomic DNA was obtained from whole blood from the patients. The PTCRA mutations identified by WES were checked by amplifying the corresponding gDNA regions with a recombinant Taq polymerase (Thermo Fisher Scientific). Polymerase chain reaction (PCR) products were purified by centrifugation through Sephadex G-50 Superfine resin (Merck) before and after the sequencing reaction, which was performed with the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems) and the primers previously used to amplify the region of interest. Purified sequencing products were analyzed with an ABI Prism 3500 apparatus (Applied Biosystems) and aligned with the genomic sequence of PTCRA (Ensembl) with Serial Cloner 2.6 software. We checked that the compound mutations found in P7 and P8 really were in two different alleles by cloning the PCR HEK293T cells were cultured in Dulbecco’s modified eagle medium (DMEM) (no. 61965059, Gibco) supplemented with 10% fetal bovine serum (FBS) (Sigma-Aldrich). TCRa-deficient JR3.11 Jurkat cells and TCRab-deficient J76 Jurkat cells were cultured in RPMI (no. 61870044, Gibco) supplemented with 10% FBS (25). All cell lines were cultured at 37°C under an atmosphere containing 5% CO2. For transfection, HEK293T cells were plated at a density of 8×105 cells per well in six-well plates. PBMCs were isolated from whole-blood samples by Ficoll-Hypaque centrifugation (Amersham-Pharmacia-Biotech). y g Materna et al., Science 383, eadh4059 (2024) Data for biological triplicates of RNA-seq performed on sorted primary human thymic T cell subsets (Thy1/DN1, Thy2/DN2, Thy3/ DN3, ISP4/ISP, DP early, DP late, and singlepositive SP8 and SP4) were downloaded with the SRA toolkit and the fastq-dump v2.9.6 tool (BioProject dataset accession number: PRJNA741323) (16). The sequence reads were aligned with the human hg38 reference genome assembly with HISAT2 v2.2.1, using the -k 1 function (49). The principal pre-TCRa isoforms were detected with a combination of cufflinks v2.2.1 de novo transcript assembly (50) and the manual curation of transcript databases: Ensembl hg38 v96 and NCBI Refseq genes v110. Expression was estimated for five pre-TCRa isoforms, along with the full gene list in Ensembl v96, with kallisto v0.46.1, for each sample (51). Estimated normalized isoform expression, expressed in transcripts per million (TPM), was used to compare expression levels across thymocyte developmental stages and to calculate the abundance of isoform A relative to the other isoforms. The aligned reads were converted to BAM format with samtools v1.14 and the triplicates were combined with the merge function and loaded onto the Integrated Genome Viewer for figure preparation (52, 53). Cell culture y Exome and genome analyses performed at Centogene up to 21 April 2023 were analyzed (Centogene started exome and genome sequencing in 2014 and 2016, respectively). Only variants with a base coverage ≥10, read frequency ≥30, and variant quality ≥220 (only for exome sequencing) were retained for further analyses. We then selected all related genetic information for the variants NM_138296.3:c.152A>C [PTCRA p.(Asp51Ala)] and NM_138296.3: c.227A>G [PTCRA p.(Tyr76Cys)]. We extracted information concerning the patient’s year of birth, sex, country of origin, family relationship, reported genetic test results of ES/GS-tested individuals, and HPO-encoded clinical information from our database when available. All the available deidentified data were aggregated at individual level. We calculated p.(Asp51Ala) allele frequencies and their binomial CIs by country and geographic region. For the phenotypic analysis, we stratified the cohort by PTCRA p.(Asp51Ala) genotype [homozygotes (HOM), heterozygotes (HET), and WT] and counted the number of occurrences per individual of any HPO term from a predefined list of 24 autoimmunityrelated terms (table S5). We analyzed the difference in the proportions of individuals with a matching autoimmune-related phenotype (having at least one of 24 predefined HPO terms) by PTCRA p.(Asp51Ala) genotype. We tested the hypothesis of an association between the individual’s PTCRA p.(Asp51Ala) genotype and RNA-seq analysis of sorted human thymocyte subsets amplicons from the gDNA of these patients with the TOPO TA cloning kit (Thermo Fisher Scientific) and using them for the one-shot transformation of TOP10 chemically competent Escherichia coli cells (Thermo Fisher Scientific). PCR with the M13 primers supplied with the TA cloning kit was performed on individual colonies before sequencing. g Analysis of the Centogene Biodatabank the presence of an autoimmune-related phenotype by enrichment analysis. Briefly, we calculated the OR of having a positive match to the autoimmunity-related HPO terms from the predefined list, comparing all PTCRA p.(Asp51Ala) genotype groups in Fisher’s exact test. Statistical analyses and figures were produced with RStudio (version 2023.03.1 Build 446, Posit Software, rstudio.com), using R Statistical Software (version 4.3.0, R Core Team 2023, R-project.org) and the tidyverse package (version 2.0.0, Posit Software, tidyverse.org). p equivalent exome files for n = 454,713 individuals (field 23155, with genotypes set to missing when read depth was <7 for single-nucleotide variations). For the UK Biobank cohort, the participants were aged 50 to 87 years as of 2021, and 55% were female. We further restricted our analysis to participants with South Asian ancestry, using field 21000. We considered a participant to be of South Asian ancestry if they had one of the following data codes for field 21000: 3001 (Indian), 3002 (Pakistani), 3 (Asian or Asian British), 3003 (Bangladeshi), or 3004 (any other Asian background). ICD10 codes and associated dates were collected from inpatient data (category 2000), cancer registries (category 100092) and first occurrences (category 1712), defined as the earliest occurrences of ICDs in the general practice, inpatient and death data, at three-digit resolution. The ICD10 codes used for autoimmune diseases were as follows: E03 (hypothyroidism), E10 (type 1 diabetes), M35 (Sjogren’s disease), G73.7 (Addison’s disease), K90.0 (celiac disease), M33 (dermatomyositis), M34 (systemic sclerosis), E05.0 (Graves’ disease), G35 (multiple sclerosis), M06 (rheumatoid arthritis), G70 (myasthenia gravis), D51.0 (pernicious anemia), M32 (systemic lupus erythematosus), D69.6 (autoimmune cytopenia), L80 (vitiligo), and L40 (psoriasis).
RES EARCH | R E S E A R C H A R T I C L E (no. 6365787001, Roche), in accordance with the manufacturer’s instructions. Choice of TCRa, TCRb, TCRg, and TCRd1 cDNA sequences Intracellular cytokine staining Intracellular cytokine staining (ICS) was performed as previously described (57). Briefly, PBMCs were thawed in cRPMI (1X RPMI 14 of 18 , Transduced JR3.11 Jurkat cells and J76 Jurkat cells were stained with antibodies against CD271 (no. 557196, BD, 1:500), CD3 (no. 555333, BD, 2:50), C1b TCR (no. 565776, BD, 2:50), or CD69 (no. 310912, Biolegend, 1:400) and incubated with the Aqua Live/Dead Cell Stain Kit (Thermo Fisher Scientific) for 1 hour at room temperature before analysis with a Gallios (Beckman Coulter) flow cytometer. All data were analyzed with FlowJo 10.5.3 software. y 1 March 2024 Flow cytometry analysis of JR3.11 Jurkat cells and J76 Jurkat cells y g The exon-trapping primers were designed to retain the translation frame of the Myc/DDK tag from the pCMV6 plasmid (Fig. 2A). The end of exon 2 was, therefore, fused to a Myc/ DDK tag for detection of the artificial fusion protein. Total protein was extracted from HEK293T cells after 24 hours of transfection with the WT, c.58G>C or c.58+5G>A exon-trapping vectors. We assessed the expression of PTCRA variants by extracting total protein from HEK293T cells 48 hours after transfection with the various pCMV6 plasmids encoding the PTCRA variants. Total protein extracts were obtained by incubating cells with lysis buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 2 mM EDTA, and 0.5% Triton X-100). A mixture of protease and phosphatase inhibitors was added to the buffers: aprotinin (10 mg/ml; Sigma-Aldrich), PMSF (1 mM; SigmaAldrich), leupeptin (10 mg/ml; Sigma-Aldrich), protease inhibitor cocktail (Sigma-Aldrich). After 30 min of lysis at 4°C, the cells were centrifuged for 10 min at 16,000g, and the supernatant was collected for immunoblotting. For each variant, we separated 20 mg of total protein by SDSPAGE and immunoblotting was performed with antibodies against the DDK Tag (1:3000, HRP-coupled, M2, no. A8592, Sigma-Aldrich), The lentiviruses used for the transduction of TCRa-deficient JR3.11 Jurkat cells and TCRabdeficient J76 Jurkat cells were produced by transfecting HEK293T cells with pCMV-VSVG (0.2 mg) (56), pHXB2 env (0.2 mg; NIH-AIDS Reagent Program; no. 1069), psPAX2 (1 mg; gift from D. Trono; Addgene plasmid no. 12260) and a vector containing the sequence for transduction. The vectors containing the sequences for transduction were pTrip-SFFV-DNGFR (empty vector), pTrip-SFFV-GFP (empty vector), pTrip-SFFV-DNGFR-PTCRA-WT, the other pTripSFFV-DNGFR vectors containing the PTCRA variants studied, pTrip-SFFV-DNGFR-TCRa, pTrip-SFFV-DNGFR-TCRd, pTrip-SFFV-DNGFRTCRg, pTrip-SFFV-DNGFR-TCRgd, and the pTrip-SFFV-GFP-TCRb vectors. HEK293T cells were transfected in six-well plates and the medium was replaced after 6 hours of incubation. The virus-containing supernatant was collected and passed through a 0.2-mm filter 24 hours after the medium was changed. Protamine sulfate (8 mg/ml) was added to the virus-containing supernatant, which was then added to Jurkat cells (immediately after seeding), which were spinoculated for 2 hours at 1200g and 25°C. The cells were then cultured for 48 hours at 37°C under an atmosphere containing 5% CO2, without shaking. Transduction efficiency was then checked by flow cytometry with the green fluorescent protein (GFP) tag or an anti-CD271 antibody (no. 557196, BD, 1:500). Transduced cells were sorted with a magnetic MACS Column and the CD271 MicroBead Kit (no. 130-099023, Miltenyi Biotec), as recommended by the manufacturer. y Cell lysis and immunoblotting We cloned PTCRA gDNA from a control, as described in Fig. 2A. The inserted PTCRA gDNA sequence, extending from the 5′UTR to the end of exon 2, is represented in blue (exons) and gray (intron 1). Briefly, PTCRA gDNA containing exon 1 and the first 909 nucleotides of intron 1 was amplified with CloneAmp Hifi premix (Takara), the forward primer 5′- GAGATCTGCCGCCGCGTAGAAGGCAGTCTTGTGGGTGC-3′, and the reverse primer 5′AAGGAACTCAGTTCCTCCAGGACTCAACCTCCAGA-3′. Similarly, PTCRA gDNA containing the last 724 nucleotides of intron 1 and exon 2 was amplified with the forward primer 5′GGAACTGAGTTCCTTGAGAGCAGGGACAATGACTTAC-3′ and the reverse primer 5′-CTCGAGCGGCCGCGTACGCGTTGACAGATGCATGGGCTGTGTAC-3′. The Infusion Cloning kit (Clontech) was used to insert both PCR products between the ASIS1 and Mlu1 cloning sites of the pCMV6 entry vector (Origene) by homologous recombination. The c.58+G>C or c.58 +5G>A mutation was generated by mutagenesis. We extracted mRNA from HEK293T cells after 24 hours of transfection with the WT, c.58G>C or c.58+5G>A exon-trapping vectors. Materna et al., Science 383, eadh4059 (2024) Total RNA was extracted from the indicated cells with the RNeasy Extraction Kit (Qiagen). RNA was reverse-transcribed with the SuperScript II reverse transcriptase (Thermo Fisher Scientific) and oligo-dT primers (Thermo Fisher Scientific). We then performed qPCR with the Applied Biosystems Assays-on-Demand probes/ primers specific for PTCRA-FAM (Hs00300125_m1) on 100 ng cDNA. The data were normalized relative to the expression (DCt) of GUS (13-glucuronidaseVIC, 4326320E) and are expressed as 2–DCt values. Lentivirus production and transduction g Artificial gene and exon trapping for the c.58G>C and c.58+5G>A alleles mRNA purification and reverse transcription quantitative PCR (RT-qPCR) PTCRA (1:3000, PA5-95578, Invitrogen), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1:5000, FL335, no. sc47724 HRP, Santa Cruz Biotechnology) or vinculin (1:5000, EPR8185, no. ab129002, Abcam). Staining was detected with the Clarity Western ECL substrate (Biorad, no. 1705061) or SuperSignal West Femto (ThermoScientific, no. 34096) with ChemiDoc MP (Biorad). p The TCRa sequence was obtained from addgene plasmid no. 128544 (after removal of the intron). The choice of TCRb was based on a comparison of the TRB repertoire of naive ab cells from patients and controls. The TRBV2*01|TRBJ21*01, TRBV7-8*01|TRBJ2-1*01, TRBV5-4*01| TRBJ1-6*01, and TRBV7-8*01|TRBJ1-6*01 rearrangements were selected because they were found to be overused in patients’ cells. Conversely, the TRBV19*01|TRBJ1-5*01 and TRBV291*01|TRBJ1-1*01 rearrangements were selected because they were less frequently detected in the patients’ cells than in control cells. The TRBV123*01|TRBJ1-2*01 and TRBV18*01|TRBJ1-2*01 TCRb chains were selected because they are the chains expressed in the Jurkat and DN-D41 cell lines, respectively (54). These two cell lines were used as controls. It has been suggested that DND41 expresses the TCRd1/TCRb heterodimer at the cell surface (36). The full-length TCRd1, TCRg, and TCRb sequences were assembled with stitchR software (55). The TCRg sequence used was the example data provided by stitchR. The CDR3 of the TCRd1 and TCRb sequences were randomly picked from the most frequent ab or gd T cell clones of the patients with the V-J of interest according to our TCR bulk sequencing data. The full sequences of all the TCRs used in this study are provided in the supplementary materials. The cDNA for the PTCRA transcript was amplified with a recombinant Taq polymerase (Thermo Fisher Scientific), a forward primer 5′-TAGAAGGCAGTCTTGTGGGTGC-3′ binding to the 5′UTR of PTCRA, and a reverse primer 5′-CATTTGCTGCCAGATCCTCTT-3′ binding to the in-frame C-terminal Myc/DDK tag. The PCR products were then cloned with the TOPO TA cloning kit (Thermo Fisher Scientific) and used for the one-shot transformation of TOP10 chemically competent E. coli cells (Thermo Fisher Scientific). Splice variants of PTCRA from individual colonies were amplified with the M13 primers supplied with the TA cloning kit before sequencing and alignment with the PTCRA cDNA (NM_138296.2), with SnapGene software used to identify alternative splicing variants. We screened 82 colonies for the WT PTCRA exontrapping vector, 65 for the c.58G>C PTCRA exontrapping vector, and 83 for the c.58+5G>A PTCRA exon-trapping vector.
RES EARCH | R E S E A R C H A R T I C L E 1640 supplemented with 10% heat-inactivated FBS, 1% L-glutamine and 1% Pen-Strep) and centrifuged before being resuspended at a concentration of 2×106 cells/ml in cRPMI. Cell pellets were resuspended in surface antibody cocktail (table S10) and incubated for 20 min. Cells were then permeabilized with permeabilization reagent (Invitrogen) and incubated for 20 min followed by a wash with PERM buffer. Cell suspensions were centrifuged, and the pellets stained with intracellular antibody cocktail (table S10) for 60 min. Finally, cells were washed with PERM buffer before being resuspended in 1.6% paraformaldehyde (PFA) to fix. The fixed cells were stored overnight at 4°C and analyzed on Aurora Spectral flow cytometer (Cytek). Mass cytometry (CyTOF) The blocking activity of anti–IFN-a, anti–IFN-b, and anti–IFN-w autoantibodies was assessed in a luciferase reporter assay, as described elsewhere (58). Protein array for assessing autoantibodies Protein arrays (HuProt v4.0 from CDI laboratories) for assessing autoantibodies were performed as previously described (24). Single-cell RNA-seq (5′ transcriptomics, ab and gd TCR) Antibody profiling by phage immunoprecipitation sequencing (PhIP-Seq) was performed on plasma samples from patients and controls as previously described (60). In vitro T cell differentiation in the ATO system In vitro T cell differentiation was studied by coculturing peripheral blood CD34+ cells with 15 of 18 , VirScan—phage immunoprecipitation sequencing y We processed 10x single-cell transcriptome libraries with Cellranger (v6.1.1) and Seurat (v4.0.4). The TCRab and TCRgd libraries were demultiplexed and cell barcodes were assigned with Minnn (v10.1). TCR libraries were annotated with MiXCR (v3.0.13) and then separated by subject. The numbers of ab or gd TCRs for the patients and controls were calculated by counting the numbers of cells expressing both TRA and TRB V-J genes and both TRG and TRD V-J genes. The final counts corresponded to the intersection of cells expressing combinations of TRA, TRB, TRG or TRD genes, accounting for 10,365, 21,755, 2233, and 1440 cells, respectively, for the controls (n = 11) and 5963, 11,416, 2095, and 529 cells, respectively, for the patients (n = 5). The diversity of a, b, g, and d TCRs was estimated by calculating Shannon’s entropy (H) index. Entropy was calculated by summing the frequencies of each clone (CDR3 amino acid sequence) and multiplying by the base 2 logarithm of the same frequency over all cells expressing TRA, TRB, TRG or TRD V-J genes. Higher H-index values indicate a more diverse distribution of CDR3 clones (59). y g 1 March 2024 Evaluation of TCR entropy and TCR chain combinations in single-cell RNA-seq data y CD3+ T cells were sorted by flow cytometry from the PBMCs of P1, P2 (two independent samples analyzed, collected at the ages of 12 and 18 months), P3, P4, and healthy controls matched for age. Cryopreserved PBMCs in R10 medium (RPMI 1640, 10% FBS, 2 mM L-glutamine, 100 U/ml of penicillin, and 100 mg/ml of streptomycin) were thawed and immediately centrifuged to obtain a cell pellet. The cells were then incubated for 15 min at 37°C in an incubator containing 5% CO2 in the presence of Benzonase (Millipore Sigma, cat. 70664) diluted 1:1000 in R10 medium. The cells were then washed once in R10 and once in fluorescenceactivated cell sorting (FACS) buffer (2% FBS in PBS). For staining, cells were resuspended in 50 ml of a mixture of LIVE/DEAD Fixable Blue Dead Cell Stain (cat. L34962) diluted 1:200 in PBS and anti-CCR7 APC-Cy7 antibody (Biolegend, cat. 353212) and incubated for 10 min at 37°C in an incubator containing 5% CO2. Cells were then labeled with 1 ml of oligonucleotide-linked hashing antibody (Totalseq-C, Biolegend) and stained by incubation with 50 ml of antibody cocktail diluted in Brilliant Stain Buffer (BD Biosciences, cat. 566349) for 20 min at room temperature. The antibody cocktail contained the following antibodies: anti-CD14 BV510 (Biolegend, cat. 301842), anti-CD19 BV510 (Biolegend, cat. 302242), anti-CD56 BV510 (Biolegend, cat. 362534), anti-CD8 BV785 (Biolegend, cat. 301046), antiCD4 PECy7 (Biolegend, cat. 300512), anti-CD95 AlexaFluor 700 (Biolegend, cat. 305648), antiPD-1 BV750 (Biolegend, cat. 329966), anti-CD69 FITC (Biolegend, cat. 310904), anti-CD40L BV421 (Biolegend, cat. 310824), anti-CD3 BUV805 (BD Biosciences, cat. 741999), anti-CD45RA PECF594 (BD Biosciences, cat. 562298), anti-CD25 BUV661 (BD Biosciences, cat. 741685), anti-CXCR3 BV711 (BD Biosciences, cat. 563156), anti-HLA-DR PECy5.5 (Invitrogen, cat. MHLDR18), and anti-CXCR5 APC (Invitrogen, cat. 17-9185-42). The cells were washed twice with FACS buffer and resuspended in R10 for sorting. We sorted 12,000 T cells (CD3+CD14−CD19−CD56−Live/Dead−) from each sample with a BD FACSymphony S6 Cell Sorter instrument (BD Biosciences) running BD g Materna et al., Science 383, eadh4059 (2024) Luciferase reporter assays for autoantibodies against IFNs FACSDiva Software version 9.5.1 (BD Biosciences). Sorted cells were pooled four by four, and each pool was loaded in a different lane of the 10x Genomics Chromium Chip for sequencing. For the sequencing of single-cell V(D)J repertoires for sorted T cells, the cell suspension was loaded on the 10x Genomics Chromium Instrument according to the manufacturer’s protocol for the Next GEM Single-Cell 5′ Kit v1.1 (10x Genomics PN-1000165) to generate gel bead-in-emulsions and for GEM-RT and the amplification of total cDNA. After purification with SPRIselect beads (Beckman Coulter), specific TCR targets were amplified from the cDNA with the PTCR1 primer (5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′) and constant region primers: TRB (5′TGCTTCTGATGGCTCAAACACAGCGACCT-3′), TRA (5′-TCTCAGCTGGTACACGGCAGGGTCAGGGT3′), TRG (5′-GAAGGAAGAAAAATAGTGGGCTTGGGGGAAAC-3′), or TRD (5′-CACCAGACAAGCGACATTTGTTCC-3′) with a barcode and the P7 sequence added to the constant region primers. The Illumina-ready libraries were sequenced by paired-end MiSeq with 2×300 base pair reads to obtain VDJ sequences. p CyTOF was performed with various strategies. One involved the use of whole blood in the Maxpar Direct Immune Profiling Assay, 30 Markers (Standard Biotools, ref: 201334), according to the manufacturer’s instructions. All the samples for whole-blood staining were processed within 24 hours of collection. P10, P12, and P13 were phenotyped by the same protocol but with a customized antibody panel (table S11). We investigated the T cell subsets, including IEL markers, with another CyTOF staining panel for cryopreserved samples (IEL panel, table S12). PBMCs were thawed and 4×106 cells were immediately stained according to the Standard Biotools protocol. The antibodies against TCR Vd1 and TCR Vd2 were added after 10 min of staining with the other antibodies to prevent interference with the binding of the TCRgd antibody. For both whole blood and IEL panels, cells were frozen at −80°C after iridium staining and stored at the same temperature until acquisition on a Helios machine (Standard Biotools). In addition to whole-blood immunophenotyping, we also performed immunophenotyping on cryopreserved PBMCs for some patients (table S13). Single-cell suspensions were centrifuged to obtain a cell pellet, which was then incubated with 20 mM lanthanum-139 (Trace Sciences)–loaded maleimido-mono-amineDOTA (Macrocyclics) in PBS for 10 min at room temperature for live-dead discrimination (LD). Cells were washed in staining buffer and resuspended in surface antibody cocktail, incubated for 30 min at room temperature, washed twice in staining buffer, fixed, permeabilized with the FoxP3 staining buffer set (eBioscience), and subjected to intracellular staining for 60 min at room temperature. Cells were washed twice and then fixed by overnight incubation in 1.6% PFA (Electron Microscopy Sciences) solution supplemented with 125 nM iridium at 4°C. Before data acquisition on a CyTOF Helios flow cytometer (Standard Biotools), cells were washed twice in PBS and once in dH2O. Custom conjugation to isotope-loaded polymers was performed with the MAXPAR kit (Stan- dard Biotools). The data were analyzed with OMIQ software.
RES EARCH | R E S E A R C H A R T I C L E TREC levels Statistics Analyses were performed with GraphPad Prism V10.1.1 software. Two-tailed Mann–Whitney tests or unpaired t tests were used for single comparisons of independent groups. In the corresponding figures, n.s. indicates not significant, ****P < 0.0001, ***P < 0.001, **P < 0.01, and *P < 0.05. REFERENCES AND NOTES 1. M. A. Yui, E. V. Rothenberg, Developmental gene networks: A triathlon on the course to T cell identity. Nat. Rev. Immunol. 14, 529–545 (2014). doi: 10.1038/nri3702; pmid: 25060579 2. J. P. Rast et al., a, b, g, and d T cell antigen receptor genes arose early in vertebrate phylogeny. Immunity 6, 1–11 (1997). doi: 10.1016/S1074-7613(00)80237-X; pmid: 9052832 16 of 18 , sjTRECs were quantified by nested qPCR, with the primers and standard curve plasmid described by Dion et al. (64). The qPCR protocol was adapted as previously described (65) using ~500 ng of purified gDNA for each quantification. y 1 March 2024 T cell clones were obtained bIting naive T cells (CD3+CD45RA+CCR7+TCRab+TCRgd−) with a BD FACSAria III SORP cell sorter (Becton Dickinson, San Jose, CA) and DIVA 9.1 software. Cells were sorted, one cell per well, in 96-well plates containing 50 ml of ImmunoCult-XF T Cell Expansion Medium (StemCell Technologies, REF no. 10981) supplemented with IL-2 (1 ng/ml) and ImmunoCult Human CD3/ CD28/CD2 T cell Activator (StemCell Technologies, REF no. 10990,1:40) per well. Every 2 days, fresh medium with IL-2 (1 ng/ml) was added to the cells. Clones were visible under a microscope 1 week after sorting. Clones were reactivated every 3 weeks with ImmunoCult Human CD3/CD28/CD2 T cell Activator (StemCell Technologies, no. 10990,1:80). DNA was extracted from clones with the DNeasy Blood & Tissue Kit (no. 69504 ; Qiagen). The TRG gene repertoire was investigated by next-generation sequencing (NGS). For library preparation, PCR was performed on 100 ng of genomic DNA with a published protocol (63), but with adaptation of the primers for a NGS version of the assay (table S16). Dual barcoding of the primers made the simultaneous multiplexing of samples possible. After library purification, sequencing was performed on an Illumina MiSeq platform. Sequencing data analysis, including demultiplexing, quality control and clonotype assignment, was performed with the Vidjil pipeline (https://www.vidjil.org). IMGT V-QUEST (https://www.imgt.org/IMGT_vquest/analysis) was used for further TRGV and TRGJ annotation and for CDR3 characterization. y g Materna et al., Science 383, eadh4059 (2024) PBMCs were stained with antibodies against CD3 (no. 565491, BD, 1:50), CD45RA (no. 130-092247, Miltenyi Biotec, 2:50), CCR7 (no. 130-120600, Miltenyi Biotec, 2:50), TCRgd (no. 331218, Biolegend, 1:50), or TCRab (no. 555548, BD, 2:50) and incubated with the Aqua Live/Dead Cell Stain Kit (Thermo Fisher Scientific) for 30 min at room temperatINaive and memory ab and gd T cells were sorted with a FACSAria cell sorter (Becton Dickinson, San Jose, CA) on the basis of CD45RA and CCR7 expression. DNA extraction was performed with the DNeasy Blood & Tissue Kit (no. 69504; Qiagen). The rearranged TRAD, TRB, and TRG genomic loci were sequenced by Adaptive Biotechnologies (Seattle, WA) as a commercial service. The data were then analyzed with ImmunoSeq online tools (Adaptive Biotechnologies) and custom R scripts. The frequencies of productive and nonproductive TRD, TRG, TRB, and TRA rearrangements were analyzed for both unique and total TRD, TRG, TRB, or TRA sequences obtained from the sorted ab and gd T cell subsets. The frequency distributions for individual clonotypes (including TRBV-toTRBJ pairing and TRAV-to-TRAJ pairing) were analyzed within unique sequences. Diversity indices were calculated and heat-map representations of the frequencies of individual TRAV/TRDV to TRAJ/TRD gene pairs and TRBV-to-TRBJ gene pairs were produced with R software version 4.2.0 (2022-04-22 ucrt) and HTS of the human TRG locus from the gDNA of clonally expanded T cells y Mice were bred under specific pathogen-free conditions in CIPHE animal facilities (agreement number: B1301407) and handled in accordance with institutional committee and European guidelines for animal care. C57BL/6 mice were purchased from Janvier Laboratories. Ptcratm1(icre)Hjf KO mice have been described elsewhere (62) and were rederived from the INFRAFRONTIER/EMMA archive (EM:08347). Multiparametric immunophenotyping was performed at the CIPHE-PHENOMIN (INSERM, US012) flow cytometry facility. Peripheral blood (PB) was collected by submandibular puncture into Microvette 500 K3 EDTA tubes (Sarstedt). Hematological analysis was performed on a Procyte Dx (IDDEX) machine, in accordance with the manufacturer’s recommendations. Peripheral blood leukocytes were analyzed with a Lyse No Wash protocol and 1X FACS Lysing Solution (BD Biosciences). Leukocytes from the spleen and thymus were extracted according to the protocol of the International Mouse Phenotyping Consortium (IMPC_IMM_002). Red blood cells were not lysed for thymic leukocyte preparations. LN T cells were isolated from pooled inguinal, brachial, axillary, and submandibular LNs. Briefly, organs were disrupted with the OctoGentleMACS system (Miltenyi Biotec), using 600 Mandl units of collagenase D (Roche Life Science) and 30 mg of DNAse I (Sigma), for High-throughput sequencing (HTS) of the human TCR repertoire from the gDNA of sorted I and memory T cells the R packages Tidyverse (1.3.2) and Immunarch (0.6.9). g Mouse experiments 20 min at room temperature. The cell suspension was filtered, and the cells were counted. Red blood cells were lysed by incubation for 1 min at room temperature with ammoniumchloride-potassium (ACK) lysis solution (eBioscience). Before staining, the cells were incubated for 10 min on ice with an anti-CD16/32 (2.4G2) antibody to block Fc receptors. In all experiments, 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen) staining was used to exclude dead cells from the analysis. Multiparameter FACS acquisition was performed on a Fortessa LSRII SORP or Canto 10C system (BD Biosciences). The analysis was performed with FACSDiva 9.01 (BD Biosciences) software. Doublets were systematically excluded on the basis of side scatter (SSC) and forward scatter (FSC) parameters. The antibodies used for immunophenotyping are listed in table S15. The thymocyte subsets were defined as ETP (CD4−CD8a−CD3e−CD44+CD25−ckit+), TN2 (CD4−CD8a−CD3e−CD44+CD25+ckit+), TN3 (CD4−CD8a−CD3e−CD44−CD25+gd−), TN4 (CD4− CD8a−CD3e−CD44−CD25−gd−), ISP (CD4−CD8a+ CD3e−CD44−CD25−gd−), iDP (CD4+CD8a+CD3e− CD44−CD25−gd−), mDP (CD4+CD8a+CD3e+ CD44−CD25−gd−), SP4 (CD4+CD8a−CD3e+CD44− gd−), SP8 (CD4−CD8a+CD3e+CD44−gd−), gd TN3 (CD3e+CD25+gd+), or gd (CD3e+CD25−gd+). p a DLL4-expressing stromal cell line (MS5-hDLL4) in the ATO system, as previously described (61), but with minor modifications. Briefly, CD34+ peripheral blood cells from five normal donors, three patients with partial pre-TCRa deficiency (P11 to P13), and three patients with complete pre-TCRa deficiency (P1, P5, and P6) were positively selected with the CD34 MicroBead UltraPure kit (Miltenyi Biotec) on an AutoMACS Pro Separator. We mixed 1000 to 1500 CD34+ cells with 150,000 MS5-hDLL4 cells per ATO. Each ATO (5 ml) was then plated in a 0.4 mM Millicell Transwell insert and placed in one well of a six-well plate in 1 ml complete RB27 medium supplemented with rhIL-7 (5 ng/ml), rhFlt3-L (5 ng/ml), and 30 mM L-ascorbic acid 2-phosphate sesquimagnesium salt hydrate. Each insert contained a maximum of two ATOs. For the first 3 weeks of culture, the medium was also supplemented with 10 ng/ml of rhSCF. After 5 weeks in culture, MACS buffer (PBS supplemented with 0.5% BSA and 2 mM EDTA) was added to each well and ATOs were dissociated by manual pipetting. The cells were then collected into a pellet by centrifugation, resuspended in FACS buffer (2% FBS in PBS), counted, and stained with the antibody cocktail described in table S14. Events were acquired on a BD LSR II Fortessa flow cytometer (BD Biosciences, San Jose, CA) and analyzed with FlowJo software version 10.6.1 (FlowJo, LLC, Ashland, OR).
RES EARCH | R E S E A R C H A R T I C L E y g y , 17 of 18 y 1 March 2024 44. C. Bycroft et al., The UK Biobank resource with deep phenotyping and genomic data. Nature 562, 203–209 (2018). doi: 10.1038/s41586-018-0579-z; pmid: 30305743 45. T. Khan et al., Human leukocyte antigen class II gene diversity tunes antibody repertoires to common pathogens. Front. Immunol. 13, 856497 (2022). doi: 10.3389/ fimmu.2022.856497; pmid: 36003377 46. P. Hebbar et al., Genome-wide landscape establishes novel association signals for metabolic traits in the Arab population. Hum. Genet. 140, 505–528 (2021). doi: 10.1007/ s00439-020-02222-7; pmid: 32902719 47. E. Genin, A. Tullio-Pelet, F. Begeot, S. Lyonnet, L. Abel, Estimating the age of rare disease mutations: The example of Triple-A syndrome. J. Med. Genet. 41, 445–449 (2004). doi: 10.1136/jmg.2003.017962; pmid: 15173230 48. R. J. Wang, S. I. Al-Saffar, J. Rogers, M. W. Hahn, Human generation times across the past 250,000 years. Sci. Adv. 9, eabm7047 (2023). doi: 10.1126/sciadv.abm7047; pmid: 36608127 49. D. Kim, J. M. Paggi, C. Park, C. Bennett, S. L. Salzberg, Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat. Biotechnol. 37, 907–915 (2019). doi: 10.1038/s41587-019-0201-4; pmid: 31375807 50. C. Trapnell et al., Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat. Protoc. 7, 562–578 (2012). doi: 10.1038/nprot.2012.016; pmid: 22383036 51. N. L. Bray, H. Pimentel, P. Melsted, L. Pachter, Near-optimal probabilistic RNA-seq quantification. Nat. Biotechnol. 34, 525–527 (2016). doi: 10.1038/nbt.3519; pmid: 27043002 52. P. Danecek et al., Twelve years of SAMtools and BCFtools. Gigascience 10, giab008 (2021). doi: 10.1093/gigascience/ giab008; pmid: 33590861 53. H. Thorvaldsdóttir, J. T. Robinson, J. P. Mesirov, Integrative Genomics Viewer (IGV): High-performance genomics data visualization and exploration. Brief. Bioinform. 14, 178–192 (2013). doi: 10.1093/bib/bbs017; pmid: 22517427 54. K.-T. Tan et al., Profiling the B/T cell receptor repertoire of lymphocyte derived cell lines. BMC Cancer 18, 940 (2018). doi: 10.1186/s12885-018-4840-5; pmid: 30285677 55. J. M. Heather et al., Stitchr: Stitching coding TCR nucleotide sequences from V/J/CDR3 information. Nucleic Acids Res. 50, e68 (2022). doi: 10.1093/nar/gkac190; pmid: 35325179 56. S. A. Stewart et al., Lentivirus-delivered stable gene silencing by RNAi in primary cells. RNA 9, 493–501 (2003). doi: 10.1261/ rna.2192803; pmid: 12649500 57. P. E. Conrey et al., IgA deficiency destabilizes homeostasis toward intestinal microbes and increases systemic immune dysregulation. Sci. Immunol. 8, eade2335 (2023). doi: 10.1126/ sciimmunol.ade2335; pmid: 37235682 58. P. Bastard et al., Autoantibodies neutralizing type I IFNs are present in ~4% of uninfected individuals over 70 years old and account for ~20% of COVID-19 deaths. Sci. Immunol. 6, eabl4340 (2021). doi: 10.1126/sciimmunol.abl4340; pmid: 34413139 59. C. E. Shannon, The mathematical theory of communication. 1963. MD Comput. 14, 306–317 (1997). pmid: 9230594 60. V. Béziat et al., Humans with inherited T cell CD28 deficiency are susceptible to skin papillomaviruses but are otherwise healthy. Cell 184, 3812–3828.e30 (2021). doi: 10.1016/ j.cell.2021.06.004; pmid: 34214472 61. C. S. Seet et al., Generation of mature T cells from human hematopoietic stem and progenitor cells in artificial thymic organoids. Nat. Methods 14, 521–530 (2017). doi: 10.1038/ nmeth.4237; pmid: 28369043 62. H. Luche et al., In vivo fate mapping identifies pre-TCRa expression as an intra- and extrathymic, but not prethymic, marker of T lymphopoiesis. J. Exp. Med. 210, 699–714 (2013). doi: 10.1084/jem.20122609; pmid: 23509324 63. M. Armand et al., A New and Simple TRG Multiplex PCR Assay for Assessment of T-cell Clonality: A Comparative Study from the EuroClonality Consortium. HemaSphere 3, e255 (2019). doi: 10.1097/HS9.0000000000000255; pmid: 31723840 64. M.-L. Dion, R.-P. Sékaly, R. Cheynier, in Immunological Tolerance: Methods and Protocols, P. J. Fairchild, Ed., vol. 380 of Methods in Molecular Biology (Humana Press, 2007), pp. 197–213. doi: 10.1007/978-1-59745-395-0_12 65. H. M. Roux et al., Genetically determined thymic function affects strength and duration of immune response in COVID patients with pneumonia. Sci. Adv. 9, eadh7969 (2023). doi: 10.1126/sciadv.adh7969; pmid: 37738336 g Materna et al., Science 383, eadh4059 (2024) 24. T. Le Voyer et al., Autoantibodies against type I IFNs in humans with alternative NF-kB pathway deficiency. Nature 623, 803–813 (2023). doi: 10.1038/s41586-023-06717-x; pmid: 37938781 25. A. R. Ramiro et al., Differential developmental regulation and functional effects on pre-TCR surface expression of human pTaa and pTab spliced isoforms. J. Immunol. 167, 5106–5114 (2001). doi: 10.4049/jimmunol.167.9.5106; pmid: 11673521 26. J. Arnaud et al., The interchain disulfide bond between TCR alpha beta heterodimers on human T cells is not required for TCR-CD3 membrane expression and signal transduction. Int. Immunol. 9, 615–626 (1997). doi: 10.1093/intimm/ 9.4.615; pmid: 9138023 27. S. S. Pang et al., The structural basis for autonomous dimerization of the pre-T-cell antigen receptor. Nature 467, 844–848 (2010). doi: 10.1038/nature09448; pmid: 20944746 28. S. Yamasaki et al., Mechanistic basis of pre–T cell receptor– mediated autonomous signaling critical for thymocyte development. Nat. Immunol. 7, 67–75 (2006). doi: 10.1038/ ni1290; pmid: 16327787 29. E. Ishikawa, Y. Miyake, H. Hara, T. Saito, S. Yamasaki, Germ-line elimination of electric charge on pre–T-cell receptor (TCR) impairs autonomous signaling for b-selection and TCR repertoire formation. Proc. Natl. Acad. Sci. U.S.A. 107, 19979–19984 (2010). doi: 10.1073/pnas.1011228107; pmid: 21030681 30. J. Buer, I. Aifantis, J. P. DiSanto, H. J. Fehling, H. von Boehmer, T-cell development in the absence of the pre-T-cell receptor. Immunol. Lett. 57, 5–8 (1997). doi: 10.1016/S0165-2478(97) 00078-3; pmid: 9232417 31. K. Terrence, C. P. Pavlovich, E. O. Matechak, B. J. Fowlkes, Premature expression of T cell receptor (TCR)ab suppresses TCR gd gene rearrangement but permits development of gd lineage T cells. J. Exp. Med. 192, 537–548 (2000). doi: 10.1084/jem.192.4.537; pmid: 10952723 32. L. Bruno, H. J. Fehling, H. von Boehmer, The ab T cell receptor can replace the gd receptor in the development of gd lineage cells. Immunity 5, 343–352 (1996). doi: 10.1016/S1074-7613 (00)80260-5; pmid: 8885867 33. I. Aifantis et al., The Ed enhancer controls the generation of CD4−CD8− abTCR-expressing T cells that can give rise to different lineages of ab T cells. J. Exp. Med. 203, 1543–1550 (2006). doi: 10.1084/jem.20051711; pmid: 16754716 34. Z. M. Ndhlovu et al., Magnitude and Kinetics of CD8+ T Cell Activation during Hyperacute HIV Infection Impact Viral Set Point. Immunity 43, 591–604 (2015). doi: 10.1016/j. immuni.2015.08.012; pmid: 26362266 35. M. Bosticardo et al., Artificial thymic organoids represent a reliable tool to study T-cell differentiation in patients with severe T-cell lymphopenia. Blood Adv. 4, 2611–2616 (2020). doi: 10.1182/bloodadvances.2020001730; pmid: 32556283 36. F. Hochstenbach, M. B. Brenner, T-cell receptor d-chain can substitute for a to form a bd heterodimer. Nature 340, 562–565 (1989). doi: 10.1038/340562a0; pmid: 2528071 37. P. Del Porto, L. Bruno, M. G. Mattei, H. von Boehmer, C. Saint-Ruf, Cloning and comparative analysis of the human pre-T-cell receptor alpha-chain gene. Proc. Natl. Acad. Sci. U.S.A. 92, 12105–12109 (1995). doi: 10.1073/pnas.92.26.12105; pmid: 8618853 38. C. Saint-Ruf et al., Analysis and expression of a cloned pre-T cell receptor gene. Science 266, 1208–1212 (1994). doi: 10.1126/science.7973703; pmid: 7973703 39. P. Gros, J.-L. Casanova, Reconciling Mouse and Human Immunology at the Altar of Genetics. Annu. Rev. Immunol. 41, 39–71 (2023). doi: 10.1146/annurev-immunol-101721-065201; pmid: 36525691 40. K. Medetgul-Ernar, M. M. Davis, Standing on the shoulders of mice. Immunity 55, 1343–1353 (2022). doi: 10.1016/ j.immuni.2022.07.008; pmid: 35947979 41. S. J. C. Mancini et al., TCRA gene rearrangement in immature thymocytes in absence of CD3, pre-TCR, and TCR signaling. J. Immunol. 167, 4485–4493 (2001). doi: 10.4049/ jimmunol.167.8.4485; pmid: 11591775 42. C. Aude-Garcia, M. Gallagher, P. N. Marche, E. Jouvin-Marche, Preferential ADV-AJ association during recombination in the mouse T-cell receptor alpha/delta locus. Immunogenetics 52, 224–230 (2001). doi: 10.1007/s002510000266; pmid: 11220624 43. N. Pasqual et al., Quantitative and qualitative changes in V-J a rearrangements during mouse thymocytes differentiation: Implication for a limited T cell receptor a chain repertoire. J. Exp. Med. 196, 1163–1173 (2002). doi: 10.1084/jem.20021074; pmid: 12417627 p 3. M. S. Krangel, Mechanics of T cell receptor gene rearrangement. Curr. Opin. Immunol. 21, 133–139 (2009). doi: 10.1016/j.coi.2009.03.009; pmid: 19362456 4. T. Kreslavsky, M. Gleimer, H. von Boehmer, ab versus gd lineage choice at the first TCR-controlled checkpoint. Curr. Opin. Immunol. 22, 185–192 (2010). doi: 10.1016/ j.coi.2009.12.006; pmid: 20074925 5. M. Malissen et al., A T cell clone expresses two T cell receptor a genes but uses one ab heterodimer for allorecognition and self MHC-restricted antigen recognition. Cell 55, 49–59 (1988). doi: 10.1016/0092-8674(88)90008-6; pmid: 3262424 6. J. L. Casanova, P. Romero, C. Widmann, P. Kourilsky, J. L. Maryanski, T cell receptor genes in a series of class I major histocompatibility complex-restricted cytotoxic T lymphocyte clones specific for a Plasmodium berghei nonapeptide: Implications for T cell allelic exclusion and antigen-specific repertoire. J. Exp. Med. 174, 1371–1383 (1991). doi: 10.1084/jem.174.6.1371; pmid: 1836010 7. P. Borgulya, H. Kishi, Y. Uematsu, H. von Boehmer, Exclusion and inclusion of a and b T cell receptor alleles. Cell 69, 529–537 (1992). doi: 10.1016/0092-8674(92)90453-J; pmid: 1316241 8. B. L. Brady, N. C. Steinel, C. H. Bassing, Antigen receptor allelic exclusion: An update and reappraisal. J. Immunol. 185, 3801–3808 (2010). doi: 10.4049/jimmunol.1001158; pmid: 20858891 9. H. von Boehmer, F. Melchers, Checkpoints in lymphocyte development and autoimmune disease. Nat. Immunol. 11, 14–20 (2010). doi: 10.1038/ni.1794; pmid: 20016505 10. Y. Xing, K. A. Hogquist, T-cell tolerance: Central and peripheral. Cold Spring Harb. Perspect. Biol. 4, a006957 (2012). doi: 10.1101/cshperspect.a006957; pmid: 22661634 11. L. Klein, B. Kyewski, P. M. Allen, K. A. Hogquist, Positive and negative selection of the T cell repertoire: What thymocytes see (and don’t see). Nat. Rev. Immunol. 14, 377–391 (2014). doi: 10.1038/nri3667; pmid: 24830344 12. H. J. Fehling, A. Krotkova, C. Saint-Ruf, H. von Boehmer, Crucial role of the pre-T-cell receptor a gene in development of ab but not gd T cells. Nature 375, 795–798 (1995). doi: 10.1038/375795a0; pmid: 7596413 13. S. Mancini et al., TCR a-chain repertoire in pTa-deficient mice is diverse and developmentally regulated: Implications for preTCR functions and TCRA gene rearrangement. J. Immunol. 163, 6053–6059 (1999). doi: 10.4049/jimmunol.163.11.6053; pmid: 10570293 14. J. Buer, I. Aifantis, J. P. DiSanto, H. J. Fehling, H. von Boehmer, Role of different T cell receptors in the development of pre–T cells. J. Exp. Med. 185, 1541–1548 (1997). doi: 10.1084/ jem.185.9.1541; pmid: 9151891 15. C. Saint-Ruf, O. Lechner, J. Feinberg, H. von Boehmer, Genomic structure of the human pre-T cell receptor a chain and expression of two mRNA isoforms. Eur. J. Immunol. 28, 3824–3831 (1998). doi: 10.1002/(SICI)1521-4141(199811) 28:11<3824::AID-IMMU3824>3.0.CO;2-9; pmid: 9842925 16. V. Sun et al., The Metabolic Landscape of Thymic T Cell Development In Vivo and In Vitro. Front. Immunol. 12, 716661 (2021). doi: 10.3389/fimmu.2021.716661; pmid: 34394122 17. Z. Ren et al., ATAV: A comprehensive platform for populationscale genomic analyses. BMC Bioinformatics 22, 149 (2021). doi: 10.1186/s12859-021-04071-1; pmid: 33757430 18. E. M. Scott et al., Characterization of Greater Middle Eastern genetic variation for enhanced disease gene discovery. Nat. Genet. 48, 1071–1076 (2016). doi: 10.1038/ng.3592; pmid: 27428751 19. K. J. Karczewski et al., The mutational constraint spectrum quantified from variation in 141,456 humans. Nature 581, 434–443 (2020). doi: 10.1038/s41586-020-2308-7; pmid: 32461654 20. M. S. Anderson et al., Projection of an immunological self shadow within the thymus by the aire protein. Science 298, 1395–1401 (2002). doi: 10.1126/science.1075958; pmid: 12376594 21. J. E. Walter et al., Broad-spectrum antibodies against selfantigens and cytokines in RAG deficiency. J. Clin. Invest. 125, 4135–4148 (2015). doi: 10.1172/JCI80477; pmid: 26457731 22. J. M. Rosenberg et al., Neutralizing Anti-Cytokine Autoantibodies Against Interferon-a in Immunodysregulation Polyendocrinopathy Enteropathy X-Linked. Front. Immunol. 9, 544 (2018). doi: 10.3389/fimmu.2018.00544; pmid: 29651287 23. P. Bastard et al., Preexisting autoantibodies to type I IFNs underlie critical COVID-19 pneumonia in patients with APS-1. J. Exp. Med. 218, e20210554 (2021). doi: 10.1084/ jem.20210554; pmid: 33890986
RES EARCH | R E S E A R C H A R T I C L E 66. M. Materna et al., Data from: The immunopathological landscape of human pre-TCRa deficiency: From rare to common variants, Dryad (2024); https://doi.org/10.5061/ dryad.9zw3r22m8. 67. M. Materna et al., Data from: The immunopathological landscape of human pre-TCRa deficiency: From rare to common variants, Adaptive Biotechnologies (2024); https://doi.org/10.21417/ MM2024S. ACKN OW LEDG MEN TS M.At., F.A.A., C.D., A.P., J.M., T.L.V., P.B., L.B., M.D., N.Vl., P.P.C., E.J., M.Al., A.H., T.A.T., M.A.A., M.L.-V., F.R., E.H., J.R.R., M.L.T., J.R.K., H.R.-Z., M.C.-A., S.M.A., M.Maz., A.Co., I.M., L.A., B.M., F.A.-M., F.S.A., C.Be., F.D., D.C.D., R.C., D.L., N.L., N.M., T.Mo., M.Sh., R.S., S.E.H., H.L., L.D.N., J.-L.C., and V.B. Competing interests: I.M. received consultancy fees from Boehringer-Ingelheim and a research grant from CSL Behring, outside this work and paid to KU Leuven. S.H. declares that she was on the ad hoc advisory board for Horizon Therapeutics, without relation to this work. The other authors have no competing interests to declare. Data and materials availability: The materials and reagents used are commercially available and nonproprietary. All raw and processed data and biological materials, including immortalized cell lines from patients, are available from the corresponding author through a material transfer agreement with INSERM. The RNA-seq data for sorted primary human thymic T cell subsets have already been published in the BioProject repository under the accession number PRJNA741323 (16). Single-cell RNA-seq data are available in the MIAME compliant gene expression omnibus database (GEO: GSE243927). Raw data for the immunoblots and qPCR are available from Dryad (66). The entire TCR sequencing dataset is accessible through the Adaptive Biotechnologies website (67). License information: Copyright © 2024 the authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original US government works. https://www. science.org/about/science-licenses-journal-article-reuse. This research was funded in part by the French National Research Agency (ANR) (ANR-10-IAHU-01, ANR-10-LABX-62-IBEID, and ANR-21-CE150034) and the Horizon Europe Framework Programme (HORIZON) (01057100; UNDINE), cOAlition S organizations. This article is also subject to HHMI’s Open Access to Publications policy. HHMI lab heads have previously granted a nonexclusive CC BY 4.0 license to the public and a sublicensable license to HHMI in their research articles. Pursuant to those licenses, the Author Accepted Manuscript (AAM) of this article can be made freely available under a CC BY 4.0 license immediately upon publication. p g SUPPLEMENTARY MATERIALS science.org/doi/10.1126/science.adh4059 Supplementary Text Figs. S1 to S8 Tables S1 to S16 References (68–86) MDAR Reproducibility Checklist Data S1 y We thank the patients and their families for participating in the study. We thank the members of the HGID laboratory for providing excellent comments on the paper. We also wish to thank L. Hadjem from the CIPHE facility and the members of the CYPS mass cytometry core facility team (Pitié Salpêtrière Hospital) for providing outstanding technical assistance. We thank A. Liston, S. Humblet-Baron, and M. Willemsen (Laboratory of Adaptive Immunology, KU Leuven). We thank the National Facility for Autoimmunity and Serology Profiling at SciLifeLab for their excellent technical support with the protein microarray studies. We thank Qatar Genome and the Qatar Biobank (QBB) management and staff for allowing us to access and analyze QBB/QGP samples and data and the Integrated Genomics Services team of Sidra Medicine for generating and processing WGS data for QBB study participants. We also thank S. Elledge (Brigham and Women’s Hospital and Harvard Medical School) for providing the VirScan phage library used in this study. This research was performed with the UK Biobank resource under application no. 40436. Funding: This study was supported in part by a grant from the St. Giles Foundation; the Rockefeller University; Institut National de la Santé et de la Recherche Médicale (INSERM); Paris Cité University; the National Center for Research Resources; the National Center for Advancing Sciences of the National Institutes of Health (UL1TR001866); the French National Research Agency (ANR) under the “Investments for the Future” program (ANR-10-IAHU01); the Integrative Biology of Emerging Infectious Diseases Laboratory of Excellence (ANR-10-LABX-62-IBEID); ANR CARMIL2 (ANR-21-CE15-0034); the ANR-RHU program (ANR-21-RHUS08-COVIFERON); the HORIZON-HLTH-2021-DISEASE-04 program under grant agreement 01057100 (UNDINE); the French Foundation for Medical Research (EQU201903007798); ITMO Cancer of Aviesan and INCa within the framework of the 2021– 2030 Cancer Control Strategy (funds administered by Institut National de la Santé et de la Recherche Médicale); the Square Foundation; W. E. Ford, General Atlantic’s Chairman and Chief Executive Officer; G. Caillaux, General Atlantic’s Co-President, Managing Director and Head of business in EMEA, and the General Atlantic Foundation; the Qatar National Research Fund (PPM11220-150017); Sidra Medicine (SDR400048); the SCOR Corporate Foundation for Science; Institut National de la Santé et de la Recherche Médicale; and the University of Paris. Open Access funding was provided by Rockefeller University. D.L. was supported by a Fonds de Recherche du Québec – Santé Chercheur-Boursier Junior 1 award. T.L.V. and P.B. were supported by the BettencourtSchueller Foundation and the MD-PhD program of the Imagine Institute. A.H., T.A.T., and F.A.-M. are supported by institutional funding from the Kuwait Foundation for the Advancement of Sciences. M.Mo. is supported by the ANRS. P.B. was supported by the FRM (EA20170638020). The work by A.Ce., D.E., and N.L. was funded by grants from the Swedish Research Council (2021-03118) and the Göran Gustafsson Foundation (2141 and 2227) to N.L. L.D.N. is supported by the Division of Intramural Research, National Institute of Allergy and Infectious Diseases, NIH, Bethesda, MD, USA (grant ZIA AI001222). F.S. (11B5520N, fellow), V.S. (1804523N), I.M. (1805821N), and R.S. (1805518N, 1805523N, senior clinical investigator fellow) are supported by the Fonds Wetenschappelijk Onderzoek - Vlaanderen National Fund for Scientific Research (FWO). E.H. holds the Bank of Montreal Chair for Pediatric Immunology. F.A.Q. was supported by the Ibn Rushd Fellowship Award – King Abdullah University of Science and Technology and King Abdulaziz City for Science and Technology. D.E. was supported by Clas Groschinsky Memorial Foundation (M21116). This study was supported by the VIB Grand Challenge program (translational science initiative on PID, GC01-C01 for I.M. and R.S.). I.M. and R.S. are members of the European Reference Network for Rare Immunodeficiency, Autoinflammatory and Autoimmune Diseases (project ID no. 739543). I.M. is funded by the FWO Vlaanderen G0B5120N and by C16/18/007 KU Leuven and by the Jeffrey Modell Foundation and is a senior clinical investigator at FWO Vlaanderen. S.E.H. is supported by a K08AI135091 grant, the Burroughs Wellcome Fund, and the CHOP Research Institute. Author contributions: Conceptualization: S.E.H., H.L., L.D.N., J.-L.C., and V.B. Supervision: S.E.H., L.D.N., J.-L.C., and V.B. Writing – original draft: V.B. Funding acquisition: S.E.H., L.D.N., J.-L.C., and V.B. Resources: M.Mo., R.K., M.V., M.S.-S., S.J., L.B., F.A.Q., V.S., M.A.A., M.L.-V., F.R., J.R.K., M.Sa., S.N., M.To., N.Va., H.M., E.T., M.N., K.M., T.Mi., K.I., N.P., H.V.B., M.Sh., and R.S. Methodology, data curation, visualization, software, validation, formal analysis, investigation, and writing – review & editing: M.Mat., O.M.D., M.B., P.E.C., B.C.-D.M., C.Br., R.B., A.Ce., F.S., C.A.G., S.D., S.Sa., C.L.F., M.O., D.R., A.Gu., A.B., T.K., A.Ge., B.P., A.L.D.S., C.A.S., S.Sh., J.J.T.-T., F.P., K.A., J.S.C., N.S.L., D.E., R.L., Y.S., Submitted 1 March 2023; accepted 26 January 2024 10.1126/science.adh4059 y g y , Materna et al., Science 383, eadh4059 (2024) 1 March 2024 18 of 18
RES EARCH RESEARCH ARTICLE SUMMARY ◥ NEUROSCIENCE SynGAP regulates synaptic plasticity and cognition independently of its catalytic activity Yoichi Araki†, Kacey E. Rajkovich†, Elizabeth E. Gerber†, Timothy R. Gamache†, Richard C. Johnson, Thanh Hai N. Tran, Bian Liu, Qianwen Zhu, Ingie Hong, Alfredo Kirkwood, Richard Huganir* INTRODUCTION: Experience-dependent changes disability, characterized by intellectual disability, autistic-like features, and epilepsy. ▪ The list of author affiliations is available in the full article online. *Corresponding author. Email: rhuganir@jhmi.edu †These authors contributed equally to this work. Cite this article as Y. Araki et al., Science 383, eadk1291 (2024). DOI: 10.1126/science.adk1291 y g SynGAP in neuronal cultures and replaced it with wild-type and GAP mutant SynGAP and found that mutation of the GAP domain did not affect its ability to rescue LTP in neuronal cultures in vitro. We confirmed this in vivo using mice containing inactivating GAP mutations. These mice show normal viability, LTP, and behaviors that are deficient in the heterozygote Syngap1-knockout mice. We investigated how the structural properties of SynGAP’s GAP activity is not required for synaptic plasticity and several cognitive behaviors. These data do not suggest that GAP activity is unimportant, and further work with these mice is needed to understand the role of SynGAP GAP activity in brain function. Finally, these results are relevant for developing treatments for SYNGAP1-related intellectual disability. Our findings suggest that treatments that regulate Ras activity or its downstream signaling will not be sufficient as a therapy and that rescuing SYNGAP1 haploinsufficiency by increasing the expression of the normal allele will be a more effective therapeutic approach. y RESULTS: We knocked down endogenous CONCLUSION: These results indicate that g RATIONALE: SynGAP is one of the most abundant proteins at excitatory synapses, suggesting that it may play a structural role in the PSD in addition to its role in regulating Ras activity. SynGAP was recently found to have unique structural properties and to undergo liquid-liquid phase separation (LLPS) with PSD95. Dispersion of SynGAP from the synapse during LTP induction would be predicted to free up PSD95-binding sites, allowing other PSD95-binding proteins to dynamically change the composition of the synapse. To differentiate the role of GAP activity from its structural properties, we examined the function of SynGAP with mutations that inactivate GAP activity in vitro in neuronal cultures and in vivo using knock-in mice containing inactivating GAP mutations. p in the strength of synaptic connections in the brain are essential for neuronal development and for brain processes such as learning and memory. Long-term potentiation (LTP) of synapses is a key form of synaptic plasticity that is widely recognized as a cellular model for the study of memory. Many forms of synaptic plasticity, including LTP, are mediated by long-lasting changes in the level of AMPA receptors (AMPARs), the major neurotransmitter receptors at excitatory synapses. Excitatory synapses contain a complex structure called the postsynaptic density (PSD), which includes hundreds of proteins that orchestrate synaptic structure and function and dynamic changes during synaptic plasticity. One of these is SynGAP, a RasGAP that binds to the major synaptic scaffolding protein PSD95 and is highly abundant in the PSD in excitatory synapses. SynGAP is essential for normal brain development and for LTP. During LTP induction, SynGAP is phosphorylated, decreasing its affinity for PSD95, resulting in its dispersion from the synapse. This disinhibits Ras activity and activates its downstream signaling processes, which were thought to be critical for synaptic potentiation. Heterozygote Syngap1-knockout mice have deficits in synaptic plasticity, learning, and memory and exhibit seizures. De novo damaging SYNGAP1 mutations in humans result in haploinsufficiency and cause SYNGAP1-related intellectual SynGAP could regulate AMPAR recruitment to synapses and mediate synaptic potentiation. Recent studies have shown that Transmembrane AMPAR Regulatory Proteins (TARPs), essential components of the AMPAR protein complex, also undergo LLPS with PSD95. A simple hypothesis was that SynGAP directly competes with the TARP-AMPAR complex, and when SynGAP is dispersed from the synapse, tthis complex could replace it and be recruited to the synapse. We tested whether SynGAP competed with TARPs in forming LLPS with PSD95 in vitro using purified proteins, heterologous cells, and neurons. We found that SynGAP directly competed with TARPs in forming LLPS with PSD95. This competition with TARPs was not dependent on GAP activity but required regions in the C-terminal domain of SynGAP responsible for LLPS with PSD95. READ THE FULL ARTICLE AT https://doi.org/10.1126/science.adk1291 y ILLUSTRATION: N. CARY/SCIENCE BASED ON BILL BLAKESLEY , AMPA receptor TARP PSD95 PSD95 SynGAP PSD95 PSD95 SynGAP PSD95 P Basal PSD95 SynGAP PSD95 SynGAP P LTP induction PSD95 PSD95 P PSD95 SynGAP PSD95 PSD95 SynGAP P LTP expression Model of SynGAP regulation of synaptic plasticity. SynGAP regulates synapses by competing with AMPAR-TARP complexes to form LLPS condensates with PSD95. During LTP induction, phosphorylation of SynGAP promotes the dispersal of SynGAP from the synapse and is replaced with AMPAR-TARP complexes, resulting in the potentiation of synaptic transmission. Araki et al., Science 383, 963 (2024) 1 March 2024 1 of 1
RES EARCH RESEARCH ARTICLE ◥ NEUROSCIENCE SynGAP regulates synaptic plasticity and cognition independently of its catalytic activity Yoichi Araki†, Kacey E. Rajkovich†, Elizabeth E. Gerber†, Timothy R. Gamache†, Richard C. Johnson, Thanh Hai N. Tran, Bian Liu, Qianwen Zhu, Ingie Hong, Alfredo Kirkwood, Richard Huganir* 1 of 15 , 1 March 2024 y Araki et al., Science 383, eadk1291 (2024) y g *Corresponding author. Email: rhuganir@jhmi.edu †These authors contributed equally to this work. y Department of Neuroscience, Kavli Neuroscience Discovery Institute, Johns Hopkins University School of Medicine, Baltimore, MD 21205, USA. activating protein (GAP) that negatively regulates small G protein signaling important for activity-dependent changes in synaptic strength (11–13). SynGAP is an abundant synaptic protein that is surpassed in copy number in the PSD by only the PSD-95 family of proteins and calcium/calmodulin-dependent protein kinase II (CaMKII) (14). Previously, we and others have shown that SynGAP undergoes a rapid change in localization after neuronal activity (7, 8). At baseline, PSD-enriched SynGAP regulates synaptic plasticity by inhibiting several G protein signaling cascades involved in LTP, including the Ras-Raf-MEK-ERK pathway, the activation of which is required for the insertion of AMPARs into the PSD (15). After an LTP-inducing stimulus, SynGAP is phosphorylated by CaMKII in an NMDA receptor–dependent manner and is rapidly dispersed from the PSD (7). SynGAP dispersion leads to increases in dendritic spine volume and synaptic AMPAR number (7). This dispersion relieves the negative regulation of synaptic Ras signaling and facilitates the induction and maintenance of changes underlying activity-dependent synapse strengthening (7). Its abundance in the PSD suggests that SynGAP may occupy a substantial number of the finite PDZ-binding slots under basal conditions, which in turn may limit the number of “slots” for AMPAR/TARP complexes (9). Indeed, reduced SynGAP expression in heterozygous knockout (KO) mice has been reported to be associated with increased concentrations of TARPs and AMPARs within the PSDs of forebrain neurons in vivo (9, 10). However, Syngap1 heterozygous mice also display enhanced activity of SynGAPregulated downstream signaling pathways throughout development (16), making it difficult to determine whether the anticorrelation between SynGAP and TARP protein amounts To test whether SynGAP regulates PSD composition in a GAP-independent manner, we used a knockdown-replacement strategy in which we knocked down SynGAP with short hairpin RNA (shRNA) and replaced it by transfecting wild-type (WT) or mutant SynGAP constructs in rat hippocampal neurons in vitro. We have previously used this approach to study SynGAP function during chemically induced LTP (cLTP) (7). cLTP causes SynGAP dispersion from the synapse, recruitment of AMPARs to synapses, and spine enlargement. In our previous study, we found that SynGAP KD increased synaptic Ras activity, enlarged spines, and increased amounts of synaptic AMPARs in the basal state, which occluded further increases in spine size and receptor content upon cLTP induction (7). Expression of the WT SynGAP-a1 isoform rescued this phenotype. However, SynGAP harboring serine-to-alanine mutations at CaMKII phosphorylation sites critical for SynGAP dispersion from synapses (SynGAP 2SA; S1108A; S1138A) rescued the basal spine size and receptor content but failed to rescue cLTP because of deficits in SynGAP dispersion (7) (also see fig. S1 and Fig. 1). Here, we used this approach to examine the role of GAP activity in cLTP. We knocked down endogenous SynGAP by transfecting 19 to 21 days in vitro (DIV) rat hippocampal neurons with shRNA against SynGAP (shRNA-SynGAP) and simultaneously expressing either an shRNA-resistant form of full-length Azurite-tagged WT or mutant SynGAP-a1 constructs, along with Super-ecliptic pHluorin (SEP)–tagged AMPAR GluA1 subunit (SEPGluA1) and a mCherry cytosolic cell fill to observe SynGAP, AMPAR, and spine size changes during cLTP (Fig. 1). As observed previously, when SynGAP KD was rescued with shRNAresistant WT SynGAP, cLTP stimulation resulted in the rapid dispersion of SynGAP from dendritic spines and a concomitant increase of both synaptic SEP-GluA1 signal and spine size (Fig. 1, B to D) (7). These cLTP-dependent changes were blocked when we transfected neurons with Azurite-SynGAP harboring the g L ong-term potentiation (LTP) is a major form of synaptic plasticity in the brain that is thought to underlie learning, memory, and other higher-order brain processes (1–3). LTP has been a central focus in neuroscience for decades, and the biochemical signaling cascades underlying it have been investigated in great depth. Synaptic potentiation during LTP is mediated by increases in synaptic AMPA receptors (AMPARs), the major excitatory neurotransmitter receptors in the brain (1–3). However, it remains unclear how LTP induction leads to the stable trapping of AMPARs at the synapse to establish and maintain increased synaptic strength. One leading hypothesis involves the diffusional trapping of plasma membrane–inserted AMPARs by binding to proteinaceous binding “slots” in the postsynaptic density (PSD) (4–6). According to the “slot” hypothesis, AMPARs associate with the PSD through the binding of their auxiliary subunit transmembrane AMPAR regulating proteins (TARPs) to PDZ-domain-containing scaffolding molecules in the PSD, including PSD-95 and other members of the membraneassociated guanylate kinase (MAGUK) family of proteins. As the PSD undergoes changes in organization and composition after the induction of synaptic plasticity, these PDZ domains can be dynamically occupied by AMPAR/TARP complexes and other transmembrane and nontransmembrane molecules (6–10). One such nontransmembrane molecule is SynGAP, a synaptically localized GTPase- SynGAP GAP activity is not required for synaptic AMPAR recruitment in vitro p SynGAP is an abundant synaptic GTPase-activating protein (GAP) critical for synaptic plasticity, learning, memory, and cognition. Mutations in SYNGAP1 in humans result in intellectual disability, autistic-like behaviors, and epilepsy. Heterozygous Syngap1-knockout mice display deficits in synaptic plasticity, learning, and memory and exhibit seizures. It is unclear whether SynGAP imparts structural properties at synapses independently of its GAP activity. Here, we report that inactivating mutations within the GAP domain do not inhibit synaptic plasticity or cause behavioral deficits. Instead, SynGAP modulates synaptic strength by physically competing with the AMPA-receptor-TARP excitatory receptor complex in the formation of molecular condensates with synaptic scaffolding proteins. These results have major implications for developing therapeutic treatments for SYNGAP1-related neurodevelopmental disorders. in the PSD is caused by PDZ slot binding competition, changes in synaptic GAP activity and downstream signaling, or both. Here, we tested the role of SynGAP at PSD both in vitro and in vivo using catalytically inactive SynGAP expression constructs and knockin (KI) mice containing inactivating mutations within the SynGAP GAP domain. We provide evidence for a distinct structural role for SynGAP in the PSD that is independent of its role as a regulator of G protein signaling and show that SynGAP dispersion during LTP induction increases the number of PDZ-binding slots available for AMPAR and TARP complexes.
RES EARCH | R E S E A R C H A R T I C L E * G + AP 2S * A A AP G 2S W T Normalized spine SynGAP * G + AP 2S * A A AP G 2S T W * G + AP 2S * A AP A G 2S W T Normalized spine GluA1 Normalized spine volume We next sought to determine whether the structural contribution of SynGAP to AMPAR trafficking that we observed in vitro could be observed in vivo. To separate the role of G protein signaling and the structural properties of 2 of 15 , SynGAP-GAP mutant mice have normal LTP y ner that is dissociable from the mechanisms underlying spine enlargement. y g GAP* was enriched at synapses and underwent dispersion from synapses after cLTP stimulation like WT SynGAP (Fig. 1, B to D). Dispersion of SynGAP-GAP* was sufficient to rescue the cLTP-dependent enhancement of synaptic SEP-GluA1 signal, but not spine enlargement (Fig. 1, B to D). These data indicate that SynGAP regulates AMPAR synaptic accumulation during cLTP in a GAP-independent man- 1 March 2024 y Araki et al., Science 383, eadk1291 (2024) g CaMKII phosphorylation site mutations. We then performed similar experiments using a SynGAP construct harboring two point mutations in the GAP domain at residues known to be critical for its GAP activity (SynGAP-GAP*; F484A, R485L) (17, 18). These mutations eliminated SynGAP GAP activity in a RAS activation pull-down assay in transfected human embryonic kidney (HEK293T) cells (fig. S2). SynGAP- p Chemical LTP Baseline Fig. 1. SynGAP GAP activity GluA1 A WT 2SA GAP* GAP*2SA is not required for synaptic AMPAR recruitment in vitro. (A) Representative Merged live fluorescent confocal images of a secondary dendrite from a rat hippocampal SEP-GluA1 neuron transfected with mCherry (cytosolic cell fill), SEP-GluA1, and AzuritemCherry tagged WT (WT) or mutant SynGAP before (Baseline) or Azuriteafter chemical LTP (cLTP). SynGAP Mutants included phosphodeficient SynGAP (2SA), GAP-inactive SynGAP (GAP*), and a combination Merged mutant with both (GAP*+2SA). Endogenous SynGAP was knocked down by shRNA and SEP-GluA1 replaced by exogenous shRNA-resistant AzuriteSynGAP. Arrowheads indicate mCherry representative synaptic spine heads with SynGAP dispersion and SEP-GluA1 insertion. AzuriteWhite arrowheads indicate SynGAP dendritic spines that enlarge and exhibit SEP-GluA1 insertion Baseline Chem LTP and SynGAP dispersion in response to cLTP. Yellow SynGAP SEP-GluA1 B C mCherry D arrowheads indicate dendritic spines displaying SEP-GluA1 **** *** 5 2.0 **** 5 *** ** insertion and SynGAP * 4 4 1.5 dispersion without spine 3 3 enlargement. Blue arrow1.0 heads indicate spines with no 2 2 response during cLTP. Scale 0.5 1 1 bar, 5 mm. (B) Quantification of SEP-GluA1 expression 0 0.0 0 before and after cLTP in neurons transfected with WT or various mutant constructs. 1.880 ± 0.181 A.U., cLTP 2.323 ± 0.205 A.U.). (D) Quantification of synaptic Normalized total synaptic spine GluA1 contents by dendritic intensity is shown SynGAP expression before and after cLTP induction in neurons transfected with (WT: n = 6, Basal 1.000 ± 0.086 A.U., cLTP 2.265 ± 0.303 A.U.; 2SA: n = 6, WT or various mutant constructs. Normalized total synaptic spine SynGAP Basal 0.974 ± 0.055 A.U., cLTP 1.271 ± 0.088 A.U.; GAP*: n = 7, Basal 1.349 ± 0.145 A.U., cLTP 2.232 ± 0.211 A.U.; GAP*+2SA: n = 7, Basal 1.374 ± 0.189 A.U., contents by dendritic intensity is shown (WT: n = 6, Basal 1.000 ± 0.018 A.U., cLTP 0.435 ± 0.074 A.U.; 2SA: n = 6, Basal 1.153 ± 0.048 A.U., cLTP 0.944 ± cLTP 1.631 ± 0.141 A.U.). (C) Quantification of the average change in spine volume during cLTP in neurons expressing WT or various mutant constructs, as 0.073 A.U.; GAP*: n = 7, Basal 0.987 ± 0.058 A.U., cLTP 0.401 ± 0.059 A.U.; GAP*+2SA: n = 7, Basal 1.091 ± 0.034 A.U., cLTP 0.981 ± 0.073 A.U.). For (A) to (D), measured by mCherry cell fill. Normalized total synaptic mCherry by dendritic intensity is shown (WT: n = 6, Basal 1.000 ± 0.141 A.U., cLTP 2.238 ± 0.182 A.U.; two-way ANOVA with repeated measures for chemical LTP treatment and multiple comparisons with Šídák’s test were used. *P < 0.05, **P < 0.01, ***P < 0.001, 2SA: n = 6, Basal 1.058 ± 0.105 A.U., cLTP 1.326 ± 0.128 A.U.; GAP*: n = 7, Basal 1.961 ± 0.160 A.U., cLTP 2.392 ± 0.284 A.U.; GAP*+2SA: n = 7, Basal ****P < 0.0001; n.s., not significant.
RES EARCH | R E S E A R C H A R T I C L E A GAP-deficient Syngap1 mutant mice Syngap1 exon 9 FR → AL in GAP domain R H E L I F R E N T L A ...CGG GAA CAC CTC ATA TTC CGA GAG AAC ACG CTC GCC... ...GCC CTT GTG GAG TAT AAG GCT CTC TTG TGC GAG CGG... gRNA Target CRISPR/Cas9 94-nucleotide oligo primer R H E L I A L E N T L A ...CGG GAA CAC TTA ATC GCT CTC GAG AAT ACG CTA GCC... ...GCC CTT GTG AAT TAG CGA GAG CTC TTA TGC GAT CGG... XhoI NheI Syngap1 GAP domain: pERK GAPDH GAPDH ERK ERK 0.5 1.0 0.5 0.0 G * 1.5 1.0 0.5 0.0 +/+ * 1.5 1.0 0.5 0.0 GAP*/GAP* +/GAP* Survival until P10 χ test p < 0.05 2 H χ2 test n.s. I # of Mice # of Mice 15 10 5 n.s. 50 0 1 2 3 +/- -/- G G AP AP */ * AP n.s. n.s. 100 50 , *** 0 (%) Probability of Survival 100 Observed Expected y (%) Probability of Survival +/ G + +/ +/ -/- - +/ + * 40 30 20 10 0 y g 0 to what has been seen previously in SynGAP heterozygous KO (Syngap1+/−) mice (18). Whereas homozygote SynGAP KO (Syngap1−/−) mice dies perinatally within 2 ro 3 days (16, 19), homozygote GAP* KI mice (Syngap1GAP*/GAP*) survives well beyond postnatal day 7 (P7) (Fig. 2, H and I) into adulthood, are fertile, and can be bred in homozygosity. Thus, whereas SynGAP is required for viability, its GAP activity is not. 1 March 2024 2.0 y 0.0 2.0 g 1.0 F 1.5 [pERK]/[ERK] D 1.5 [pERK]/[ERK] C +/+ Araki et al., Science 383, eadk1291 (2024) + +/ pERK [SynGAP]/[GAPDH] SynGAP [SynGAP]/[GAPDH] SynGAP Weeks SynGAP, we generated KI mice with the same inactivating mutations in the GAP domain used in vitro to eliminate GAP activity (Fig. 2A). Heterozygote mice harboring this GAP* KI mutation (Syngap1+/GAP*) had normal SynGAP protein expression in the brain but showed increased expression of phosphorylated extracellular signal– regulated kinase (pERK) (Fig. 2, B to G), consistent with decreased GAP activity similar G G AP AP */ * AP * G + +/ +/ E +/ + AP * G +/ +/ + B G G AP AP */ * CGGGAACACTTAATCGCTCTCGAGAATACGCTAG A L p Fig. 2. SynGAP-GAP KI mice exhibit normal SynGAP protein expression but have elevated Ras-ERK signaling in the brain. (A) Generation of Syngap1+/GAP* mice by CRISPR-Cas9. gRNA was designed to make the double-strand break near the target site, and the GAP activity-deficient mutant was introduced (FR→AL, “GAP*”) by homology-directed repair using a 94-nucleotide GAP-mutant oligo donor. (B to D) Representative immunoblots and quantification of SynGAP and GAPDH protein from whole brains of Syngap1+/GAP*, Syngap1GAP*/GAP* mice and WT littermates (Syngap1+/+). Syngap1+/+ (n = 2, mean ± SEM; 1.000 ± 0.046 A.U.) versus Syngap1+/GAP* (n = 2, mean ± SEM; 1.076 ± 0.077 A.U.); Syngap1+/+ (n = 2, mean ± SEM; 1.030 ± 0.069 A.U.) versus Syngap1GAP*/GAP* (n = 2, mean ± SEM; 1.020 ± 0.021 A.U.). *P < 0.05, Mann-Whitney test. (E to G) Representative immunoblots and quantification of phospho-ERK and total ERK protein from whole brains of Syngap1+/GAP*, Syngap1GAP*/GAP* mice and WT littermates (Syngap1+/+). Syngap1+/+ (n = 4, mean ± SEM; 1.05 ± 0.043 A.U.) versus Syngap1+/GAP*(n = 4, mean ± SEM; 1.288 ± 0.017 A.U.); Syngap1+/+ (n = 4, mean ± SEM; 1.000 ± 0.029 A.U.) versus Syngap1GAP*/GAP* (n = 4, mean ± SEM; 1.437 ± 0.092 A.U.). *P < 0.05, Mann-Whitney test. (H) Survival of Syngap1+/−, Syngap1−/− mice and WT littermates (Syngap1+/+) resultant from Syngap1+/− × Syngap1+/− breeding until age P10. Top panel: Observed number of mice (Syngap1+/+ = 8, Syngap1+/− = 12, Syngap1−/− = 0) versus Expected number of mice (Syngap1+/+ = 5, Syngap1+/− = 10, Syngap1−/− = 5); *P < 0.05, chi-square test. No Syngap1−/− mice survived until P10. Bottom panel: Survival plot. Log-rank (Mantel-Cox) test was used; Syngap1+/+ and Syngap1+/− (P = 0.36, n.s.); Syngap1+/+ and Syngap1−/− (***P = 0.0009). (I) Survival of Syngap1+/GAP*, Syngap1GAP*/GAP* mice and WT littermates cSyngap1+/+) resultant from Syngap1+/GAP* × Syngap1+/GAP* breeding until P10. Top Panel: Observed number of mice (Syngap1+/+ = 18, Syngap1+/GAP* = 27, Syngap1GAP*/GAP* = 13) versus Expected number of mice (Syngap1+/+ = 14.5, Syngap1+/GAP* = 29, Syngap1GAP*/GAP* = 14.5; chi-square test was used, n.s. (P = 0.57). Bottom panel: Survival plot. Log-rank (Mantel-Cox) test was used for Syngap1+/+ and Syngap1+/GAP* (P = 0.41, n.s.) and Syngap1+/+ and Syngap1GAP*/GAP* (P = 0.11, n.s.). 0 0 1 2 3 Weeks +/+ +/GAP* GAP*/ GAP* Previous studies have shown that spine size and miniature excitatory postsynaptic current (mEPSC) are both increased in the Syngap1 heterozygote KO (20). However, consistent with our in vitro data above showing that after SynGAP knockdown (KD), the GAP* mutant did not rescue the increased synaptic spine size but did rescue the normal AMPAR content in the baseline conditions (Fig. 1), the synaptic spine 3 of 15
RES EARCH | R E S E A R C H A R T I C L E % LTP TBS SynGAP-GAP mutant mice have normal activity, working memory, and associative fear memory Previous work has shown that SynGAP is required for normal locomotor activity, learning, SynGAP+/+ 180 B 160 140 SynGAP+/- 120 80 -20 0 20 40 60 10 ms 1 mV 180 140 100 +/+ +/- +/+ TBS D 180 % LTP 160 +/GAP* 140 120 80 -20 GAP*/GAP* 0 20 40 60 Time (min) 10 ms 1 mV 180 SynGAP competes with TARP-g8 for binding to PSD-95 140 100 Araki et al., Science 383, eadk1291 (2024) 1 March 2024 4 of 15 , Fig. 3. SynGAP-GAP KI mice have normal LTP. (A) Averaged population field CA1 recordings of TBS-LTP time course obtained from brain slices of Syngap1+/− mice and Syngap1+/+ littermate controls. All data points are normalized to the averaged baseline fEPSP slope. Inset: Example averaged fEPSP traces from Syngap1+/+ and Syngap1+/− slices recorded during baseline (black) and 40 to 60 min after TBS-LTP induction (red). (B) Quantification of averaged TBS-LTP in Syngap1+/− and Syngap1+/+ littermates. Individual data points are superimposed. TBS-LTP is calculated by the ratio of the mean fEPSP slope measured 40 to 60 min after TBS-LTP induction (yellow-shaded region) divided by the averaged fEPSP baseline slope within each recorded sample (Syngap1+/+: n = 13, 150.9 ± 7.51% SEM; Syngap1+/−: n = 13, 123.0 ± 5.416% SEM). Mann-Whitney rank sum test was used. (C) Averaged population field CA1 recordings of TBS-LTP time course obtained from brain slices of Syngap1+/GAP* and Syngap1GAP*/GAP* mice as well as their Syngap1+/+ littermate controls. Inset: Example averaged fEPSP traces from Syngap1+/+, Syngap1+/GAP*, and Syngap1GAP*/GAP* slices recorded during baseline (black) and 40 to 60 min after TBS-LTP induction (red). (D) Quantification of averaged TBS-LTP in Syngap1+/+, Syngap1+/GAP*, and Syngap1GAP*/GAP* littermates. Individual data points are superimposed. (Syngap1+/+: n = 22, 145.5 ± 4.74% SEM; Syngap1+/GAP*: n = 19, 151.9 ± 6.57% SEM; Syngap1GAP*/GAP*: n = 16, 154.8 ± 9.34% SEM). Nonparametric one-way ANOVA and Kruskal-Wallis multiplecomparisons test were used. Error bars and shading represent SEM. *P < 0.05; n.s., not significant. y +/+ +/GAP* GAP*/GAP* Because GAP catalytic activity of SynGAP is not required for normal LTP and memory, we investigated whether SynGAP’s structural role in the PSD is essential for neuroplasticity. Both SynGAP (24) and TARP-g8 (25) (hereafter referred to as g8) undergo liquid-liquid phase separation (LLPS) with MAGUK family proteins in cell-free systems. LLPS is a known mechanism of the formation of molecular condensates that are composed of dynamic protein clusters that exchange constituents with the adjacent pool of freely diffusing proteins (26). In vitro, many synaptic proteins are known to undergo LLPS, which can facilitate the clustering of membrane proteins (27, 28). Previous studies have shown that PSD-95 can form molecular condensates with both SynGAP (24) and TARPs (27, 28). To explore whether this property of SynGAP is important for its role in LTP, we first investigated the possibility that SynGAP competes with the g8-terminal cytosolic region (198 amino acids, hereafter referred to as g8CT) for binding to PSD-95 to regulate the composition of synaptic PDS-95 molecular clusters y g 100 % LTP (40-60 min) 220 n.s. n.s. n.s. y Time (min) C * g 100 220 and memory (20–23). However, whether the GAP activity of SynGAP is required for these behaviors remains to be fully elucidated. We performed a series of behavioral experiments in 2- to 4-month-old mice. In open-field testing, Syngap1+/− mice showed hyperactivity compared with WT littermates (Fig. 4A), consistent with prior work (22). By contrast, both Syngap1+/GAP*and Syngap1 GAP*/GAP* mice showed normal activity that was indistinguishable from that of their WT littermates (Fig. 4B). We next compared working memory using the Y-maze spontaneous alternation task. Consistent with previous studies (20, 23), Syngap1+/− mice had reduced spontaneous alternations compared with WT littermates (Fig. 4C). However, the percentages of alternations for Syngap1+/GAP* and Syngap1GAP*/GAP* mice were not different from those of their WT littermates (Fig. 4D). To explore whether SynGAP GAP activity is required for associative learning, we then performed auditory cued and contextual fear conditioning. Consistent with prior studies (21, 22), Syngap1+/− mice had impaired learning of a shock-associated auditory cue, a conditioned stimulus (CS), as assessed by measuring the amount of time spent freezing in response to the presentation of the CS after conditioning (Fig. 4E). Syngap1+/GAP* mice showed no impairment in fear conditioning and showed increases in freezing that were no different from those of WT mice (Fig. 4F). Taken together, these data show that whereas Syngap1+/− mice exhibit hyperactivity and deficits in both working memory and fear learning, these impairments are not found in heterozygous and homozygous GAP* KI mice. p A viously observed LTP deficits with Syngap1 haploinsufficiency (Fig. 3, A and B) (19). By contrast, slices prepared from both Syngap1+/GAP* mice unexpectedly exhibited normal TBS-LTP expression compared with recordings obtained from brain slices of WT littermates (Fig. 3, C and D). Moreover, we found that Syngap1GAP*/GAP* mice had normal LTP (Fig. 3, C and D). These data suggest that the structural presence of SynGAP at synapses is sufficient for normal LTP to occur and demonstrate that the GAP activity of SynGAP is dispensable for the expression of hippocampal LTP. % LTP (40-60 min) size in the CA1 hippocampal region of homozygote GAP* KI mice (Syngap1GAP*/GAP*) was enlarged but the mEPSC amplitude remained unchanged (fig. S3). These data support the idea that GAP activity may be important for changes in spine size but does not affect AMPA receptor content in synapses in vivo. To test whether SynGAP’s GAP activity is required for synaptic plasticity in vivo, we performed extracellular field recordings to measure LTP in CA1 of the hippocampus induced by repeated theta-burst stimulation (TBS) of the Schaeffer collateral pathway in Syngap1+/−, Syngap1+/GAP*, and Syngap1GAP*/GAP* mice, along with their respective WT littermates (Fig. 3). We measured a 54% reduction of TBS-LTP expression in Syngap1+/− brain slices compared with WT littermates, replicating pre-
RES EARCH | R E S E A R C H A R T I C L E Distance (cm) A SYNGAP+/+ B SYNGAP+/- 6000 Distance (cm) Fig. 4. Syngap1+/GAP* KI mice have normal activity, working memory, and associative fear memory. (A) Distance traveled by Syngap1+/− mice (n = 15) and Syngap1+/+ WT (WT) littermates (n = 18) during a 2-hour open-field test in 5-min intervals. Two-way ANOVA with repeated measures for time only and Šídák’s multiple-comparisons test were used. (B) Distance traveled by Syngap1+/GAP* mice (n = 16), Syngap1GAP*/GAP* mice (n = 14), and Syngap1+/+ WT littermates (n = 17) during a 2-hour open-field test in 5-min intervals. Two-way ANOVA with repeated measures for time only and Šídák’s multiple-comparisons test were used. (C) Percentage of spontaneous alternating arm visits (% alternation) by Syngap1+/− mice (n = 48, 56.00 ± 1.29% alternation) and Syngap1+/+ littermates (n = 37, 68.30 ± 1.58% alternation) during a 5-min Y-maze exploration test. The red dotted line represents the 50% successful alternation rate expected due to chance. Two-tailed Student’s t test was used. (D) Percentage of spontaneous alternating arm visits (% alternation) by Syngap1+/GAP* mice (n = 35, 65.63 ± 1.83% alternation), Syngap1GAP*/GAP* mice (n = 18, 67.14 ± 2.37% alternation), and Syngap1+/+ littermates (n = 35, 66.74 ± 1.49% alternation) during a 5-min Y-maze exploration test. The red dotted line represents the 50% successful alternation rate expected due to chance. One-way ANOVA and Tukey’s test were used. (E) Average percentage of time spent freezing per minute (% freezing) with and without the conditioned stimulus (auditory cue, CS) by Syngap1+/− mice (n = 14 29.12 ± 4.44% freezing) and Syngap1+/+ littermates (n = 19, 27.50 ± 2.37% freezing). Two-way ANOVA with repeated measures for CS only and Šídák’s multiple-comparisons test were used. (F) Average percentage of time spent freezing per minute (% freezing) with and without presentation of the conditioned stimulus (auditory cue, CS) by Syngap1+/GAP* mice (n = 15, 23.18 ± 2.84% freezing), Syngap1GAP*/GAP* mice (n = 19, 20.11 ± 2.129% freezing) and Syngap1+/+ littermates (n = 18, 27.15 ± 2.203% freezing). Two-way ANOVA with repeated measures for CS only and Šídák’s multiplecomparisons test were used. Error bars represent SEM. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001; n.s., not significant.. **** 4000 2000 6000 4000 2000 0 0 40 80 Time (min) C 100 0 120 +/- +/+ 0 40 80 Time (min) D ns 100 120 GAP*/GAP* +/GAP* +/+ **** +/+ +/GAP* GAP*/GAP* ns (%) Alternation 60 40 20 80 60 40 g (%) Alternation p 80 20 y 0 **** n.s. F 80 100 60 40 **** **** *** 80 60 y g % Freezing 100 % Freezing E 0 40 20 20 y during the expression of LTP. We transfected full-length PSD-95-mCherry and GFP-g8CT in COS cells in the absence and presence of SynGAP. Consistent with data from cell-free experiments (25), coexpression of PSD-95mCherry and GFP-g8CT in the absence of SynGAP resulted in molecular clusters containing both GFP-g8CT and PSD-95-mCherry (Fig. 5A). We then cotransfected GFP-g8CT and PSD-95mCherry with increasing concentrations of SynGAP and examined the PSD-95 clusters for the presence of g8 and SynGAP. At low SynGAP Araki et al., Science 383, eadk1291 (2024) – + – + expression, SynGAP co-clustered with g8CT and PSD-95, but with increasing concentrations of SynGAP, the presence of g8CT in the clusters was eliminated (Fig. 5A), indicating that SynGAP can compete with g8 for binding to PSD95 clusters. We tested whether g8CT/PSD-95 and PSD95/SynGAP clusters dynamically exchange their contents with cytosolic pool using a fluorescence recovery after photobleaching (FRAP) assay (fig. S4), which confirmed that these contents recovered within a few minutes after bleaching. These results suggest these clusters are 1 March 2024 0 CS , 0 CS – + – + – + not immobile aggregates of the two proteins but rather are likely condensed liquid-phase droplets similar to those seen in vitro. We then characterized the structural requirements of SynGAP for competition with g8. Coexpression of WT SynGAP eliminated g8CT from PSD-95 clusters (Fig. 5A). Mutation of the GAP domain had no effect on the ability of SynGAP to compete with g8CT (Fig. 5B). By contrast, a series of mutations that regulate cluster formation substantially affected the ability of SynGAP to compete with g8CT (Fig. 5 of 15
RES EARCH | R E S E A R C H A R T I C L E Dose-dependency of SynGAP competition to γ8-PSD95 puncta + + PSD95 SynGAP + + + + + + + + + + + + x0 x0.25 x0.5 x1 x2 x4 Merge γ-8 CT *** 75 50 *** 25 *** *** x4 PS 8 8+ D95 PS D 95 x0 .2 5 x0 .5 SynGAP x2 0 PSD95 +Azurite-SynGAP Structual element of SynGAP competition to γ8-PSD95 puncta PSD95 + + SynGAP + + + + WT + + LDKD + + ΔPDZ + + LDKD+ ΔPDZ + + ΔC143 + + ΔC580 + + + + GAP* GAP*+ LDKD+ ΔPDZ Merge *** *** *** *** *** 75 50 25 * * n.s. 0 SynGAP y P 8 8+ SD9 PS 5 D 95 W LD T KD LD KD PD +Δ Z PD C Z 14 C 3 58 0 G AP LD KD GA * +Δ P* PD + Z PSD95 100 g γ-8 CT p γ-8 CT % PSD95 puncta with γ8 B n.s. 100 x1 γ-8 CT % PSD95 puncta with γ8 A +Azurite-SynGAP Phase-in-phase separation of TARP-g8-PSD95 and SynGAP-PSD95 condensates within phase-separated droplets of purified proteins Next, we used purified proteins to further explore how g8 and SynGAP compete for binding to PSD95. We first confirmed that g8CT-PSD95 and PSD95-SynGAPCC-PBM underwent LLPS and formed liquid condensates (droplets) in our assay system when the two pairs of purified proteins were mixed (24, 25) (Fig. 6A, top and middle panels). Next, we explored the phase separation of these three purified proteins when combined. The proteins did not homogeneously mix within droplets and formed separate phase-in-phase condensates within individual liquid droplets; SynGAPCC-PBM-PSD95 clustered in the center, whereas g8CT-PSD95 1 March 2024 formed an adjacent protein condensation, a ring-like structure around the periphery (Fig. 6A, bottom panels). These distinct localizations were found in nearly all droplets (fig. S8A). When the localization of each protein was plotted on the differential interference contrast (DIC) image, faint boundaries detected by refractive index changes were observed around the inner droplet of SynGAPCC-PBMPSD95 (Fig. 6B). This observation indicates that separate condensates with distinct lightscattering properties were forming within each droplet, with SynGAP-PSD95 condensates forming inside the g8-PSD95 condensate. Plotting the localization of g8CT-PSD95 by drawing a line across the droplet center when only g8CT and PSD-95 were mixed showed that g8CT-PSD95 had a uniform distribution across the droplet (Fig. 6C, left panel). However, when SynGAPCC-PBM was added, g8CT was more peripherally localized 6 of 15 , Araki et al., Science 383, eadk1291 (2024) sal role of SynGAP to compete with the TARPPSD95 interaction. y 5B). Mutations in SynGAP’s PDZ ligand domain (DPDZ mutant) or in its coil-coil domain (LDKD mutant), which we have previously shown are important for cluster formation and LLPS (24), decreased its ability to displace g8CT (Fig. 5B; for structure of deletion constructs please see fig. S5). Combining these two mutations (DPDZ/LDKD) almost completely eliminated SynGAP’s ability to compete with g8. Deletion of the entire C-terminal coilcoil domain and disordered region (DC580), but not the GAP domain, was required to eliminate SynGAP’s ability to displace g8CT. Similar experiments using full-length g8 showed similar results (fig. S6). These results indicate that SynGAP’s C-terminal structure is essential for its ability to compete with g8 for cluster formation with PSD-95. The same experiment using TARP-g2 (g2), another major TARP, yielded similar results (fig. S7), suggesting a univer- cells transfected with GFP-g8CT (“g8”), PSD95-mCherry, and different AzuriteSynGAP mutants (WT, LDKD, DPDZ, LDKD+DPDZ, DC143, DC580, GAP*, and GAP*+LDKD+DPDZ). Scale bar, 5 mm. Right panel: percentage of PSD95 puncta with g8 with different amounts of Azurite-SynGAP. One-way ANOVA and Tukey’s multiple-comparisons test were used. Error bars represent SD. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001; n.s., not significant compared with g8+PSD95+Azurite-SynGAP WT unless otherwise specified. y g Fig. 5. SynGAP-PSD95 and TARP-g8-PSD95 compete in vitro. (A) Confocal microscopy of COS cells transfected with GFP-g8CT (“g8”), PSD95-mCherry, and different amounts of Azurite-SynGAP (0.25×, 0.5×, 1×, 2×, and 4×). Scale bar, 5 mm. Right panel: percentage of PSD95 puncta with g8 with different amounts of Azurite-SynGAP. One-way ANOVA and Tukey’s multiple-comparisons test were used. Error bars represent SD. *P < 0.05, **P < 0.01, ***P < 0.001; n.s., not significant. compared with g8+PSD95. (B) Confocal microscopy of COS
RES EARCH | R E S E A R C H A R T I C L E A Merge +DIC DIC Merge γ8 PSD95 SynGAP Zoom-Merge γ8 PSD95 PSD95 SynGAP γ8 PSD95 SynGAP B DIC+ SynGAP-PSD95 phase (Boundary) γ8 SynGAP SynGAP PSD95 SynGAP γ8 C PSD95 γ8 SynGAP γ8 γ8 PSD95 PSD95 Merge PSD95 SynGAP γ8 γ8 (Top, Outer) x-y γ8 PSD95 SynGAP x-y PSD95 SynGAP (Bottom, Inner) Top x-z Optical slice Bottom 1 March 2024 7 of 15 , Araki et al., Science 383, eadk1291 (2024) SynGAPCC-PBM-PSD95 droplet was not only located inside but also had a propensity to sink closer to the bottom, likely becase of its higher density. Conversely, g8CT-PSD95 droplets were generally distributed peripherally and positioned in the plane above SynGAPCC-PBMPSD95 (Fig. 6D). Using time-lapse imaging, we investigated whether the droplets exhibited y with >50% higher g8CT concentration in the periphery, whereas SynGAPCC-PBM was >95% located centrally with PSD95 (Fig. 6C, right panel), suggesting that the g8CT-PSD95 and SynGAPCC-PBM-PSD95 droplets form different layers of protein condensates. Using confocal microscopy to scan both the x–z and x–y planes, we found that the y g Fig. 6. SynGAP-PSD95 and TARP-g8-PSD95 show mutually exclusive phase-in-phase separation in droplets. (A) Images of purified protein sedimentation assay by confocal microscopy. Purified proteins included TARP-g8CT (“g8”) tagged with iFlour568 (green), PSD95 tagged with iFlour633 (red), and SynGAPCC-PBM (last 156 amino acids of SynGAP: coiled-coil domain + PDZ ligand: “SynGAP”) tagged with iFlour488 (blue). Left panels: merged fluorescence images with DIC images. Top: g8-PSD95 droplets. Middle: SynGAP-PSD95 droplets. Bottom: g8-PSD95-SynGAP droplets. High-power views are also shown (right panels). Scale bar, 3 mm. (B) Phase-in-phase separation of SynGAP-PSD95 droplets inside the g8-PSD95 droplets. Left panels: blue arrows or circles delineate the inner rings of phase-in-phase separation. Right panels: merge of DIC images with g8-PSD95-SynGAP droplets. Yellow arrows indicate regions of separation between SynGAP and PSD95 phase. Scale bar, 3 mm. (C) Comparison between g8-PSD95 droplets and g8-PSD95-SynGAP droplets. A line scan of protein condensations (yellow line) is shown to the right of each image. Scale bar, 3 mm. (D) Optical sectioning microscopy of g8-PSD95-SynGAP protein droplets. Top panels: x–y view. Bottom panels: x–z view. Optical slices (blue boxes) used to generate top (x–y) panels are shown. Scale bar, 5 mm. Right panel: schematic of g8-PSD95-SynGAP droplets. y D We next tested whether SynGAP GAP-activity is required for synaptic recruitment of g8 during cLTP using the same SynGAP KD/replacement approach used above. After rat hippocampal neurons were transfected with GFP-g8, we observed a cLTP-dependent enhancement of synaptic GFP-g8 fluorescence comparable to that observed with SEP-GluA1. Synaptic recruitment of g8 required phosphorylation of SynGAP but did not require SynGAP GAP activity (Fig. 7, A and B), revealing that SynGAP regulates synaptic accumulation of g8 during cLTP in a GAP-independent manner. We then investigated whether SynGAP mutations that alter SynGAP condensate formation with PSD-95 could affect the expression of cLTP. In these experiments, we knocked down SynGAP and replaced it with either WT SynGAP or SynGAP mutants that regulate LLPS. In these experiments, we induced cLTP at two glycine concentrations (10 and 200 mM) to test the sensitivity of SynGAP dispersion and cLTP induction to the strength of the induction stimulus. At 10 mM glycine, WT SynGAP was not dispersed from spines and cLTP was not expressed, as assayed by increases in spine size or the recruitment of g8. By contrast, glycine at 200 mM resulted in clear WT SynGAP dispersal and cLTP induction [Fig. 8 and (24)]. Replacement with the LDKD mutant also rescued cLTP using 200 mM glycine, whereas replacement with the PDZ mutant only partially rescued cLTP, highlighting the importance of the PDZ ligand sequence of SynGAP for occupying PSD-95 PDZ domains in the basal state. At 10 mM glycine, the LDKD mutant was dispersed and cLTP was expressed, in contrast to WT (Fig. 8). This outcome suggests that the LDKD mutation lowers the threshold for SynGAP dispersal from synapses, enhancing the sensitivity of cLTP induction by glycine and consequently facilitating the recruitment of g8 during cLTP. Neither the DPDZ mutant g γ8 PSD95 SynGAP γ8 Mutations in SynGAP that affect condensate formation and LLPS with PSD-95 regulate recruitment of TARP-g8 to synapses during cLTP p PSD95 SynGAP one of the fundamental properties of phaseseparated bodies, the tendency to coalesce (fig. S8B). We observed that within 1 to 2 min after initial physical contact between droplets, the outer layer of g8CT-PSD95 first fused, followed by the inner layer of SynGAPCC-PBM-PSD95. This observation suggests that both the outer g8-PSD95 phase and the SynGAP-PSD95 phase retain their droplet-like properties. The results strongly support the idea that SynGAP competes with g8 for PSD95 binding, resulting in the formation of the different layers of protein droplets rapidly and spontaneously. Critically, these phases appear incompatible with one another, exhibiting distinct droplet properties.
RES EARCH | R E S E A R C H A R T I C L E A TARP-γ8 WT 2SA GAP* GAP*2SA Baseline Merged TARPγ8 mCherry AzuriteSynGAP Chemical LTP Merged p TARPγ8 mCherry g AzuriteSynGAP Baseline Chem LTP *** *** 1.5 1.0 0.5 * G + AP 2S * A A AP G 2S W T 0.0 8 of 15 , cLTP 1.162 ± 0.071 A.U.; GAP*: n = 7, Basal 1.438 ± 0.143 A.U., cLTP 2.666 ± 0.177 A.U.; GAP*+2SA: n = 7, Basal 1.675 ± 0.288 A.U., cLTP 1.867 ± 0.283 A.U.). (C) Quantification of the average change in spine volume during cLTP in neurons expressing WT or various mutant constructs as measured by mCherry cell fill. Normalized total synaptic mCherry by dendritic intensity is shown (WT: n = 6, Basal 1.000 ± 0.088 A.U., cLTP 2.516 ± 0.234 A.U.; 2SA: n = 6, Basal 0.978 ± 0.118 A.U., cLTP 1.301 ± 0.132 A.U.; GAP*: n = 7, Basal 1.945 ± 0.158 A.U., cLTP 2.644 ± 0.333 A.U.; GAP*+2SA: n = 7, Basal 1.875 ± 0.085 A.U., cLTP 2.038 ± 0.180 A.U.). (D) Quantification of synaptic SynGAP expression before and after cLTP induction in neurons transfected with WT or various mutant constructs. Normalized total synaptic spine SynGAP content by dendritic intensity is shown (WT: n = 6, Basal 1.000 ± 0.098 A.U., cLTP 0.435 ± 0.066 A.U.; 2SA: n = 6, Basal 1.077 ± 0.065 A.U., cLTP 0.997 ± 0.095 A.U.; GAP*: n = 7, Basal 1.032 ± 0.075 A.U., cLTP 0.497 ± 0.081 A.U.; GAP*+2SA: n = 7, Basal 1.019 ± 0.098 A.U., cLTP 0.912 ± 0.061 A.U.). Two-way ANOVA with repeated measures for chemical LTP treatment and multiple-comparisons with Šídák’s test were used. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001; n.s., not significant. y 1 March 2024 * 0 Fig. 7. SynGAP GAP activity is not required for synaptic TARP-g8 recruitment in vitro. (A) Representative live fluorescent confocal images of a secondary dendrite from a rat hippocampal neuron transfected with GFP-TARP-g8, mCherry (cytosolic cell fill) and Azurite-tagged WT or mutant SynGAP before (Baseline) or after chemical LTP (cLTP). Mutants include phospho-deficient SynGAP (2SA), GAP-inactive SynGAP (GAP*), and a combination mutant with both (GAP*+2SA). Endogenous SynGAP was knocked down by shRNA and replaced by exogenous shRNA-resistant Azurite-SynGAP. Arrowheads indicate representative synaptic spine heads with SynGAP dispersion and g8 insertion. White arrowheads indicate dendritic spines that enlarge and exhibit g8 insertion and SynGAP dispersion in response to chemical LTP. Yellow arrowheads indicate dendritic spines displaying g8 insertion and SynGAP dispersion without enlargement (no structural plasticity). Blue arrowheads indicate spines with no response during cLTP. Scale bar, 5 mm. (B) Quantification of synaptic GFP-g8 expression before and after cLTP induction in neurons expression WT or various mutant constructs. Normalized total synaptic spine g8 contents by dendritic intensity are shown (WT: n = 6, Basal 1.000 ± 0.090 A.U., cLTP 2.394 ± 0.185 A.U.; 2SA: n = 6, Basal 0.992 ± 0.042 A.U., Araki et al., Science 383, eadk1291 (2024) Normalized spine SynGAP 1 G + AP 2S * A G + AP 2S * A * AP G A 2S 2 SynGAP 2.0 y g W T 0 3 AP 1 * A 2 *** 4 G 3 5 2S *** Normalized spine volume Normalized spine γ8 *** 4 D mCherry W T C TARPγ8 5 y B
RES EARCH | R E S E A R C H A R T I C L E A WT LDKD ΔPDZ LDKDΔPDZ Merge Baseline GFP-γ8 mCherry AzuriteSynGAP Chemical LTP (10 μΜ) Merge GFP-γ8 AzuriteSynGAP Chemical LTP (200 μΜ) Merge GFP-γ8 y mCherry AzuriteSynGAP Fig. 8. SynGAP phase-separation and PDZ-ligand binding capacity regulate TARP-g8 trafficking during chemical LTP. (A) Representative live fluorescent confocal images of a secondary dendrite from a rat hippocampal neuron transfected with GFP-g8, mCherry (cytosolic cell fill), and Azurite-tagged WT or mutant SynGAP before (Baseline) or after either weak cLTP (10 mM; Glycine) or strong cLTP (200 mM; Glycine). Mutants include LDKD, DPDZ, or both. Endogenous SynGAP was knocked down by shRNA and replaced with exogenous shRNA-resistant Azurite-SynGAP. Green circles indicate spine heads with the basal condition. Yellow circles and arrows indicate dendritic spines that enlarge and exhibit g8 insertion, spine enlargements, and SynGAP dispersion in response Araki et al., Science 383, eadk1291 (2024) 1 March 2024 2 *** *** ns 1 0 Z ΔP D Z KD ΔP D KD Normalized spine SynGAP *** 3 LD ΔP 4 W T Z D Z D KD *** LD Baseline Chem LTP (10 μΜ) Chem LTP (200 μΜ) LD ΔP 0 ΔP Z D Z D KD 1 LD ΔP KD LD W T 2 *** ns 5 , 0 ns *** 3 SynGAP y 1 * 4 KD 2 *** LD * *** T *** *** 3 5 W 4 ns D mCherry y g *** Normalized spine volume C TARPγ8 5 Normalized spine γ8 g B p mCherry to chemical LTP. Blue arrows indicate dendritic spines displaying g8 insertion and large spine even in the basal state. Scale bar, 5 mm. (B) Quantification of synaptic GFP-g8 expression in neurons transfected with WT or various mutant constructs before and after cLTP. Normalized total synaptic spine g8 contents by dendritic intensity are shown [WT: n = 5, Basal 1.218 ± 0.098 A.U. cLTP (10 mM) 1.556 ± 0.157 A.U, cLTP (200 mM) 3.237 ± 0.099 A.U.; LDKD: n = 6, Basal 1.356 ± 0.097 A.U. cLTP (10 mM) 3.164 ± 0.285 A.U, cLTP (200 mM) 3.540 ± 0.410 A.U. DPDZ: n = 6, Basal 1.853 ± 0.221 A.U., cLTP (10 mM) 1.996 ± 0.243 A.U, cLTP (200 mM) 2.748 ± 0.137 A.U.; LDKD+DPDZ: n = 5, Basal 2.474 ± 0.353 A.U., cLTP (10 mM) 3.075 ± 0.300 A.U, cLTP (200 mM) 9 of 15
RES EARCH | R E S E A R C H A R T I C L E 3.312 ± 0.149 A.U.]. (C) Quantification of the average change in spine volume as measured by mCherry cell fill in neurons transfected with WT or various mutant constructs before and after cLTP. Normalized total synaptic mCherry by dendritic intensity are shown [WT: n = 5, Basal 1.139 ± 0.070 A.U. cLTP (10 mM) 1.538 ± 0.160 A.U, cLTP (200 mM) 2.974 ± 0.109 A.U.; LDKD: n = 6, Basal 1.220 ± 0.092 A.U. cLTP (10 mM) 2.868 ± 0.142 A.U, cLTP (200 mM) 3.586 ± 0.249 A.U. DPDZ: n = 6, Basal 1.816 ± 0.270 A.U., cLTP (10 mM) 1.954 ± 0.267 A.U, cLTP (200 mM) 3.098 ± 0.242 A.U.; LDKD+DPDZ: n = 5, Basal 2.771 ± 0.225 A.U., cLTP (10 mM) 2.698 ± 0.152 A.U, cLTP (200 mM) 3.022 ± 0.156 A.U.]. (D) Quantification of synaptic SynGAP expression in neurons transfected with Discussion y , 10 of 15 y g 1 March 2024 y Araki et al., Science 383, eadk1291 (2024) over the lifetimes of the animals tested. Here, we have disentangled SynGAP signaling function from its structural properties both in vitro and in vivo by generating mice with inactivating GAP mutations. The heterozygous Syngap1+/GAP* mice have reduced SynGAP GAP activity comparable to the heterozygous KO mice but have normal total SynGAP protein expression and displayed normal LTP and no apparent deficits in several behaviors despite diminished GAP activity. Moreover, the homozygous Syngap1GAP*/GAP* mice are viable and have normal LTP and behavior, indicating that LTP and viability are independent of the GAP activity. These results indicate that SynGAP binding in the PSD is required for normal plasticity and cognition by regulating the number of PSD slots available for binding TARP-AMPAR complexes and in turn directly regulating synaptic strength. Our data suggest that the GAP-dependent signaling functions of SynGAP are important for spine size changes during LTP. Further work using these mice and other approaches is needed to understand the role of SynGAP GAP activity in brain function. SYNGAP1-related intellectual disability has been classified as a RASopathy resulting from loss of function of the SYNGAP1 gene (32). Several therapeutic strategies to ameliorate aberrant biochemical signaling downstream of Ras as a result of SYNGAP1 haploinsufficiency have been tested (33, 34). However, the efficacy of this treatment approach remains inconclusive. Our new data suggest that pharmacologically correcting dysregulated downstream GAP signaling of SynGAP may not be sufficient to rescue disease phenotypes because these strategies do not address the reduced PSD slot occupancy by SynGAP haploinsufficiency. In searching surveys of various ages and ethnicities [a total of 687,000 entries encompassing GnomAD (35), TOPMED (36), 8.3KJPN (37), and ALFA], we found five human SYNGAP1 single nucleotide variant carriers with GAPdisabling mutations (17) (rs1224277120 C>T: R485C, rs1248933822 G>A: R485H) that were not associated with any neurological or mental diagnosis. This result suggests that heterozygous SynGAP mutations that impair GAP signaling might be neither lethal nor sufficient to lead to an neurodevelopmental disorder g The synaptic RasGAP SynGAP is essential for synaptic plasticity and learning and memory, and mutations in SYNGAP1 cause intellectual disability, autistic-like behaviors, and epilepsy in humans (16, 19, 29, 30). Recent studies have shown that the dispersion of SynGAP from synapses is required for the induction of LTP (7). We have previously demonstrated that SynGAP synaptic dispersion during cLTP relieves the basal inhibition of synaptic Ras, an important step that allows derepression of ERK activity and AMPAR insertion (7). Whether SynGAP serves additional critical functions for AMPAR recruitment beyond its GAP activity has been an open question. Moreover, a comprehensive mechanistic understanding of how AMPARs are up-regulated and maintained at the synapse during LTP has remained elusive. The slot hypothesis of LTP suggests that AMPAR-TARP complexes could bind to a finite number of available “slots” on scaffolding proteins at the PSD (4–6, 9, 10). Here, we provide evidence for the pivotal role of SynGAP in determining slot availability for the AMPARTARP complex independently of its GAP activity (see schematic model in fig. S10). We have previously shown that phosphorylation of SynGAP by CaMKII is required for the activity-dependent dispersion of SynGAP from the PSD during synaptic plasticity (7). Here, we reveal that AMPARs can be recruited to the PSD after SynGAP dispersion in a manner that is independent of the GAP activity of SynGAP. Additionally, we found that SynGAP binding to PSD-95 competes with TARPs for binding to PSD-95 through the coiled-coil mediated multivalent interaction that forms PSD-LLPS (LLPS) and PDZ-ligand mediated protein binding (PDZ), and this antagonistic relationship is regulated by CaMKII phosphorylation sites on SynGAP (fig. S10). These data indicate that CaMKII can act to molecularly tune PSD-95 binding partners at the PSD. Our data suggest that CaMKII may differentially regulate the affinities and condensation properties of SynGAP and TARPs for PSD-95 to promote the recruitment of AMPARs. The tuning of condensation properties is an attractive model with which to describe the rapid and dynamic changes to PSD composition and receptor density that occur during synaptic plasticity. Finally, we showed that the elimination of SynGAP GAP activity does not disrupt LTP in CA1 of the hippocampus, and several behavioral phenotypes are normal in Syngap1 GAP mutant KI mice, suggesting that the structural function of SynGAP is a critical feature of its ability to regulate synaptic plasticity and to promote normal cognition. These data strongly suggest that SynGAP is a dominant driver of TARP enrichment in reconstituted condensates, because its CaMKIIdependent dispersion from synapses results in the recruitment of TARP-g8 to synapses. It is known that CaMKII phosphorylates TARP C-terminal domains during synaptic plasticity (6). The phosphorylation of the TARP-g2 C terminus by CaMKII enhances its binding affinity for PSD-95 and AMPAR activity at synapses (31). Thus, it seems plausible that CaMKII phosphorylation of TARP C termini contributes to the compositional switch that we observed. However, we found that mutation of two key CaMKII sites on SynGAP eliminated the CaMKII-dependent dispersion of SynGAP and the recruitment of TARP-g8. In addition, a recent report suggested that TARPg8 phosphorylation disrupts phase separation with PSD-95, resulting in decreased clustering (25). Additional experiments are required to explore the potential contribution of TARP phosphorylation in condensate composition switching. Previous studies have reported that the reduced SynGAP expression in heterozygous KO mice is associated with increased concentrations of TARPs and AMPARs within the PSDs of forebrain neurons in vivo, suggesting a potential competition between SynGAP and TARPs for slots (9, 10). However, experimental results using Syngap1 heterozygous KO mice are confounded by the effects of persistent upregulation of synaptic small GTPase activity p nor the LDKD mutant exhibited substantial effects on the synaptic targeting of SynGAP (fig. S9). These results show that the LDKD mutation that modulates SynGAP’s ability to compete with g8 for condensate formation with PSD-95 can regulate the threshold for recruitment of g8 during cLTP induction, demonstrating that SynGAP’s ability to undergo LLPS is critical for LTP expression. WT or various mutant constructs before and after cLTP. Normalized total synaptic spine SynGAP contents by dendritic intensity are shown [WT: n = 5, Basal 4.530 ± 0.296 A.U. cLTP (10 mM) 4.194 ± 0.449 A.U, cLTP (200 mM) 1.852 ± 0.326 A.U.; LDKD: n = 6, Basal 3.909 ± 0.284 A.U. cLTP (10 mM) 1.569 ± 0.216 A.U, cLTP (200 mM) 1.254 ± 0.075 A.U. DPDZ: n = 6, Basal 3.646 ± 0.389 A.U., cLTP (10 mM) 3.348 ± 0.497 A.U, cLTP (200 mM) 1.392 ± 0.080 A.U.; LDKD+DPDZ: n = 5, Basal 1.422 ± 0.120 A.U., cLTP(10 mM) 1.128 ± 0.080 A.U, cLTP (200 mM) 1.098 ± 0.033 A.U.]. Two-way ANOVA with repeated measures for chemical LTP treatment and multiple-comparisons with Šídák’s test were used. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001; n.s., not significant.
RES EARCH | R E S E A R C H A R T I C L E diagnosis, unlike typical SYNGAP1 loss-offunction mutations (38, 39) and is consistent with our results here. Our data indicate that future therapeutic strategies for the treatment of SYNGAP1-related intellectual disability should focus on increasing the amount of total SynGAP protein generated from the spared allele. These strategies will be complicated because SynGAP is expressed as a heterogeneous collection of structural isoforms that serve distinct functions in neuronal development and synaptic plasticity (40). Future studies will be needed to determine the structural and functional requirements for a complete rescue of SYNGAP1 haploinsufficiency phenotypes, and this will help to guide the development of treatments for SYNGAP1related intellectual disability and other severe neurodevelopmental disorders. 1 March 2024 11 of 15 , Total SynGAP was detected by the antibody obtained from abcam (catalog #ab3344; 1:1000 dilution). Phospho-ERK and total-ERK were detected by the antibody obtained from Cell Live COS cells and cultured hippocampal neurons were imaged using a Cell Observer spinning disk confocal microscope (Carl Zeiss) or an LSM 880 laser scanning confocal microscope (Carl Zeiss). For live imaging of COS cells, cells were plated on collagen-coated 18-mm glass coverslips 24 to 36 hours before the start of the experiment. COS cells were transiently transfected with cDNA constructs encoding proteins of interest using Lipofectamine 2000 (Invitrogen) 16 to 24 hours before the start of the experiment. Coverslips containing y Araki et al., Science 383, eadk1291 (2024) Antibodies Confocal live cell imaging y g Brain tissue was excised from 5-month-old mice. Tissue was lysed in 10 volumes of lysis buffer (50 mM Tris, pH 8.0, 100 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 0.2% SDS, 0.5% sodium deoxycholate, with cOmplete Protease inhibitor EDTA-free mix; Roche/Sigma) and PhosSTOP phosphatase inhibitor mixture (Sigma, catalog #4906847001) with a Dounce A homogenizer. Protein concentrations were measured with the Pierce BCA assay kit (Pierce, catalog #23225). SDS sample buffer (5×, 250 mM Tris, pH 6.8, 20% v/v glycerol, 10% w/v SDS, 12% v/v b-mercaptoethanol, and 0.05% w/v bromophenol blue) was added to each sample (10 mg Small GTPase (Ras) activity was measured using a small GTPase(Ras)–GTP pull-down assay. DNA constructs expressing a small G protein (Ras) and SynGAP constructs (WT, GAP*) were co-transfected into HEK293T cells for 48 to 72 hours. Active Ras levels were then assayed using a Ras activation assay kit (EMD Millipore, catalog #17-218). In brief, cells were lysed in Mg2+ lysis and wash buffer (25 mM HEPES, pH 7.5, 150 mM NaCl, 1% Igepal CA-630, 10 mM MgCl2, 1 mM EDTA, and 10% glycerol), and active GTPbound small G-proteins were pulled down using beads covalently bound to effector domains (Raf-1 RBD agarose). After washing beads, active GTP-bound small G proteins were recovered through the addition of 2× SDS sample buffer followed by SDS-PAGE and subsequent immunoblotting for the Ras (anti-Ras, clone RAS10, EMD Millipore, catalog #05-516, 1:1000 dilution). COS cells or HEK293T cells originally obtained from ATCC (COS cells: catalog #CRL-1651; HEK293T cells: catalog #CRL-3216) were thawed from liquid nitrogen and maintained in a medium consisting of Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) (Hyclone), and 1% penicillin-streptomycin (10,000 U/ml) (Thermo Fisher Scientific). Cells were maintained at 37°C in an incubator with 5% CO2 and passaged <20 total times. For the g8-PSD95-SynGAP competition assay, the cells were fixed by 4% paraformaldehyde and phosphate-buffered saline (PBS) for 20 min at room temperature after 16 to 24 hours of transfection. After three washes with PBS, coverslips were mounted in PermaFluor mounting medium (Thermo Fisher Scientific). Cultured primary hippocampal neurons were prepared as described previously (7) with some modifications. Briefly, hippocampi were dissected from embryonic day 18 (E18) rat pups (both female and male; strain name: Sprague Dawley, envigo/inotiv, catalog #002) before dissociation by papain treatment and mechanical trituration. Cells were plated on coverslips treated with 25 mM poly-L-Lysine in Neurobasal medium (Gibco) supplemented with 5% horse serum (Hyclone), 1% penicillin-streptomycin (10,000 U/ml) (Thermo Fisher Scientific), 2 mM GlutaMAX Supplement (Thermo Fisher Scientific), and 2% B27 supplement (Gibco) (NM5). One day after plating, the medium was replaced with medium lacking horse serum (NM0). Neurons were maintained in an incubator at 37°C with 5% CO2 for up to 21 days, and medium (NM0) was changed once per week over the duration of the culture. y Western blotting (SDS–polyacrylamide gel electrophoresis) Ras activation assay Cell culture g All constructs used in this study were generated using standard restriction cloning protocols. GFP-TARP g8 was generated by synthesizing a double-stranded gene fragment (gBlock, IDT) with an engineered 5′ SalI site and a 3′ NotI site, followed by restriction subcloning into the CMV-driven GFP-C3 expression vector. For experiments involving purified proteins, coding sequences of proteins of interest(SynGAP CC-PBM [156 amino acids (24)], PSD95 full length (24), and g8 C-terminal tail [198 amino acids (25)] were cloned into pGEX-6p bacterial expression vectors to generate protein products with an N-terminal GST tag with an engineered PreScission Protease recognition site for tag removal after isolation. Expression constructs for GFP-g8 C-terminal tail (198 amino acids) (25) were cloned into pEGFP expression vectors to generate protein products with an N-terminal GFP tag. Other constructs used in the chemical LTP assay and COS cell competition assay were described previously (7, 40, 41) or fig. S5. Signaling Technology (catalog #9102 and #9101) (1:1000 dilution). GAPDH was detected by the antibody obtained from Cell Signaling Technology (catalog #2118) (1:1000 dilution). Ras antibody was described in Ras activation assay section. IRDye 680RD or 800CW donkey antimouse IgG and goat anti-Rabbit IgG secondary antibodies (LI-COR Biosciences) were used to detect primary antibodies of the appropriate species. p Materials and methods Molecular biology and cloning of total protein) for a final 1× concentration. Samples were sonicated with a probe sonicator before heating at 90°C for 5 min to facilitate complete protein denaturation. Samples were then loaded into precast Bolt 4 to 12% gradient Bis-Tris 1.0-mm gels (Invitrogen, Thermo Fisher Scientific, catalog #NW04120BOX) soaked in Bolt MOPS (Invitrogen, Thermo Fisher, catalog #B000102) or MES SDS running buffers (Invitrogen, Thermo Fisher Scientific, catalog #B0002) depending on the molecular weights of the proteins of interest. Proteins were separated on the basis of molecular weight by SDS–polyacrylamide gel electrophoresis (SDS-PAGE). Proteins were then transferred to a 0.2-mm nitrocellulose membrane (Amersham Protran NC). Membranes were blocked with Intercept Trisbuffered saline blocking buffer (LI-COR Biosciences) for 30 min; incubated with primary antibodies targeted to the proteins of interest in a solution of Tris-buffered saline with 0.1% Tween-20 (TBST) with 1.5% w/v bovine serum albumin (BSA) and 0.1% sodium azide overnight at 4°C with gentle rocking; washed with TBST three times for 5 min each before incubation with species-specific fluorescent secondary antibodies (LI-COR Biosciences) directed against bound primary antibodies for 1 hour at room temperature in the dark; washed with TBST three times for 10 min each, followed by Tris-buffered saline 1 time for 5 min; and then imaged using the Odyssey CLx Imaging system. Protein bands were quantified using Image Studio software.
RES EARCH | R E S E A R C H A R T I C L E cLTP stimulation All animals (rats and mice) used in this study were housed in the Johns Hopkins University School of Medicine (JHU SOM) animal facility according to Institutional Animal Care and Use Committee guidelines. SynGAP+/− KO mice were generated using a BAC transgene at the Transgenic Core Facility of JHU SOM (19). Mice were backcrossed onto the C57BL/6 background. SynGAP+/GAP* and SynGAPGAP*/GAP* mice were engineered using CRISPR/Cas9 genome editing, resulting in two amino acid changes (F484A and R485L) on a mixed C57BL/6J background. Cas9 was targeted to the genomic sequence of interest using the following guide RNA (gRNA) sequence: 5′-GCGTGTTCTCTCGGAATATG-3′. The following 94-bp edited oligo donor template containing nine point mutations (five silent and four to generate FR→AL mutations) was introduced: 5′-ATCAGT CTCATATACTCTTCTATGGCTTTAGTGGCTAGCGTATTCTCGAG AGCGATTAAGTGTTCCCGCTCCATGAATCGGTCTACCTCTGACA-3′. The protospacer adjacent motif (PAM) was destroyed, and two restriction sites (XhoI and NheI) were engineered downstream of the FR→AL mutations for founder screening. Animals SynGAP heterozygous KO mice that have been previously described (19), SynGAP GAP mutants (+/GAP*, GAP*/GAP*), and WT (+/+) 12 of 15 , 1 March 2024 Generation of Syngap1-GAP-mutant KI mice y Live imaging and quantification of LTP were performed as described previously (7). Hippocampal neurons from E18 rats were seeded on 25-mm poly-L-lysine–coated coverslips. The cells were plated in Neurobasal medium (Gibco) containing 50 U/ml penicillin, 50 mg/ml streptomycin, and 2 mM GlutaMax supplemented with 2% B27 (Gibco) and 5% horse serum (Hyclone). Starting at 6 DIV, cells were maintained in glia-conditioned NM1 [Neurobasal media with 2 mM GlutaMax, 1% FBS, 2% B27, 1× FDU (5 mM uridine, Sigma catalog #F0503), and 5 mM 5-fluro-2 -deoxyuridine (Sigma catalog #U3003)]. Cells were transfected at 17 to 19 DIV with Lipofectamine 2000 (Invitrogen) in accordance with the manufacturer’s instructions. After 2 days, coverslips were placed on a custom perfusion chamber with basal ECS [143 mM NaCl, 5 mM KCl, 10 mM Hepes, pH 7.42, 10 mM glucose, 2 mM CaCl2, 1 mM MgCl2, 0.5 mM tetrodotoxin (TTX), 1 mM strychnine, and 20 mM bicuculline], and time-lapse images were acquired with either an LSM880 (Carl Zeiss) or a spinning disk confocal microscope controlled by Axiovision software (Carl Zeiss). After 5 to 10 min of baseline recording, cells were perfused with 10 ml of glycine without magnesium ECS (143 mM NaCl, 5 mM KCl, 10 mM HEPES, pH 7.42, 10 mM glucose, 2 mM CaCl2, 0 mM MgCl2, 0.5 mM TTX, 1 mM strychnine, 20 mM bicuculline, and 200 mM glycine) for 10 min, followed by 10 ml of basal ECS. To stabilize the imaging focal plane for long-term experiments, we used Definite focus (Zeiss). For quantification, we selected pyram- y g Araki et al., Science 383, eadk1291 (2024) Purified proteins were labeled by iFluor-488/ 568/633 succinimidyl ester (AAT Bioquest, catalog #1023/1049/1030) as previously described (28). Fluorescence-labeled protein was mixed with corresponding unlabeled protein at a ratio of 1:20. For the imaging assay, g8 C-terminal tail (50 mM) and PSD95 full-length (10 mM), and SynGAP CC-PBM (10 mM) were mixed in cleavage buffer plus 5% polyethylene glycol in a total volume of 10 ml. Each condition mixture was injected into a flowmetry chamber composed of a #1.5H coverslip (Carl Zeiss, catalog #474030-9000) and a slide glass separated by two layers of double-sided tape as a spacer). A Zeiss LSM880 confocal microscope [20× Plan-Apochromat M27, air, numerical aperture (NA) 0.8, or 63× Plan-Apochromat M27, oil-immersion, NA 1.4, Carl Zeiss] was used for DIC and fluorescent imaging at room temperature. ImageJ software was used for analyzing images. y GST-tagged SynGAP CC-PBM (156 amino acids) (24), PSD95 full length (24), and the g8 C-terminal tail (198 amino acids) (25) were expressed in Escherichia coli BL21 in Luria broth medium at 37°C for ~3 hours. Protein expression was induced by 0.1 mM IPTG (final concentration) at OD600 around 1.0 at 30°C. Proteins were purified using glutathione agarose affinity column, and GST tags were cleaved by PreScission Protease (Cytiva, catalog #270843-01) with a cleavage buffer containing 50 mM Hepes, pH 7.4, 50 mM NaCl, 1 mM EDTA, and 1 mM dithiothreitol. Purified proteins eluted from the affinity column were then collected and their concentrations determined by Nanodrop. g8 proteins were further Protein fluorescence labeling and an imaging-based assay of phase separation idal neurons on the basis of morphology that consisted of a clear primary dendrite and quantified all spines on the 30- to 40-mm stretch of the secondary dendrite beginning just after the branch from the primary dendrite. For identifying spine regions, we used the mCherry channel to select the spine region that was well separated from the dendritic shaft. These ROIs in the mCherry channel were transferred to the green/blue channel to quantify either SEP-GluA1, GFP-g8, or Azurite-SynGAP content in synaptic spines. Total signals of each channel were normalized by the signal density of adjacent dendritic regions to control for different expression levels of each protein in different cells. Total relative spine volume [in arbitrary units (A.U.)] was calculated as follows: average red signal at ROI (synaptic spine) – average red density at background region) * (area of ROI)/(average red signal at ROI (adjacent dendritic region) – average red density at background region). Total SEPGluA1, GFP-g8, or Azurite-SynGAP content at synaptic spine was calculated as follows: average signal at ROI (synaptic spines) – average density at background region) * (area of ROI)/ (average signal at ROI (adjacent dendritic region) – (average density at background region). All values are represented as the relative ratio to the value of WT rescue before stimulation (as 1.0). g Protein purification concentrated using an Amicon Ultra centrifugal filter with MWCO 3K (Merck Millipore, catalog #UFC500324). p cells were preincubated for 20 min in basal extracellular solution (ECS) (150 mM NaCl, 3 mM KCl, 2 mM CaCl2, 10 mM HEPES, pH 7.4, 10 mM D-(+)-glucose, and 1 mM MgCl2) at 37°C with 0% CO2 before being transferred to a custom-made imaging chamber filled with basal ECS. Experiments were performed at 37°C. For the FRAP assay, single z plane images were taken while focused on the basal coverglass-adjacent plasma membrane with the same 63× objective and 2× digital zoom. Images were acquired every 10 s using 488-, 561-, and 633-nm lasers. Five baseline images were acquired before photobleaching at a single circular region of interest (ROI) drawn by the experimenter (~2.5 mm square shape). Images were analyzed using ImageJ. All FRAP ROI mean intensity values were normalized to both the intensity before bleach and bleach depth to extract the recovery fraction. Cultured hippocampal neurons were transiently transfected with the desired cDNA constructs using Lipofectamine 2000 at 17 to 19 DIV 36 to 48 hours preceding the start of the experiment. The molecular replacement of SYNGAP1 in primary cultured neuron was described previously (7). Briefly, SynGAP pLKO KD vector with the shRNA sequence (SYNGAP1-#5: CCT GGA TGA AGA CTC CAT TAT, which corresponds to nucleotides 597 to 617 of rat SynGAP: numbering according to NP_851606) was cotransfected with the Azurite-tagged shRNAresistant SynGAP (with TCT CGA GGA TTC TAT CAT; silent mutations are indicated by bold font at same positions of rat SynGAP) with either WT or various mutants as rescue constructs together with mCherry and SEPGluA1 or GFP-g8 before starting cLTP experiments. About 70% of endogenous SynGAP was knocked down by this treatment (7), which is well over the 50% loss that is universally observed in SRID patient model mice (42). Coverslips containing cultured neurons were subjected to the same preincubation protocol applied to COS cells before being loaded into the imaging chamber.
RES EARCH | R E S E A R C H A R T I C L E littermates were maintained on a mixed background of C57/B6J and 129/SvEv background strains. Animals were allowed ad libitum access to food and water and reared on a typical 12-hour light-dark cycle. All animal experiments used both male and female mice (aged 3 to 7 months) and were conducted in accordance with the guidelines implemented by the Institutional Animal Care and Use Committee at JHU under the protocol numbers MO20M372, MO23M52, and RA23M46. Acute slice preparation Each test mouse was placed in a photobeamequipped (16 × 16 configuration with equal spacing of 2.54 cm) plastic chamber (45 × 45 cm) and allowed to explore free from interference for 120 min. Ambulatory movements were tracked and analyzed using the Photobeam Activity System – Open Field (San Diego Instruments). Y-maze spontaneous alternation task After a 30-min acclimatization period, mice were placed in the center of a Y-maze in which the three arms were oriented 120 degrees from one another. Mice were allowed to explore the apparatus for 5 min. Arm entries were recorded when both of the mouse’s rear paws passed over the boundary line between the apparatus’s center region and arm region. An arm entry was recorded as an alternation when the mouse fully entered an arm that it had not visited most recently (e.g., arm A → arm B → arm C = alternation; arm A → arm B → arm A = not alternation). The percent alternation was calculated as the number of alternating arm entries divided by the total number of arm entries. The Y-maze apparatus was thoroughly cleaned between trials. Arm entries were 13 of 15 , 1 March 2024 Open field task y AAV: AAV2/9-hSyn1-DIO-eGFP-CW3SL (45) (titer: 1.79 × 1013 GC/ml) and AAV1.CamKII0.4. Cre.SV40 (https://www.addgene.org/105558/) (titer: 1.6 × 109 GC/ml) were injected to bilateral dorsal CA1 (coordinates: AP 1.9 mm; ML 1.6 mm DV 1.2 mm) for 0.5 ml of AAV mixture per each position into C57B6J WT and SynGAP GAP*/GAP* mice (2 months old) to sparsely label the pyramidal neurons. After 9 days of injection, mice were transcardially perfused with PBS followed by fixation solution (4% paraformaldehyde in PBS) under isoflurane anesthesia immediately before decapitation. The brain was removed from the skull Mice aged 2 to 4 months were subjected to behavioral tests, including the open-field test, to assess locomotion, the Y-maze spontaneous alternation task to assess working memory performance, and contextual plus cued fear conditioning to assess associative memory. All groups were approximately evenly divided (45 to 55%) between males and females. All animals were housed in the JHU SOM Miller Research Building (MRB) animal facility. All behavioral assays were performed in the JHU SOM Animal Behavioral Core. y g Araki et al., Science 383, eadk1291 (2024) Sparse GFP labeling of CA1 hippocampal neurons and measure of synaptic spine volume Behavior y Slices were placed in a submersion recording chamber with recirculating aerated ACSF at 30°C. Synaptic field excitatory postsynaptic potentials (fEPSPs) were evoked in response to electrical stimulation of the Schaeffer collateral inputs using a bipolar theta glass Ag/ AgCl electrode (3 MΩ) containing ACSF. Inputoutput curves were used to determine the half-maximal fEPSP amplitude, which was the stimulation intensity used to measure the fEPSP slope over a stable 20-min baseline period in response to a single 0.2-ms stimulation pulse delivered every 30 s. (A stable baseline period of 10 min with baseline fEPSP slope not drifting by >10% was the minimum required inclusion criteria for LTP recordings.) To induce LTP, four episodes of thetaburst stimulation (TBS) were triggered at 0.1 Hz. Each TBS episode consisted of 10 stimulus trains administered at 5 Hz, with one train consisting of 4 pulses at 100 Hz. After TBS, the fEPSP slope was measured for 60 min by delivering single electrical pulses every 30 s. The magnitude of LTP was quantified by Whole-cell recordings were performed as previously described (43, 44). Briefly, paired littermates of WT and SynGAPGAP*/GAP* mice (P23 to P24) were anesthetized, and 300-mmthick transverse hippocampal slices were prepared in dissection buffer containing 210 mM sucrose, 7 mM glucose, 26.2 mM NaHCO3, 2.5 mM KCl, 1 mM NaH2PO4 , and 7 mM MgSO4. Slices were recovered in a submersion chamber filled with oxygenated ACSF (119 mM NaCl, 26.2 mM NaHCO 3 , 11 mM glucose, 2.5 mM KCl, 1 mM NaH2PO4, 2.5 mM CaCl2, and 1.3 mM MgSO4) at 36°C for 30 min before recordings. During all recordings, slices were perfused in ACSF2 in the presence of 100 mM picrotoxin at the flow rate of ~3 ml/min at room temperature. The micropipettes (2.5 to 3.5 mOhm) were made of borosilicate glass (World Precision Instruments) with a Sutter micropipette puller (P-97) and filled with internal solution (115 mM Cs-MeSO 3 , 0.4 mM EGTA, 5 mM TEACl, 2.8 mM NaCl, 20 mM Hepes, 3 mM Mg-ATP, 0.5 mM Na2-GTP, 10 mM Na phosphocreatine, and 5 mM QX-314). Hippocampal CA1 excitatory neurons were held at –80 mV in a wholecell mode. Next, 1 mM TTX and 50 mM APV was applied into ACSF2. Signals were measured 5 min after whole-cell mode established with MultiClamp 700B amplifier and digitized using a Digidata 1440A digitizer (Molecular Devices). All data were sampled and digitized at 10 kHz with Clampex 11.2 software, filtered at 1 kHz and analyzed with Clampfit 10.7. Cells with <100 miniature events were discarded. Rise time was calculated at 20 to 80% of mEPSC rise phase and decay time was calculated at 10 to 90%. g Extracellular LTP recordings Extracellular mEPSC recordings and incubated in 4% paraformaldehyde overnight for postfixation. Coronal brain slices (50 mm thickness) were prepared using a vibratome (Leica VT1200S). Brain slices were mounted in PermaFluor mounting medium (Thermo Fisher Scientific) on glass slides. Images were acquired with either LSM880 (Carl Zeiss) (5× objective lens for entire hippocampus, 5-mm z-section for entire 50-mm thickness) or spinning disk confocal microscopes controlled by Axiovision software (Carl Zeiss) (10× objective lens for CA1 region; 2-mm z-section for total 30-mm thickness, 63× objective lens for synaptic spine imaging; 0.5-mm z-section for total 30-mm thickness). Total relative spine volume (arbitrary unit) was calculated as follows: average green signal at ROI (synaptic spine) – average green density at background region) * (area of ROI)/(average green signal at ROI adjacent dendritic region) – (average green density at background region). p SynGAP+/GAP*, SynGAPGAP*/GAP*, and SynGAP+/− mice (3 to 7 months of age), along with their respective WT (Syngap1+/+) littermates, were transcardially perfused with ice-cold aerated dissection buffer (212.7 mM sucrose, 5 mM KCl, 1.25 mM Na2PO4, 10 mM glucose, 26 mM NaHCO3, 0.5 mM CaCl2, 10 mM MgCl2) under isoflurane anesthesia immediately before decapitation. The brain was rapidly removed from the skull, and the hippocampi were extracted in a continuously oxygenated dissection buffer. Acute transverse hippocampal slices (400 mm thickness) were prepared using a vibratome (Leica VT1200S) and briefly washed of the sucrose-based dissection buffer in aerated artificial cerebrospinal fluid (ACSF) composed of the following (in mM): 119 NaCl, 5 KCl, 1.25 Na2PO4, 26 NaHCO3, 10 glucose, 2.5 CaCl2, and 1.5 MgCl2. Slices were then placed in a chamber containing ACSF at 30°C for 30 min and then transferred to room temperature for at least 60 min until being used for electrophysiological recordings. The experimenter was blinded to the animals’ genotypes until all experiments and analyses were completed. normalizing the fEPSP slope to the average baseline response, then calculating the average fEPSP slope between 40 and 60 min after TBS. Statistical comparisons were made exclusively between WT and mutant littermates with a Student’s t test, Mann-Whitney test, or one-way ANOVA.
RES EARCH | R E S E A R C H A R T I C L E recorded manually, and the experimenter was blind to the experimental conditions. The normality of the data was assessed using the Kolmogorov-Smirnov test, and groups were statistically compared using a one-way ANOVA followed by Tukey’s post hoc multiplecomparisons test. Contextual and cued fear conditioning , 14 of 15 y 1 March 2024 y g Araki et al., Science 383, eadk1291 (2024) y All statistical analyses were performed using GraphPad Prism software. Graphs were prepared using GraphPad Prism 8.0/9.0/10.0 Software or Microsoft Excel 16.36. In the figures, all error bars and shadows represent the SEM unless otherwise stated. We followed International Committee of Medical Journal Editors (ICMJE) guidelines for units of measurement [International Systems of Units (SI)]. The normality of the data was assessed using the Shapiro-Wilk test unless stated otherwise. Details regarding sample numbers (mouse number, neurons, and synaptic spines that were imaged) and experimental replicates were described in each figure legend. We did not exclude any outliers. We estimated sample 1. H. W. Kessels, R. Malinow, Synaptic AMPA receptor plasticity and behavior. Neuron 61, 340–350 (2009). doi: 10.1016/ j.neuron.2009.01.015; pmid: 19217372 2. R. L. Huganir, R. A. Nicoll, AMPARs and synaptic plasticity: The last 25 years. Neuron 80, 704–717 (2013). doi: 10.1016/ j.neuron.2013.10.025; pmid: 24183021 3. R. A. Nicoll, A brief history of long-term potentiation. Neuron 93, 281–290 (2017). doi: 10.1016/j.neuron.2016.12.015; pmid: 28103477 4. S. Shi, Y. Hayashi, J. A. Esteban, R. Malinow, Subunit-specific rules governing AMPA receptor trafficking to synapses in hippocampal pyramidal neurons. Cell 105, 331–343 (2001). doi: 10.1016/S0092-8674(01)00321-X; pmid: 11348590 5. J. Lisman, S. Raghavachari, A unified model of the presynaptic and postsynaptic changes during LTP at CA1 synapses. Sci. STKE 2006, re11 (2006). doi: 10.1126/stke.3562006re11; pmid: 17033044 6. P. Opazo, M. Sainlos, D. Choquet, Regulation of AMPA receptor surface diffusion by PSD-95 slots. Curr. Opin. Neurobiol. 22, 453–460 (2012). doi: 10.1016/j.conb.2011.10.010; pmid: 22051694 7. Y. Araki, M. Zeng, M. Zhang, R. L. Huganir, Rapid dispersion of SynGAP from synaptic spines triggers AMPA receptor insertion and spine enlargement during LTP. Neuron 85, 173–189 (2015). doi: 10.1016/j.neuron.2014.12.023; pmid: 25569349 8. Y. Yang, J. H. Tao-Cheng, T. S. Reese, A. Dosemeci, SynGAP moves out of the core of the postsynaptic density upon depolarization. Neuroscience 192, 132–139 (2011). doi: 10.1016/j.neuroscience.2011.06.061; pmid: 21736925 9. W. G. Walkup IV et al., A model for regulation by SynGAP-a1 of binding of synaptic proteins to PDZ-domain ‘Slots’ in the postsynaptic density. eLife 5, e16813 (2016). doi: 10.7554/ eLife.16813; pmid: 27623146 10. T. L. Mastro et al., A sex difference in the response of the rodent postsynaptic density to synGAP haploinsufficiency. eLife 9, e52656 (2020). doi: 10.7554/eLife.52656; pmid: 31939740 11. J. H. Kim, D. Liao, L. F. Lau, R. L. Huganir, SynGAP: A synaptic RasGAP that associates with the PSD-95/SAP90 protein family. Neuron 20, 683–691 (1998). doi: 10.1016/S0896-6273 (00)81008-9; pmid: 9581761 12. H. J. Chen, M. Rojas-Soto, A. Oguni, M. B. Kennedy, A synaptic Ras-GTPase activating protein (p135 SynGAP) inhibited by CaM kinase II. Neuron 20, 895–904 (1998). doi: 10.1016/ S0896-6273(00)80471-7; pmid: 9620694 g Statistics RE FERENCES AND NOTES 13. T. R. Gamache, Y. Araki, R. L. Huganir, Twenty years of SynGAP research: From synapses to cognition. J. Neurosci. 40, 1596–1605 (2020). doi: 10.1523/JNEUROSCI.0420-19.2020; pmid: 32075947 14. M. Sheng, E. Kim, The postsynaptic organization of synapses. Cold Spring Harb. Perspect. Biol. 3, a005678 (2011). doi: 10.1101/cshperspect.a005678; pmid: 22046028 15. J. J. Zhu, Y. Qin, M. Zhao, L. Van Aelst, R. Malinow, Ras and Rap control AMPA receptor trafficking during synaptic plasticity. Cell 110, 443–455 (2002). doi: 10.1016/S0092-8674 (02)00897-8; pmid: 12202034 16. N. H. Komiyama et al., SynGAP regulates ERK/MAPK signaling, synaptic plasticity, and learning in the complex with postsynaptic density 95 and NMDA receptor. J. Neurosci. 22, 9721–9732 (2002). doi: 10.1523/JNEUROSCI.22-2209721.2002; pmid: 12427827 17. K. Scheffzek et al., The Ras-RasGAP complex: Structural basis for GTPase activation and its loss in oncogenic Ras mutants. Science 277, 333–339 (1997). doi: 10.1126/ science.277.5324.333; pmid: 9219684 18. G. Rumbaugh, J. P. Adams, J. H. Kim, R. L. Huganir, SynGAP regulates synaptic strength and mitogen-activated protein kinases in cultured neurons. Proc. Natl. Acad. Sci. U.S.A. 103, 4344–4351 (2006). doi: 10.1073/pnas.0600084103; pmid: 16537406 19. J. H. Kim, H. K. Lee, K. Takamiya, R. L. Huganir, The role of synaptic GTPase-activating protein in neuronal development and synaptic plasticity. J. Neurosci. 23, 1119–1124 (2003). doi: 10.1523/JNEUROSCI.23-0401119.2003; pmid: 12598599 20. J. P. Clement et al., Pathogenic SYNGAP1 mutations impair cognitive development by disrupting maturation of dendritic spine synapses. Cell 151, 709–723 (2012). doi: 10.1016/ j.cell.2012.08.045; pmid: 23141534 21. X. Guo et al., Reduced expression of the NMDA receptorinteracting protein SynGAP causes behavioral abnormalities that model symptoms of Schizophrenia. Neuropsychopharmacology 34, 1659–1672 (2009). doi: 10.1038/npp.2008.223; pmid: 19145222 22. R. Nakajima et al., Comprehensive behavioral analysis of heterozygous Syngap1 knockout mice. Neuropsychopharmacol. Rep. 39, 223–237 (2019). doi: 10.1002/npr2.12073; pmid: 31323176 23. E. D. Ozkan et al., Reduced cognition in Syngap1 mutants is caused by isolated damage within developing forebrain excitatory neurons. Neuron 82, 1317–1333 (2014). doi: 10.1016/j.neuron.2014.05.015; pmid: 24945774 24. M. Zeng et al., Phase transition in postsynaptic densities underlies formation of synaptic complexes and synaptic plasticity. Cell 166, 1163–1175.e12 (2016). doi: 10.1016/ j.cell.2016.07.008; pmid: 27565345 25. M. Zeng et al., Phase separation-mediated TARP/MAGUK complex condensation and AMPA receptor synaptic transmission. Neuron 104, 529–543.e6 (2019). doi: 10.1016/ j.neuron.2019.08.001; pmid: 31492534 26. B. Wang et al., Liquid-liquid phase separation in human health and diseases. Signal Transduct. Target. Ther. 6, 290 (2021). doi: 10.1038/s41392-021-00678-1; pmid: 34334791 27. S. Banjade, M. K. Rosen, Phase transitions of multivalent proteins can promote clustering of membrane receptors. eLife 3, e04123 (2014). doi: 10.7554/eLife.04123; pmid: 25321392 28. M. Zeng et al., Reconstituted postsynaptic density as a molecular platform for understanding synapse formation and plasticity. Cell 174, 1172–1187.e16 (2018). doi: 10.1016/ j.cell.2018.06.047; pmid: 30078712 29. F. F. Hamdan et al., Mutations in SYNGAP1 in autosomal nonsyndromic mental retardation. N. Engl. J. Med. 360, 599–605 (2009). doi: 10.1056/NEJMoa0805392; pmid: 19196676 30. M. H. Berryer et al., Mutations in SYNGAP1 cause intellectual disability, autism, and a specific form of epilepsy by inducing haploinsufficiency. Hum. Mutat. 34, 385–394 (2013). doi: 10.1002/humu.22248; pmid: 23161826 31. A. Sumioka, D. Yan, S. Tomita, TARP phosphorylation regulates synaptic AMPA receptors through lipid bilayers. Neuron 66, 755–767 (2010). doi: 10.1016/j.neuron.2010.04.035; pmid: 20547132 32. W. E. Tidyman, K. A. Rauen, Expansion of the RASopathies. Curr. Genet. Med. Rep. 4, 57–64 (2016). doi: 10.1007/s40142016-0100-7; pmid: 27942422 33. E. H. Cook, J. T. Masaki, S. J. Guter, F. Najjar, Lovastatin treatment of a patient with a de novo SYNGAP1 protein p Contextual and cued fear conditioning was performed as previously described (21). Animals were handled (picked up and held by the experimenter for 30 s) daily for 14 days before training. Before this test, mice were kept in a soundproof room separate from the testing room for 30 min. To assess fear‐related learning and memory, mice were placed singly in an acrylic chamber of PVC plastic walls (33 × 25 × 28 cm) with a stainless‐steel grid floor (0.2 cm diameter, spaced 0.5 cm apart). Between mice for conditioning and context testing, the walls and grids of the chamber were wiped with 70% ethanol. In the cued test, the walls and floor were cleaned with 1% acetic acid. Animals were placed in the conditioning chamber (Video Freeze; Med Associates) and allowed to explore for 120 s, after which a tone (90 dB) was presented for 30 s, which coterminated with a footshock (1 s, 0.5 mA). This tone-shock pairing occurred three times per session, with an intertrial interval of 90 s. After the third and final shock, the animals remained in the training chamber for 90 s. Twenty-four hours later, the animals were returned to the chamber. Contextual memory was assessed by the percentage of time spent freezing for 600 s (no shock presentation). Twenty-four hours later, the dimensions, as well as the visual, tactile, and olfactory cues (cleaning with 1% acetic acid) of the conditioning chamber, were altered to create a novel context for the mice. Cued fear learning was assessed in this novel context by measuring the average percent freezing per minute for 300 s without and 300 s with the presentation of the 90 dB auditory cue (CS). sizes on the basis of previous experiments in the laboratory, which are comparable to the other studies in the field. We randomly allocated culture dishes and mice in every set of experimental conditions. Each data points are shown in figures. All behavioral experiments were conducted blind to the genotype and/or treatment. Only after all data were collected was a correspondence table opened, linking the provisional experimental group names with the formal names where the genotype and/or treatment details were known. Western blot data were analyzed using a one-way ANOVA followed by Tukey’s post hoc multiple-comparisons test unless stated otherwise. For all behavior testing, the normality of the data was assessed using the Kolmogorov-Smirnov test. In the Y-maze spontaneous alternation task, groups were compared using a one-way ANOVA followed by Tukey’s post hoc multiple-comparisons test. For contextual and cued fear conditioning, mutant mice were compared with their WT littermates during the context trial using a one-way repeated-measures ANOVA. With and without cue was compared within each genotype using a one-way ANOVA. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.
RES EARCH | R E S E A R C H A R T I C L E 34. 35. 36. 37. 38. 39. 41. X. Chen et al., Arc weakens synapses by dispersing AMPA receptors from postsynaptic density via modulating PSD phase separation. Cell Res. 32, 914–930 (2022). doi: 10.1038/ s41422-022-00697-9; pmid: 35856091 42. Y. Araki et al., Mouse models of SYNGAP1-related intellectual disability. Proc. Natl. Acad. Sci. U.S.A. 120, e2308891120 (2023). doi: 10.1073/pnas.2308891120; pmid: 37669379 43. H. L. Tan, S. L. Chiu, Q. Zhu, R. L. Huganir, GRIP1 regulates synaptic plasticity and learning and memory. Proc. Natl. Acad. Sci. U.S.A. 117, 25085–25091 (2020). doi: 10.1073/ pnas.2014827117; pmid: 32948689 44. A. R. Graves et al., Visualizing synaptic plasticity in vivo by large-scale imaging of endogenous AMPA receptors. eLife 10, e66809 (2021). doi: 10.7554/eLife.66809; pmid: 34658338 45. I. Hong et al., Calcium-permeable AMPA receptors govern PV neuron feature selectivity. bioRxiv, 2023.2007.2020.549908 (2023). doi: 10.1101/2023.07.20.549908 ACKN OWLED GMEN TS We thank all members of the Huganir lab for discussion and support throughout this work, especially S. Ju, R. Oba, S. Myung, S. H. Kwon, and S. Glavaris for reagent preparation and critical reading of the manuscript. We also thank the Bridge the Gap SYNGAP Education and Research Foundation, the SynGAP Research Fund, and all the patients of SYNGAP1-related intellectual disability and their families for their outreach and advocacy. Funding: This work was supported by the National Institutes of Health (grants R01MH112151 and R01NS036715 to R.H. and grant T32MH015330 to K.R.) and the SynGAP Research Fund (R.H.). Author contributions: Conceptualization: Y.A., T.G., R.H.; Formal analysis: Y.A., K.R., E.G., T.G., R.J., T.H.N.T., Q.Z.; Funding acquisition: R.H.; Investigation: Y.A., K.R., E.G., T.G., R.J., T.H.N.T., Q.Z.; Methodology: Y.A., B.L., I.H.; Project administration: R.H.; Supervision: R.H., A.K.; Visualization: Y.A., K.R., E.G., T.G.; Writing – original draft: Y.A., K.R., E.G., T.G., R.H.; Writing – review and editing: Y.A., E.G., I.H., R.H. Competing interests: R.H. is a scientific cofounder and scientific advisory board (SAB) member of Neumora Therapeutics and SAB member of MAZE Therapeutics. Y.A, R.C.J, I.H., and R.L.H are listed as inventors on pending patent claims (US 2021/0180062, PCT/US2023/065370, and PCT/US2023/ 065364) filed by Johns Hopkins University covering therapeutic strategies for SYNGAP1-related intellectual disability. The remaining authors declare no competing interests. Data and materials availability: All data are available in the main text or the supplementary materials. License information: Copyright © 2024 the authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original US government works. https://www.science.org/about/sciencelicenses-journal-article-reuse SUPPLEMENTARY MATERIALS science.org/doi/10.1126/science.adk1291 Figs. S1 to S10 MDAR Reproducibility Checklist Submitted 4 August 2023; accepted 28 December 2023 10.1126/science.adk1291 p 40. truncating variant. J. Child Adolesc. Psychopharmacol. 29, 321–322 (2019). doi: 10.1089/cap.2018.0159; pmid: 30901256 G. Kluger, C. von Stülpnagel-Steinbeis, S. Arnold, K. Eschermann, T. Hartlieb, Positive short-term effect of low-dose rosuvastatin in a patient with SYNGAP1-associated epilepsy. Neuropediatrics 50, 266–267 (2019). doi: 10.1055/ s-0039-1681066; pmid: 30875700 K. J. Karczewski et al., The mutational constraint spectrum quantified from variation in 141,456 humans. Nature 581, 434–443 (2020). doi: 10.1038/s41586-020-2308-7; pmid: 32461654 D. Taliun et al., Sequencing of 53,831 diverse genomes from the NHLBI TOPMed Program. Nature 590, 290–299 (2021). doi: 10.1038/s41586-021-03205-y; pmid: 33568819 S. Tadaka et al., jMorp updates in 2020: Large enhancement of multi-omics data resources on the general Japanese population. Nucleic Acids Res. 49, D536–D544 (2021). doi: 10.1093/nar/gkaa1034; pmid: 33179747 D. R. M. Vlaskamp et al., SYNGAP1 encephalopathy: A distinctive generalized developmental and epileptic encephalopathy. Neurology 92, e96–e107 (2019). doi: 10.1212/ WNL.0000000000006729; pmid: 30541864 C. Mignot et al., Genetic and neurodevelopmental spectrum of SYNGAP1-associated intellectual disability and epilepsy. J. Med. Genet. 53, 511–522 (2016). doi: 10.1136/jmedgenet2015-103451; pmid: 26989088 Y. Araki et al., SynGAP isoforms differentially regulate synaptic plasticity and dendritic development. eLife 9, e56273 (2020). doi: 10.7554/eLife.56273; pmid: 32579114 g y y g y , Araki et al., Science 383, eadk1291 (2024) 1 March 2024 15 of 15
RES EARCH RESEARCH ARTICLE ◥ NEUROSCIENCE Retrograde endocannabinoid signaling at inhibitory synapses in vivo Barna Dudok1,2*†, Linlin Z. Fan3†, Jordan S. Farrell2,4,5, Shreya Malhotra2, Jesslyn Homidan2, Doo Kyung Kim3, Celestine Wenardy3, Charu Ramakrishnan6, Yulong Li7, Karl Deisseroth3,8,9, Ivan Soltesz2 Departments of Neurology and Neuroscience, Baylor College of Medicine, Houston, TX 77030, USA. 2Department of Neurosurgery, Stanford University, Stanford, CA 94305, USA. 3 Department of Bioengineering, Stanford University, Stanford, CA 94305, USA. 4F.M. Kirby Neurobiology Center and Rosamund Stone Zander Translational Neuroscience Center, Boston Children’s Hospital, Boston, MA 02115, USA. 5 Department of Neurology, Boston Children’s Hospital, Harvard Medical School, Boston, MA 02115, USA. 6Cracking the Neural Code (CNC) Program, Stanford University, Stanford, CA 94305, USA. 7State Key Laboratory of Membrane Biology, School of Life Sciences, Peking University, Beijing 100871, China. 8Department of Psychiatry and Behavioral Sciences, Stanford University, Stanford, CA 94305, USA. 9 Howard Hughes Medical Institute, Stanford, CA 94305, USA. *Corresponding author. Email: barna.dudok@bcm.edu †These authors contributed equally to this work. y , 1 March 2024 y g Fig. 1. Rapid eCB signaling in the hippocampus in vivo. (A) GRABeCB2.0 and jRGECO1a were expressed in CA1 neurons. Head-fixed mice ran on a linear treadmill during multiphoton imaging. (B) Event-aligned average single-cell calcium and eCB responses during calcium transients. Plot shows mean responses (line) ± SEM (shaded area) for n = 4 sessions from n = 4 vehicle-treated mice, 607 ± 241 ROIs per session, and 5.2 ± 1.1 peaks per ROI. Labels show decay time constants of exponential fits. (C) Analysis of place cells. Average tuning curves (solid black line) were calculated for each session by aligning location-averaged place cell traces on their preferred location. (D) Average spatial tuning curves (±SEM) are shown centered on the preferred location of place cells (red indicates calcium) together with the tuning curves of eCB signals from the same cells (blue) or after shuffling cells within sessions (gray). One-sided, one-sample t test with alternative hypothesis m > 0: P = 5.67 × 10–5, n = 4 male mice; shuffle: P = 0.88. Plots show average tuning curves (line) ± SEM (shaded area), n = 4 sessions from n = 4 drug-naïve mice and 161 ± 35 place cell ROIs per session. Dudok et al., Science 383, 967–970 (2024) y triggers eCB synthesis and the retrograde activation of cannabinoid type-1 receptors (CB1s), which in turn suppresses GABA release. In the CA1 region of the hippocampus, the highest CB1 expression is found on axons of perisomatically projecting GABAergic basket cells that also express cholecystokinin (CCKBCs) (6–8). Conversely, the other major basket cell type, parvalbumin-expressing basket cells (PVBCs), do not express CB1s. Correspondingly, DSI is 1 g S trong depolarization of neurons can induce a transient suppression of their inhibitory synaptic inputs in acute brain slices (1, 2). Such retrograde, activitydependent suppression of GABAergic synapses, referred to as depolarization-induced suppression of inhibition (DSI), is mediated by endocannabinoid (eCB) signaling (3–5). In vitro studies have shown that robust postsynaptic calcium (post-Ca) increase during DSI p Endocannabinoid (eCB)–mediated suppression of inhibitory synapses has been hypothesized, but this has not yet been demonstrated to occur in vivo because of the difficulty in tracking eCB dynamics and synaptic plasticity during behavior. In mice navigating a linear track, we observed locationspecific eCB signaling in hippocampal CA1 place cells, and this was detected both in the postsynaptic membrane and the presynaptic inhibitory axons. All-optical in vivo investigation of synaptic responses revealed that postsynaptic depolarization was followed by a suppression of inhibitory synaptic potentials. Furthermore, interneuron-specific cannabinoid receptor deletion altered place cell tuning. Therefore, rapid, postsynaptic, activity-dependent eCB signaling modulates inhibitory synapses on a timescale of seconds during behavior. maximally potent at CCKBC inputs to pyramidal cells and is capable of completely muting these synapses (9, 10). DSI has been hypothesized to also occur in vivo, but the specific neuronal activity patterns that give rise to DSI remain unknown (11). When mammals navigate their environment, individual hippocampal pyramidal cells discharge at specific place fields (11, 12), and several observations are consistent with the possibility that place cell firing in behaving animals may engage a DSI-like phenomenon. In vitro, externally imposed place cell–like activity can drive DSI (13), and disinhibition of the postsynaptic cells by DSI can facilitate excitatory synapse plasticity (14, 15). In vivo, place cell formation is supported by reduced inhibition (16, 17). A potential role of DSI in hippocampal place field properties has been proposed 1 of 4
RES EARCH | R E S E A R C H A R T I C L E (18); however, the steps that would underlie a retrograde, eCB-mediated, DSI-like plasticity in vivo have remained speculative, and the hypothesis that DSI contributes to place cell disinhibition has remained untested. Here, we used optical methods in mice navigating a linear track to test (i) whether place cell activity in behaving animals is sufficient to trigger eCB synthesis in the postsynaptic cell, (ii) whether eCB signals affect presynaptic CB1s on GABAergic terminals in vivo, and (iii) whether DSI-like plasticity can modulate place cell activity patterns. Location-specific eCB signaling by place cells , 2 of 4 y 1 March 2024 y g Dudok et al., Science 383, 967–970 (2024) y Fig. 2. Spatially tuned presynaptic eCB signals in the hippocampus in vivo. (A) Labeling strategy for in vivo imaging. Interneuronal GRABeCB2.0 and pan-neuronal jRGECO1a expression were combined. Bottom panels show the segmentation approach. Neuron cell bodies were segmented in the jRGECO1a channel (post-Ca). The ROIs were enlarged by binary dilation for measuring signals in the neighboring axons in the GRABeCB2.0 channel (pre-eCB). (B) Average spatial tuning curves (±SEM) are shown centered on the preferred location of place cells (red indicates calcium) together with the tuning curves of eCB signals from the corresponding pre-eCB ROIs (blue) or after shuffling ROIs within sessions (gray), n = 18 sessions from n = 5 mice and 193 ± 130 ROIs per session. (C) Quantification of signal intensity at the preferred location. Boxes indicate median ± interquartile range; whiskers: nonoutlier range; markers: recording sessions. pre-eCB: P = 0.002, n = 5 mice (n = 3 males and n = 2 females); shuffle: P = 0.69. (D) Spatial tuning curves are shown after injecting mice with JZL-184 to inhibit the enzymatic breakdown of the eCB 2-AG by MGL or after vehicle injection. (E) Quantification of location-specific pre-eCB signals, P = 0.0004, Mann-Whitney test, n = 14 vehicle sessions from n = 5 mice and n = 6 JZL sessions from n = 3 mice. g mobilization in place cells during exploration is specific to the cell’s preferred location. By contrast, non-place cells had lower calcium and accompanying eCB transient amplitudes compared with place cells in the same field of view (fig. S1G). Although the molecular mechanisms of retrograde eCB transport are not precisely understood, there is general agreement that DSI requires the postsynaptically generated eCBs to engage presynaptic CB1s on interneuronal terminals impinging on the activated neuron (4, 27). Thus, we specifically allowed the expression of GRABeCB2.0 only in interneurons using Dlx5/6-Cre transgenic mice (28) to enable presynaptic eCB measurements (fig. S2A). The distribution of GRABeCB2.0, a chimera of CB1 and a green fluorescent protein variant, resembled membrane-enriched CB1 targeting (29) in interneuron axon terminals, with no detectable postsynaptic expression in principal cells and relatively low expression in interneuron somata (fig. S2, B to F). For simultaneously imaging somatic calcium and axonal eCB transients, we combined interneuronal GRABeCB2.0 and pan-neuronal, red-shifted calcium sensor expression (Fig. 2A and fig. S2E). We generated somatic, putatively post-Ca ROI sets as above and measured nearby axonal, putatively presynaptic eCB (pre-eCB) signals after enlarging the somatic p The genetically encoded G protein–coupled receptor activation based eCB reporter GRABeCB2.0 enables the recording of eCB dynamics with high spatial resolution in vivo (19, 20). eCB mobilization during DSI depends on post-Ca influx (21). To characterize eCB signaling related to calcium transients, we expressed GRABeCB2.0 and the red-shifted calcium sensor jRGECO1a (22) in CA1 neurons. We performed two-photon dual calcium and eCB imaging in the pyramidal layer while mice ran several laps on a linear treadmill track with tactile cues (Fig. 1A) (23). We segmented regions of interest (ROIs) corresponding to neuronal somata (most of which in the pyramidal layer are expected to belong to pyramidal cells) (24) and measured calcium and eCB signals in the same ROIs. We analyzed calcium transients by finding peaks on traces of fluorescence change over baseline (DF/F) (Fig. 1B). Transient eCB signals were detected concomitant with calcium peaks (Fig. 1B), with a peak delayed by 1.04 ± 0.16 s relative to calcium and an average decay time constant of 3.53 ± 0.75 s. To investigate which eCB ligand contributes to the transients, we performed the latter analysis on datasets that we previously recorded in the presence of ligandspecific inhibitors of eCB synthesis or metabolism (20). Calcium peak–coupled eCB transients were suppressed by inhibiting the synthesis of 2-arachidonoylglycerol (2-AG), the eCB species involved in CA1 DSI in vitro (25). Furthermore, eCB transient durations were extended after we treated mice with JZL 184 to inhibit monoacylglycerol lipase (MGL) and thus 2-AG degradation (25, 26) (fig. S1, A to C). Conversely, manipulations altering the synthesis or degradation of the other major eCB species, anandamide (AEA), had no effect on the in vivo eCB transients (fig. S1, D to F). Next, to investigate eCB dynamics specifically in place cells, we identified place cells by calculating location-specific average calcium signals (Fig. 1C). Average eCB signals were elevated around the same track locations where calcium was high in the same individual place cells (Fig. 1D). These results indicate that eCB
RES EARCH | R E S E A R C H A R T I C L E ROIs (Fig. 2A). Similar to eCB signals measured in place cell somata (Fig. 1D), pre-eCB signals in interneuronal axons surrounding place cells were elevated at the same track locations where post-Ca was high (Fig. 2, B and C). These results indicate that place cell activations during behavior are accompanied by eCB signaling at perisomatic inhibitory axons. Similarly to DSI in vitro (30) and calcium transient–related post-eCB signals in vivo (fig. S1B), location-specific pre-eCB signals around place cells were magnified by pharmacological inhibition of 2-AG degradation (Fig. 2, D and E), consistent with a prominent role of 2-AG in inhibitory axon eCB signaling while not ruling out the partial involvement of other eCBs such as AEA. p g y y g y , Fig. 3. Inhibitory synaptic plasticity in behaving mice. (A) Labeling strategy for the all-optical assay of CCKBC synaptic function in vivo. (B) Top: example unfiltered fluorescence traces from four CA1 neurons [(a) to (d)]. Bottom: spike raster (n = 30 neurons from n = 5 mice). Cyan bars indicate CCKBC photostimulation onset (488 nm, 10 ms duration, 9.5 to 20 mW/mm2, 0.5 Hz). (C) Mean subthreshold postsynaptic waveforms after presynaptic CCKBC photostimulation (n = 30 neurons from n = 5 mice). (D) Unfiltered example traces of plateau-driven complex spikes (CS, red arrows) preceding photostimulation events. (E) Additional example traces from the same cells as in (D) without complex spikes occurring within 1 s before the stimulation. (F) Stimulus-triggered average (mean ± SEM) oeIPSP (black: with CS; orange: without CS). (G) Quantification of neuronal depolarization before stimulation Dudok et al., Science 383, 967–970 (2024) 1 March 2024 and oeIPSP amplitudes (negative values) during trials with or without preceding complex spikes (depolarization: P = 0.0076, paired t test, n = 15 cells from n = 4 mice; oeIPSP amplitude: P = 0.0045). (H) Histograms of place field sizes of individual place cells in control mice and after cell-type-specific CB1 KO in GABAergic neurons (GABA-CB1-KO). n = 420 ± 254 place cells from n = 5 control and n = 3 GABA-CB1-KO mice. (I) Quantification of place cell place field size and spatial information. n = 13 sessions from n = 2 male and n = 2 female control mice; n = 19 sessions from n = 3 male GABA-CB1-KO mice. Markers and box plots show individual sessions (boxes: median ± interquartile range, whiskers: nonoutlier range). Place field size: P = 0.032, c2(1) = 4.59; spatial information: P = 0.004, c2(1) = 8.5, linear mixed effects models and likelihood ratio test. 3 of 4
RES EARCH | R E S E A R C H A R T I C L E Postsynaptic activity–dependent modulation of inhibitory postsynaptic potentials 8. 9. 10. 11. 12. 13. 1 March 2024 SUPPLEMENTARY MATERIALS science.org/doi/10.1126/science.adk3863 Materials and Methods Figs. S1 to S3 References (42–45) MDAR Reproducibility Checklist Submitted 18 August 2023; accepted 24 January 2024 10.1126/science.adk3863 4 of 4 , 6. 7. I. Llano, N. Leresche, A. Marty, Neuron 6, 565–574 (1991). T. A. Pitler, B. E. Alger, J. Neurosci. 12, 4122–4132 (1992). A. C. Kreitzer, W. G. Regehr, J. Neurosci. 21, RC174 (2001). R. I. Wilson, R. A. Nicoll, Nature 410, 588–592 (2001). T. Maejima, K. Hashimoto, T. Yoshida, A. Aiba, M. Kano, Neuron 31, 463–475 (2001). I. Katona et al., J. Neurosci. 19, 4544–4558 (1999). K. Tsou, S. Brown, M. C. Sañudo-Peña, K. Mackie, J. M. Walker, Neuroscience 83, 393–411 (1998). G. Marsicano, B. Lutz, Eur. J. Neurosci. 11, 4213–4225 (1999). C. Földy, A. Neu, M. V. Jones, I. Soltesz, J. Neurosci. 26, 1465–1469 (2006). S.-H. Lee et al., J. Neurosci. 35, 10039–10057 (2015). J. O’Keefe, J. Dostrovsky, Brain Res. 34, 171–175 (1971). K. C. Bittner et al., Nat. Neurosci. 18, 1133–1142 (2015). F. Dubruc, D. Dupret, O. Caillard, J. Neurophysiol. 110, 1930–1944 (2013). y 1. 2. 3. 4. 5. We thank A. Ortiz, C. Porter, S. Linder, and K. Patron for technical and administrative support. Funding: This work was supported by the National Institute of Neurological Disorders and Stroke (NINDS) of the National Institutes of Health (NIH). The content is solely the responsibility of the authors and does not necessarily represent the official views of the NIH. This work was supported by the NIH (grants R01NS99457, R01NS131728, and R01NS133381 to I.S.; grant R00NS117795 to B.D.; grant K99MH132871 to L.Z.F.; and grant K99NS126725 to J.S.F.); the Knight Initiative for Brain Resilience (grant KCG-116 to I.S.); a McNair scholarship from the McNair Medical Institute at The Robert and Janice McNair Foundation to B.D.; a Helen Hay Whitney fellowship to L.Z.F.; a Burroughs Wellcome Fund Career Award at the Scientific Interface to L.Z.F.; a Stanford University Bio-X Undergraduate Summer Research Program grant to C.W.; and the National Institute of Mental Health, National Institute on Drug Abuse, National Science Foundation, Gatsby Foundation, Fresenius Foundation, AE Foundation, Tarlton Foundation, and NOMIS Foundation to K.D. Author contributions: Conceptualization: B.D., L.Z.F., K.D., I.S.; Formal analysis: B.D., L.Z.F.; Funding acquisition: B.D., K.D., I.S.; Investigation: B.D., L.Z.F., J.S.F., S.M., J.H., D.K., C.W., C.R.; Methodology: B.D., L.Z.F., J.S.F.; Resources: Y.L.; Supervision: K.D., I.S.; Visualization: B.D., L.Z.F.; Writing – original draft: B.D., L.Z.F., I.S.; Writing – review & editing: all authors. Competing interests: I.S. declares unrelated consultant activity for Actio Biosciences, CODA Biotherapeutics, MapLight Therapeutics, Praxis Precision Medicines, and Ray Therapeutics. K.D. declares unrelated consultant activity for MapLight Therapeutics and Stellaromics. The remaining authors declare no competing interests. Data and materials availability: All data, code, and materials are available from the authors upon reasonable request. License information: Copyright © 2024 the authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original US government works. https://www.science.org/about/sciencelicenses-journal-article-reuse y g Dudok et al., Science 383, 967–970 (2024) RE FERENCES AND NOTES AC KNOWLED GME NTS y The above results provide evidence for postsynaptic neuronal activity–dependent modulation of CCKBC synapses in vivo. A suppression of inhibition could disinhibit place cells during place field traversal, contributing to locationspecific place cell activity (16, 36). To determine whether preventing inhibitory synaptic eCB signaling may lead to altered place fields, we knocked out CB1 selectively in forebrain GABAergic neurons (GABA-CB1-KO, lacking CB1 from perisomatic and dendritic interneurons) (28) (fig. S3B) and recorded place cell calcium signals during a spatial navigation task g Interneuron cannabinoid receptors modulate place cell activity patterns 14. G. Carlson, Y. Wang, B. E. Alger, Nat. Neurosci. 5, 723–724 (2002). 15. V. Chevaleyre, P. E. Castillo, Neuron 43, 871–881 (2004). 16. M. Valero, A. Navas-Olive, L. M. de la Prida, G. Buzsáki, Cell Rep. 40, 111232 (2022). 17. S. V. Rolotti et al., Neuron 110, 783–794.e6 (2022). 18. T. F. Freund, I. Katona, D. Piomelli, Physiol. Rev. 83, 1017–1066 (2003). 19. A. Dong et al., Nat. Biotechnol. 40, 787–798 (2022). 20. J. S. Farrell et al., Neuron 109, 2398–2403.e4 (2021). 21. Y. Hashimotodani, T. Ohno-Shosaku, M. Kano, Curr. Opin. Neurobiol. 17, 360–365 (2007). 22. H. Dana et al., eLife 5, e12727 (2016). 23. N. B. Danielson et al., Neuron 91, 652–665 (2016). 24. P. Kaifosh, J. D. Zaremba, N. B. Danielson, A. Losonczy, Front. Neuroinform. 8, 80 (2014). 25. Y. Hashimotodani, T. Ohno-Shosaku, T. Maejima, K. Fukami, M. Kano, Neuropharmacology 54, 58–67 (2008). 26. J. Z. Long, D. K. Nomura, B. F. Cravatt, Chem. Biol. 16, 744–753 (2009). 27. E. Albarran et al., Nat. Neurosci. 26, 997–1007 (2023). 28. K. Monory et al., Neuron 51, 455–466 (2006). 29. B. Dudok et al., Nat. Neurosci. 18, 75–86 (2015). 30. B. Pan et al., J. Pharmacol. Exp. Ther. 331, 591–597 (2009). 31. L. L. Glickfeld, M. Scanziani, Nat. Neurosci. 9, 807–815 (2006). 32. B. Dudok et al., Neuron 109, 997–1012.e9 (2021). 33. L. Z. Fan et al., Cell 186, 543–559.e19 (2023). 34. H. Tian et al., Nat. Methods 20, 1082–1094 (2023). 35. J. Epsztein, M. Brecht, A. K. Lee, Neuron 70, 109–120 (2011). 36. S. Royer et al., Nat. Neurosci. 15, 769–775 (2012). 37. Ö. Albayram, S. Passlick, A. Bilkei-Gorzo, A. Zimmer, C. Steinhäuser, Pflugers Arch. 468, 727–737 (2016). 38. I. Del Pino et al., Nat. Neurosci. 20, 784–792 (2017). 39. C. Varga, P. Golshani, I. Soltesz, Proc. Natl. Acad. Sci. U.S.A. 109, E2726–E2734 (2012). 40. M. Bartos et al., Proc. Natl. Acad. Sci. U.S.A. 99, 13222–13227 (2002). 41. A. D. Milstein et al., eLife 10, e73046 (2021). p Retrograde eCB signaling through CB1 inhibits CCKBC to pyramidal cell synapses in vitro (9, 31). On the basis of our results showing eCB transients time-locked to calcium transients, we expected to observe an activitydependent modulation of CCKBC synapses. We used a CCKBC-specific (Sncg-FlpO) mouse line to test this hypothesis (32) and developed an all-optical method to study synaptic transmission between CCKBCs and postsynaptic neurons. These animals express the FlpO recombinase enzyme specifically in gammasynuclein (Sncg)–expressing cells. Sncg is expressed selectively in CCKBCs; therefore, FlpO will be expressed specifically in this cell population in Sncg-FlpO mice. We expressed FlpOdependent excitatory opsin (sombC1C2TG) (33) in CCKBCs and a soma-localized genetically encoded voltage indicator (GEVI, somQuasAr6a) (34) in sparsely labeled CA1 neurons in SncgFlpO mice (Fig. 3A and fig. S3A). We imaged GEVI in awake mice head-fixed on a spherical treadmill while activating CCKBCs with photostimulation (Fig. 3B). Brief CCKBC activation elicited time-locked CA1 neuronal hyperpolarization, consistent with optogenetically evoked inhibitory postsynaptic potentials (oeIPSP; Fig. 3C). Plateau-driven complex spikes in CA1 pyramidal cells are particularly important for synaptic plasticity (12, 33, 35). We identified plateau-driven complex spikes with voltage imaging and then grouped the photostimulationinduced responses based on the presence or absence of complex spikes during the 1 s before the stimulus (Fig. 3, D and E). Whereas oeIPSPs were detectable in the absence of a preceding complex spike (Fig. 3E), the same postsynaptic cells showed reduced oeIPSPs after complex spikes (Fig. 3, D, F, and G). As expected, the average postsynaptic depolarization before the CCKBCs stimulus was higher in the presence of complex spikes (Fig. 3G). Together, these results demonstrate a transient suppression of CCKBC inhibition after complex spikes, consistent with a DSI-like mechanism. as mice foraged for a water reward. Both control (Dlx-Cre) and GABA-CB1-KO mice exhibited spatially tuned calcium signals, suggesting that CB1 expression by GABAergic neurons is not required for place field formation per se (fig. S3, C and D). However, we observed a widening of place fields in GABA-CB1-KO mice relative to mice with intact CB1 expression (Fig. 3, H and I). Analyzing the properties of individual place cells revealed that in the absence of interneuron CB1 expression, place cells were active over a larger fraction of the belt and altogether encoded less spatial information (Fig. 3I and fig. S3, C to J). In GABA-CB1-KO mice, place cells fired less reliably lap-to-lap, and had fewer calcium transients near the preferred location (fig. S3, H and I). As a population, place cells in the GABA-CB1-KO encoded mouse location less accurately compared with control despite the similar ratio of place cells (fig. S3, E and J). The observed changes in place cell activity patterns are consistent with the reported impaired spatial learning performance of GABA-CB1-KO mice (37) and mice with perturbed CCKBC development (38). In this study, we report (i) rapid eCB signals time-locked to calcium transients in hippocampal neurons including place cells, both in the postsynaptic membrane and the presynaptic inhibitory axons; (ii) modulation of CCKBC synapses correlated to past postsynaptic activity; and (iii) diminished place cell place field properties in the absence of eCB signaling at inhibitory synapses. Our results demonstrate that an eCB-mediated, DSI-like plasticity is capable of rapid modulation of inhibition in vivo on the behaviorally relevant timescale of seconds. Because of the selective expression of CB1 at synapses of CCK-expressing but not PV-expressing interneurons, DSI may enable recently activated place cells to maintain elevated excitability without suppressing the ability of PVBC synapses to synchronize the PC population activity dynamics to theta and gamma oscillations (39, 40). Such a selective, lasting suppression of inhibition involving CB1 signaling may also contribute to maintaining an eligibility trace for non-Hebbian activity– dependent plasticity (41).
RES EARCH THERMODYNAMICS Variance sum rule for entropy production I. Di Terlizzi1,2†, M. Gironella3,4†, D. Herraez-Aguilar5, T. Betz6,7, F. Monroy8,9, M. Baiesi2,10, F. Ritort3,11* Entropy production is the hallmark of nonequilibrium physics, quantifying irreversibility, dissipation, and the efficiency of energy transduction processes. Despite many efforts, its measurement at the nanoscale remains challenging. We introduce a variance sum rule (VSR) for displacement and force variances that permits us to measure the entropy production rate s in nonequilibrium steady states. We first illustrate it for directly measurable forces, such as an active Brownian particle in an optical trap. We then apply the VSR to flickering experiments in human red blood cells. We find that s is spatially heterogeneous with a finite correlation length, and its average value agrees with calorimetry measurements. The VSR paves the way to derive s using force spectroscopy and time-resolved imaging in living and active matter. ð1Þ where the left-hand side includes the variances of the displacements Dxt ¼ xt  x0 , and t of time-cumulative forces [ SF ðt Þ ¼ ∫ 0 dsFs ]. The total variance V T ðt Þ ¼ V Dx ðt Þ þ m2 V SF ðt Þ equals the free diffusion term 2Dt plus a nonequilibrium contribution S ðt Þ denoted as excess variance t Sðt Þ ¼ 2m∫ 0 ds½CxF ðsÞ  CFx ðsÞ ð2Þ that measures the breakdown of time-reversal symmetry, with CAB ðsÞ ¼ As B0  A s B 0 the correlation function in the NESS. In equilib- 1 March 2024 s¼ v2 1 m þ @ 2 V Dx jt¼0 þ V F 2 m 4m t ð4Þ To illustrate the VSR, we consider two examples of a NESS where Ft equals the force in the measurement device, Ft ¼ FtM, and FtI ¼ 0. Methods Experiments with colloidal particles (Figs. 1 and 2) were done in a miniaturized version of an optical tweezers instrument described in (22). Human red blood cells (RBCs) were obtained by finger pricking of a healthy donor for the RBC experiments. The phosphate-buffered saline (PBS) solution contains 130 mM NaCl, 20 mM K/Na phosphate buffer, 10 mM glucose, and 1 mg/ bovine serum albumin per milliliter of solution. For optical tweezer (OT)-stretching experiments, 4 ml of blood was diluted in 1 ml of PBS. RBCs were treated and biotinylated for OT sensing as described in (11). For optical microscopy (OM) measurements, the RBC pellet obtained after centrifugation (5000g for 10 min at 4°C) was resuspended (1:15) in PBS solution (23). Contact areas in OT experiments were estimated using a multiscale feature extractor based on a Gaussian pyramid representation of the raw image followed by a Laplacian reconstruction. For OT sensing, we used estimates from (11). Bead dragged through water The first system is an optically trapped colloidal particle dragged through water (friction coefficient g ¼ 1=m) at speed v. The bead’s dynamics can be analytically solved, and the VSR (Eq. 1) verified (materials and methods S3). Equation 4 follows with S ¼ 0 and s ¼ gv2, as expected. Figure 1C shows the experimental validation of the VSR (Eq. 1). The right inset shows measurements of s  gv2 for several repetitions of the experiment and 1 of 6 , V Dx ðt Þ þ m2 V SF ðt Þ ¼ 2Dt þ S ðt Þ  y Di Terlizzi et al., Science 383, 971–976 (2024)  where v ¼ x is the particle’s average velocity and s is expressed in power units (e.g., kB T =s). By using Eq. 1 along with Eq. 3, we derive the formula for the rate of entropy production in terms of the static variance of the force V F ¼ F 2  F 2 and the convexity of the meansquared displacement V Dx at time 0 y g *Corresponding author. Email: ritort@ub.edu †These authors contributed equally to this work. We introduce a variance sum rule (VSR) to derive s in experiments where a measurement probe is in contact with a system in a NESS (Fig. 1A). Dynamics are described by a Langevin pffiffiffiffiffiffi equation, xðt Þ ¼ mFt þ 2Dht , with probe mobility m, diffusivity D, and a Gaussian white noise term, ht. The total force acting on the probe Ft ≡ Ft ðxt Þ equals the sum of the force exerted by the measurement device, FtM , plus a probesystem interaction, FtI , Ft ¼ FtM þ FtI (arrows in Fig. 1A). In most experimental settings, FtI remains inaccessible, so Ft and s cannot be directly measured. Our approach focuses on how observablesQt on average spread in time, as quantified by their variance V Q ðt Þ ¼ Qt2  Qt 2 with ð…Þ the dynamical average in the NESS. The VSR is an equality for integrated quantities in an arbitrary time interval (0, t), which imposes a tight constraint on the fluctuations in a stochastic diffusive system over the experimental timescales. By integrating the Langevin equation over the interval (0,t) and by taking the variance of both sides, a time-preserved identity can be obtained (materials and methods S1). The VSR for position and force fluctuations reads ð3Þ y Max Planck Institute for the Physics of Complex Systems, Nöthnitzer Straße 38, 01187 Dresden, Germany. Dipartimento di Fisica e Astronomia, Università di Padova, Via Marzolo 8, 35131 Padova, Italy. 3Small Biosystems Lab, Condensed Matter Physics Department, Universitat de Barcelona, C/ Marti i Franques 1, 08028 Barcelona, Spain. 4 Department of Medical Biochemistry and Cell Biology, Institute of Biomedicine, The Sahlgrenska Academy, University of Gothenburg, 40530 Gothenburg, Sweden. 5 Facultad de Ciencias Experimentales, Universidad Francisco de Vitoria, Ctra. Pozuelo-Majadahonda Km 1,800, 28223 Pozuelo de Alarcón, Madrid, Spain. 6Third Institute of Physics, Georg August Universität Göttingen, Göttingen, Germany. 7Cluster of Excellence “Multiscale Bioimaging: from Molecular Machines to Networks of Excitable Cells” (MBExC), University of Göttingen, Göttingen, Germany. 8Departamento de Química Física, Facultad de Química, Universidad Complutense, 28040 Madrid, Spain. 9Translational Biophysics, Instituto de Investigación Sanitaria Hospital Doce de Octubre (IMAS12), Av. Andalucía, 28041 Madrid, Spain. 10INFN, Sezione di Padova, Via Marzolo 8, 35131 Padova, Italy. 11Institut de Nanociència i Nanotecnologia (IN2UB), Universitat de Barcelona, 08028 Barcelona, Spain. 2 Variance sum rule v2 1 þ @ 2 Sj m 4m t t¼0 g 1 methods that estimate s more precisely are needed to determine dissipative processes in the nanoscale. s¼ p N onequilibrium steady states (NESS) pervade nature, from climate dynamics (1) to living cells and active matter (2). A fundamental quantity is the entropy production rate s at which energy is dissipated to the environment, which is positive by the second law of thermodynamics (3, 4). Entropy production measurements remain challenging despite their relevance, especially in microscopic systems with stochastic and spatially varying fluctuations and limited access to microscopic variables (5, 6). The entropy production rate s determines the efficiency of energy transduction in classical and quantum systems (7, 8), the energetic costs and irreversible behavior of living cells (9–12). It is an elusive quantity when forces and currents are experimentally inaccessible. Bounds can be obtained from time irreversibility (13, 14), the thermodynamic uncertainty relation (15, 16), and coarse-graining (17–21). Most of these results provide lower bounds that refine the second law of thermodynamics, s ≥ 0. However, the bounds are often loose without upper limits and therefore uninformative about the actual s. Alternative rium, Sðt Þ ¼ 0 because of time-reversal symmetry. Figure 1B illustrates the VSR for a generic NESS. From the VSR, one can derive an equation relating s to the variances of fluctuating variables. By taking the time derivative twice of Eq. 2 and evaluating it at t ¼ 0, one obtains a formula for s that depends on the convexity of the excess variance S ðt Þ at t ¼ 0 (materials and methods S2),
RES EARCH | R E S E A R C H A R T I C L E using Eq. 4, finding s  gv2 ¼ 5 T 7 kB T =s. Notice that S ¼ 0 implies that the two rightmost terms in Eq. 4 are of equal magnitude but opposite sign, compensating each other, mV F ¼  2m1 @t2 V Dx jt¼0 ¼ kB T =tr > 0 with tr ¼ g=k ¼ 0:35 ms the bead’s relaxation time (k ¼ 70 pN=mm being the trap stiffness). The value mV F ∼ 3  103 kB T =s is almost three orders of magnitude larger than s  gv2 (T7 kB T =s). The results S ¼ 0 and s ¼ gv2 are not restricted to a harmonic well but hold for an arbitrary time-dependent potential U ðx  vt Þ. This gives a reversed thermodynamic uncertainty relation (16) for the work exerted on the bead by the optical trap, Wt ¼ vSF ðt Þ ¼ t v∫0 dsFs, and an upper bound for s (materials and methods S4), 2 s 2Wt ≤ k B T t V W ðt Þ ð5Þ 4  104 nm/pN  s, speed v ¼ 10 mm=s, gv2 ¼ 610 kB T=s). The lower inset plots s  gv2 ¼ m 1 2 4m @t V Dx jt¼0 þ 2 V F from Eq. 4 for the experimental realizations; the horizontal red line shows the average over all experiments [5 T 7 kB T=s] with one standard deviation (red band). The black dashed line is the theoretical prediction s ¼ gv2 . The upper inset shows the experimental test of the inequality (Eq. 5). Dashed vertical lines show the bead’s relaxation time tr . p g In Fig. 1C (left inset), we experimentally test Eq. 5. The upper bound becomes tight for t ≫ tr , the difference between two terms in Eq. 5 vanishing as tr =t, as expected from the steady-state fluctuation theorem for Gaussian work distributions (4). Fig. 1. Variance sum rule (VSR): Sketches and experiments with a dragged particle. (A) Experimental setup for a NESS measured with optical tweezers. (B) Illustration of the VSR showing the different terms in Eq. 1. (C) Experimental test of the VSR for an optically trapped bead dragged through water at room temperature (bead radius R ¼ 1:5 mm, mobility m ¼ The stochastic switching trap ð6Þ with w ¼ wþ þ w , a ¼ wr =w , and wr ¼ 1=tr ¼ k=g (the bead’s relaxation rate for a resting trap). In Fig. 2C, we test the VSR and Eq. 6 for three NESS conditions. The inset shows the two terms contributing to the total variance V T . For large times, S converges to a Di Terlizzi et al., Science 383, 971–976 (2024) w w þ wr ð7Þ Figure 2D shows values of s measured in SST experiments with Dl ¼ 280 nm using Eq. 4. Their average sexp ¼ 4:6 T 4  103 kB T =s agrees with the theoretical prediction (Eq. 7), sth ∼ 5:3  103 kB T =s . Figure 2E compares sexp with sth (Eq. 7) (black dashed line) for varying Dl. Experiment and theory agree over three decades of s. Reduced VSR Until now, we have considered the case of a single degree of freedom where the total force acting on the bead equals the measured force, Ft ¼ FtM and FtI ¼ 0. For the case of multiple degrees of freedom where positions and total forces can be measured, Eqs. 1 and 3, can be generalized (materials and methods S1 and S2). Quite often, however, a measurement probe (atomic force microscope tip, microbead, etc.) is in contact with a system in a NESS, such as a biological cell with metabolic activity (Fig. 1A). In this case, FtI ≠ 0 is experimentally inaccessible, and Ft ¼ FtM þ FtI cannot be measured, making the VSR (Eq. 1) inapplicable. Moreover, in many cases, only a spatial degree 1 March 2024 V Dx ðt Þ þ m2 k2 V Sx ðt Þ ¼ 2Dt þ S~ðt Þ ð8Þ , að1  ewr t Þ  a2 ð1  ewt Þ 1  a2 sth ¼ ðkDlÞ2 qð1  qÞm of freedom xt is monitored, e.g., in particletracking experiments (24, 25) or in detecting cellular fluctuations (26, 27). To apply the VSR in these situations, it is necessary to model the NESS by making assumptions about the interaction FtI and the underlying degrees of freedom. Specifically, for a linear-response measuring device (FtM ¼ kxt ), a reduced VSR for a single degree of freedom can be derived and expressed in terms of variances related to the position xt only. In these conditions, the displacement variance,V Dx, along with the variance t of Sx ðt Þ ¼ ∫0 ds xs , V Sx ðt Þ , satisfy (materials and methods S6), y  finite value, and V T merges with the equilibrium line 2Dt (black dashed line) when plotted in log-log scale. Equations 3 and 6 yield the theoretical prediction (v ¼ 0) y g S ðt Þ ¼ 4ðDlÞ2 qð1  qÞ y The second system we consider is the stochastic switching trap (SST) (22), where an active force is applied to an optically trapped bead by randomly switching the trap position lt between two values (lþ ; l ) separated by Dl ¼ lþ  l (Fig. 2A). Jumps occur at exponentially distributed times with switching rates wþ ; w at each position. The ratio w =wþ ¼ q=ð1  qÞ defines the probability q of the trap to be at position lþ . Figure 2B shows the measured bead’s position xt and force Ft ¼ kðlt  xt Þ for three cases with q ¼ 1=2 and varying Dl. The bead follows the movement of the trap (top), quickly relaxing to its new equilibrium trap position at every jump (force spikes, bottom). Figure 2C shows the total variance, V T ðt Þ ¼ V Dx ðt Þ þ m2 V SF ðt Þ. V T deviates from 2Dt (dashed line) between 104 and 1 s, showing that S≠0 is comparable to V T (notice the log-log scale). The SST model is analytically solvable (materials and methods S5), giving expressions for V Dx ðt Þ; V SF ðt Þ, and Sðt Þ. For the latter, we find Equation 8 is a general result which, however, does not permit one to derive a formula for s like Eq. 3. Notice that S~ differs from S in Eq. 1 and does not vanish in equilibrium. S~ can be expressed in terms of the generic interacting force FtI ; see eq. S38 in materials and methods. To derive s using Eq. 8, we use a solvable model for the experiment and a procedure consisting of the following steps: (i) Analytically derive expressions for the excess variances, Sðt Þ and S~ðt Þ for the model; (ii) calculate sth from Sðt Þ using Eq. 3; (iii) fit the reduced VSR (Eq. 8) to the experimental data using S~ðt Þ from the model to extract the model parameters; (iv) insert the parameters in the analytical expression for sth 2 of 6
RES EARCH | R E S E A R C H A R T I C L E p g Fig. 2. VSR and entropy production rate for experiments with a stochastic switching trap. (A) Schematics of the experiment. (B) Traces of position and force for three Dl values [see legend in (C)]. (C) VSR (Eq. 1) and total variance V T : Symbols are experimental data, and lines represent the theory with known parameters without fitting. The inset shows the different terms in the VSR. (D) Measurements of s for wþ ¼ w ¼ 10 s1 and Dl ¼ 280 nm; we show different experimental realizations (squares), their average sexp and the theoretical value sth (Eq. 7). (E) s (red symbols) averaged over experimental realizations (orange circles) for Dl = 18, 70, and 280 nm; black line is the analytical prediction (Eq. 7). y y g Di Terlizzi et al., Science 383, 971–976 (2024) of amplitude D, fta ¼ 0 , fta fsa ¼ D2 ejtsj=ta , with ta the active correlation time (Fig. 3A, inset). The dynamics are described by the stochastic equation xt ¼ kmxt þ  pffiffiffiffiffiffi 2Dht þ mfta ð9Þ with k the trap stiffness, m the particle mobility, and D ¼ kB T m the diffusion constant. To test the reduced-VSR approach (Eq. 8) for deriving s, we exploit the mapping of the ABP 1 March 2024 (Eq. 9) to the SST model discussed previously (Fig. 2A). The mappingpfollows ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiby ffi identifying parameters D ¼ kDl qð1  qÞ, ta ¼ 1=w, wr ¼ km from which Eq. 7 follows [for q ¼ 1=2, see also (28)]. We have used Eq. 8 to analyze the data already used in the previous approach for the SST experiments 2) wi th  (Fig.  ~ðt Þ ¼ 2D2 m2 ta t  ta 1  et=ta ( co m par e S eq. S37) where D and ta are fitting parameters. Results are shown in Fig. 3A and residuals in fig. S2A. Their values and s agree with the 3 of 6 , to derive s. The approach remains applicable to a vast category of NESS whenever the interacting force FI between the probe and NESS is linear. This is a typical situation in mesoscopic systems where fluctuations are small in the linear response regime. A model for the experimental system that includes the degrees of freedom contributing most to s is required. For instance, consider an active Brownian particle (ABP) in an optical trap subject to a random time-correlated active force FtI ≡ fta y Fig. 3. Application of the reduced VSR to experiments (SST and RBCs) to extract the entropy production rate. (A) Test of Eq. 8 for the SST experimental ~ T ðtÞ ¼ V Dx ðtÞ þ m2 k2 V Sx ðtÞ, fitted to Eq. 8 for different data, equivalent to the active ABP, in a harmonic trap (Eq. 9 and inset). Symbols are experimental values for V ~ T ðtÞ for the two-layer active model ~ Dl (lines). Blue and red circles are the two contributions to V T ðtÞ for Dl ¼ 18 nm. (B and C) Fits of the reduced VSR to V (materials and methods S6). (B) Healthy RBCs in OT-stretching experiments at three trap stiffness values (Fig. 4A). To help visualization, the three different ~ value; (C) Healthy (active) and passive RBCs in OT-sensing experiments (Fig. 4B). ~ T ðtÞ values have been scaled with respect to a single D V
RES EARCH | R E S E A R C H A R T I C L E p g y stretching (A) varying the trap stiffness kb from high values (5  102 pN/nm, rightmost points) to low values (7  104 pN/nm, leftmost points) for healthy RBCs. (E) s measurements for OT sensing for healthy (red symbols) and passive (blue symbols) RBCs. (F) Colored s map for OM measurements along the equatorial cell contour, as in (C), for a healthy RBC (circles) and a passive RBC (diamonds). The radial distance represents s in arbitrary units. The orange curve is the s-smoothed profile. (G) Scatter plot of s versus V x for the RBCs of (F), showing that they are partially anticorrelated. Orange circles are s values averaged over windows of 50 nm2 in V x . (H) Spatial correlation functions for s and position x are measured along the cell contour. (I) Values of sRBC compared to calorimetry estimates. For OT stretching, the dark (light) red bar corresponds to the lowest (highest) trap stiffness. y g Fig. 4. Application of the reduced VSR to RBCs. (A) OT-stretching experiments. Video image of stretched RBC and schematics of contact area estimation (left); (right) three selected bead position traces at a high (blue), medium (orange), and low (red) trap stiffness. (B) OT-sensing experiments. Experimental setup from (11) (left) and tracking bead position traces for a healthy (red) and passive (blue) RBC (right). (C) Ultrafast OM measurements: Healthy RBC (upper images) and position traces (right) for three selected pixels (50 nm by 50 nm) along the cell contour with high (red), medium (yellow), and low (green) variance V x ; passive RBC (lower images) and cell contour traces for three selected pixels (blue, right). The right images also show a color variance map along the cell contour. The color bar denotes variance levels (red, highest; blue, lowest). (D) s and position variance Vx measurements for OT y Red blood cells Finally, we apply the reduced-VSR to the challenging case of human RBCs (29). RBCs metabolize glucose into adenosine 5´-triphosphate (ATP) via the glycolytic pathway, producing the cell membrane’s active flickering with a consequent entropy creation (11, 23, 30, 31). The RBC membrane is dynamically attached to the spectrin cortex through multiprotein complexes, which actively bind and unbind in the phosphorylation step of the glycolytic pathway (32). We have carried out experimental RBC Di Terlizzi et al., Science 383, 971–976 (2024) measurements using three techniques (Fig. 4). Two of them use OTs in different setups: (i) mechanical stretching of RBCs using beads nonspecifically attached to the membrane with different optical trap stiffness (OT stretching, Fig. 4A); (ii) mechanical sensing of a biotinylated RBC membrane using streptavidin functionalized beads using data from (11) (OT sensing, Fig. 4B). The third technique measures cell contour fluctuations by membrane flickering segmentation tracking of free-standing RBCs using ultrafast OM (23, 33) (Fig. 4C). As a first observation, a single-layer active model (Eq. 9) with its S~ðt Þ in Eq. 8 does not describe the experimental data. Instead, we consider a two-layer model with one hidden position variable for the active membrane–cortex in- 1 March 2024 teraction that is linearly coupled to the membrane outer layer x (probe) (materials and methods S7). Similar active models have been proposed in the study of hair-cell bundle dynamics (14, 34, 35). The two-layer active model leads to a reduced VSR of the form (Eq. 8) that fits the experimental data; the fitting procedure is described in materials and methods S8 and S9. Some fits of the reduced VSR are shown in Fig. 3, B and C, and residuals of the fits are shown in fig. S2, B to F. Figure 4, D and E, show s values obtained from OT-stretching data in the range of trap stiffnesses kb ¼ 5  102  7  104 pN/nm and OT-sensing data with kb ∼ 2  105 pN/nm for healthy and ATP-depleted (passivated) RBCs. For OT stretching, s increases as kb decreases 4 of 6 , expected ones (table S1 and fig. S3A.). Therefore, the reduced VSR (Eq. 8) permits us to infer NESS parameters and s from xt measurements only.
RES EARCH | R E S E A R C H A R T I C L E Discussion M. S. Singh, M. E. O’Neill, Rev. Mod. Phys. 94, 015001 (2022). C. Bechinger et al., Rev. Mod. Phys. 88, 045006 (2016). C. Maes, Séminaire Poincaré 2, 29 (2003). U. Seifert, Rep. Prog. Phys. 75, 126001 (2012). F. Ritort, Adv. Chem. Phys. 137, 31–123 (2008). S. Ciliberto, Phys. Rev. X 7, 021051 (2017). I. A. Martínez et al., Nat. Phys. 12, 67–70 (2016). G. T. Landi, M. Paternostro, Rev. Mod. Phys. 93, 035008 (2021). 9. P. Martin, A. J. Hudspeth, F. Jülicher, Proc. Natl. Acad. Sci. U.S.A. 98, 14380–14385 (2001). 10. C. Battle et al., Science 352, 604–607 (2016). 11. H. Turlier et al., Nat. Phys. 12, 513–519 (2016). 5 of 6 , 1. 2. 3. 4. 5. 6. 7. 8. y REFERENCES AND NOTES y g The agreement between mechanical and bulk calorimetric estimates of the RBC metabolic energy turnover suggests that the heat produced in the glycolytic pathway is tightly coupled with membrane flickering due to active kickers. Tight mechanochemical coupling is critical to an efficient free-energy chemical transduction. It has been observed in processive enzymes (e.g., polymerases, transport motors, etc.) (46) and in allosteric coupling in ligand binding (47). Tightly coupled processes are related to emergent cycles in cellular metabolism and chemical reaction networks, particularly for the relevant glycolytic cycle of RBCs (48). A clarifying example of weak versus tight coupling is the effect of the trap stiffness in deriving s (Fig. 4D). Unless the probe stiffness is smaller than the RBC stiffness, the probe’s passive fluctuations mask the system’s activity and s. In addition to molecular motors and living cells, the VSR should apply to timeresolved photoacoustic calorimetry (49) and enzyme catalysis, where the effective diffusion constant of the enzyme increases linearly with the heat released (50), a consequence of Eq. 1. Moreover, spatially resolved maps of partial measurements of s for weak mechanochemical coupling provide insight into the structural features underlying heat dissipation in biological cells. In a wider context, the VSR applies to nonlinear systems, from non-Gaussian active noise to nonlinear potentials (materials and methods S13). Finally, we stress that different models can fit the experimental data. However, the power of the VSRs, Eqs. 1 and 8, is given by the constraint imposed by the sum of variances over the experimental timescales. By fitting the experimental data to a single function, the total variance V T ðt Þ over several decades, the contribution of dissipative processes over multiple timescales is appropriately weighted in the sum balance. This distinguishes our approach from plain model fitting of the experimental power spectrum to derive the model parameters (35) that may lead to inaccurate estimations (materials and methods S14). In this regard, the VSR links modeling with energetics. y 1 March 2024 active noise, ∼100 s1 for the RBC experiments (tables S2 to S4). g Di Terlizzi et al., Science 383, 971–976 (2024) ta → 0, sðta Þ saturates to a finite value whereas aðta Þ ∼ ta , decreasing V x (fig. S6). We hypothesize that the anticorrelation observed in the s map derives from the highly heterogeneous ta (mean 0.05 s and standard deviation 0.2 s) but nearly constant D (mean 4.4 pN and standard deviation 0.2 pN) across all pixel units. A constant-noise amplitude D with a heterogeneous ta suggests a uniform density of kickers but a heterogeneous ATP concentration cATP across the RBC surface, which modulates the ATP binding rate of the kickers, ta1 ∼ kbind º cATP . The s map of a single RBC determines the finite correlation length x for the spatially varying s field, a main prediction of active field theories (37, 38) and stochastic hydrodynamics (39). For healthy RBCs, x has been estimated from the spatial correlation functionCss ðd Þ, and Cxx ðd Þ of the traces at a curvilinear distance d along the RBC contour, Fig. 4H. Functions can be fitted to an exponential ∼expðd=xÞ with xss ∼ 0:35 T 0:05 mm and xxx ∼ 0:82 T 0:02 mm, giving the median x ∼ 0:6 T 0:2 mm. This value is larger than the lateral resolution of the microscope (200 nm). The structure factor of the s field along the cell contour shows a characteristic peak at a domain length l ∼ 1:3 mm, which is larger than xss , possibly due to the heterogeneous cortex-membrane bindingunbinding dynamics that produce differently active s domains (materials and methods S11). A two-layer active model in a ladder with an interlayer coupling kxx further corroborates the value obtained for xxx (materials and methods S12). The average heat flux density can be estimated as js ¼ s=x2 ¼ ð2 T 1Þ 104 kB T = ðs  mm2 Þ with x2 the typical area of an entropyproducing region. In summary, for an RBC of typical surface area A ∼ 130 mm2 , one obtains sRBC ¼ js  A ¼ ð2 T 1Þ  105 kB T =s (OT stretching, at lowest kb ); sRBC ¼ ð2 T 1Þ 105 kB T =s (OT sensing); and sRBC ¼ ð3 T 1Þ 106 kB T =s (OM). These values are compatible with calorimetric bulk measurements of packed 6 RBCs, sbulk RBC ¼ ð2 T 1Þ  10 kB T =s (40, 41) and are larger than indirect measures based on the breakdown of the fluctuation-dissipation theorem and effective temperatures (11, 42). The significantly low s values obtained for passive RBCs (blue data in Fig. 4, E to G and I) validate our approach. Our sRBC ∼ 105  106 kB T =s is higher than the values obtained through information-theoretic measures based on the breakdown of detailed balance (12, 14). Intuitively, the VSR (Eqs. 1 and 8) sets an energy balance between fluctuating positions and forces, both conjugated energy variables, a missing feature in the thermodynamic uncertainty relation and coarse-graining models (43–45). In general, the VSR captures most of s because sampling rates, 40 kHz for OT stretching, 25 kHz for OT sensing, and 2 kHz for OM, are higher than the frequency of the p reaching s ¼ ð3 T 1Þ  103 kB T =s averaged over RBCs, for the lowest kb . This value is compatible with OT-sensing measurements, s ¼ ð2 T 1Þ  103 kB T =s for healthy RBCs, which is larger than for passive RBCs (red and blue symbols in Fig. 4E). Moreover, s appears correlated with the variance of the flickering signal as measured from the position traces, V x ¼ x2  x 2 (Fig. 4D). The apparent correlation demonstrates that the probe stiffness kb must be lower than the stiffness of the RBC, kRBC ∼ 5  103 pN/nm, to measure s; otherwise, the active flickering of the RBC membrane is suppressed by the passive fluctuations of the bead. The correlation between s and Vx is also explicitly shown in fig. S4, where a color-map plot of the stiffness shows that we can detect active flickering and s only for kb < kRBC. Indeed, for the largest trap stiffness kb ∼ 5  102 pN/nm, one obtains s ∼ 10 kB T =s (rightmost points in Fig. 4D), a value almost constant if the RBC is stretched up to 30 pN (fig. S4). The measured s is extensive with the bead–RBC contact area. Estimations from video images (Fig. 4A and materials and methods) yield circular contact areas of a ¼ 0:8 T 0:2 mm2 for both OTtype experiments giving the heat flux density js ¼ s=a ¼ ð3 T 1Þ  103 kB T =ðs  mm2 Þ for OT stretching at low kOT and js ¼ ð1:8 T 0:6Þ 103 kB T =ðs  mm2 Þ for OT sensing. Such estimations are subject to uncertainty in the actual diameter and shape of the contact area. Furthermore, we have analyzed the simulation data of the OT-sensing experiments based on the three-dimensional numerical model of (11). The active and passive trajectories for the sensing bead give s ∼ 104 kB T =s and s ∼ 20 kB T =s, respectively (materials and methods S10). For the OM experiments, we show in Fig. 4C the color map of the position variance V x (healthy, top; passive, bottom), and in Fig. 4F we show the color map of s (circles, healthy; diamonds, passive), measured over pixels of area 50 nm by 50 nm along the RBC contour. For the healthy RBCs, both s and V x reveal an RBC heterogeneous activity with average values s ¼ ð7 T 1Þ  103 kB T =s and V x ¼ 400 T 10 nm2 . Molecular maps of heterogeneous RBC deformability have been previously reported (36). In contrast to OT experiments (Fig. 4, D and E), for OM experiments s and V x are anticorrelated in the active regime (Pearson coefficient ∼  0:4 ) with high-variance regions showing lower s (Fig. 4G). Results for other RBCs are shown in fig. S5. This counterintuitive result demonstrates the critical role of the active timescale ta, which, for fixed D, determines the active contribution to the total þ aðta Þsðta Þ (eq. S41a) variance, V x ¼ V passive x with aðta Þ positive and monotonically increasing with ta and sðta Þ given in eq. S42. It can be shown that in the high-activity limit
RES EARCH | R E S E A R C H A R T I C L E 32. T. J. Byers, D. Branton, Proc. Natl. Acad. Sci. U.S.A. 82, 6153–6157 (1985). 33. M. Mell, F. Monroy, PLOS ONE 13, e0207376 (2018). 34. P. Martin, A. J. Hudspeth, Proc. Natl. Acad. Sci. U.S.A. 96, 14306–14311 (1999). 35. G. Tucci et al., Phys. Rev. Lett. 129, 030603 (2022). 36. D. E. Discher, N. Mohandas, E. A. Evans, Science 266, 1032–1035 (1994). 37. C. Nardini et al., Phys. Rev. X 7, 021007 (2017). 38. T. GrandPre, K. Klymko, K. K. Mandadapu, D. T. Limmer, Phys. Rev. E 103, 012613 (2021). 39. T. Markovich, É. Fodor, E. Tjhung, M. E. Cates, Phys. Rev. X 11, 021057 (2021). 40. U. Bandmann, M. Monti, I. Wadsö, Scand. J. Clin. Lab. Invest. 35, 121–127 (1975). 41. P. Bäckman, Thermochim. Acta 205, 87–97 (1992). 42. E. Ben-Isaac et al., Phys. Rev. Lett. 106, 238103 (2011). 43. D. M. Busiello, S. Pigolotti, Phys. Rev. E 100, 060102 (2019). 44. D.-K. Kim, Y. Bae, S. Lee, H. Jeong, Phys. Rev. Lett. 125, 140604 (2020). 45. P. Bilotto, L. Caprini, A. Vulpiani, Phys. Rev. E 104, 024140 (2021). 46. A. I. Brown, D. A. Sivak, Chem. Rev. 120, 434–459 (2020). 47. N. V. Dokholyan, Chem. Rev. 116, 6463–6487 (2016). 48. A. Wachtel, R. Rao, M. Esposito, J. Chem. Phys. 157, 024109 (2022). 49. K. S. Peters, G. J. Snyder, Science 241, 1053–1057 (1988). 50. C. Riedel et al., Nature 517, 227–230 (2015). 51. I. Di Terlizzi et al., Variance sum rule for entropy production. (2023); https://doi.org/10.5061/dryad.h44j0zpsw D.H.-A. and F.M. are supported by the Spanish Research Council (grant PID2019-108391RB-100 and grant TED2021-132296B). T.B. is supported by the European Research Council (consolidator grant 771201 and the Deutsche Forschungsgemeinschaft under Germany’s Excellence Strategy - EXC 2067/1-390729940). M.B. is supported by research grant BAIE_BIRD2021_01 from the University of Padova. F.R. is supported by ICREA Academia 2018. Author contributions: I.D.T., M.B., and F.R. conceptualized the study; M.G., D.H.-A., T.B., and F.M. collected and curated the data. I.D.T. wrote the software for data analysis and performed visualization. I.D.T. and M.G. analyzed the data. F.R. administered the project. I.D.T., M.B., and F.R. wrote the original draft. All authors discussed the results and implications of the methodology and commented on the manuscript. Competing interests: The authors declare no competing financial interests. Data and materials availability: All data needed to evaluate the conclusions in the paper, and the code for fitting the VSR, are available at Dryad (51). Figures 1A and 2A, fig. S1, and the inset of Fig. 3A were created with BioRender.com. License information: Copyright © 2024 the authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original US government works. https://www.sciencemag.org/about/ science-licenses-journal-article-reuse SUPPLEMENTARY MATERIALS science.org/doi/10.1126/science.adh1823 Materials and Methods Supplementary Text Figs. S1 to S15 Tables S1 to S5 References (52–60) p ACKN OWLED GMEN TS Funding: M.G. and F.R. are supported by the Spanish Research Council (grant PID2019-111148GB-100 and PID2022-139913NB-100). Submitted 16 February 2023; accepted 9 January 2024 10.1126/science.adh1823 g 12. C. W. Lynn, E. J. Cornblath, L. Papadopoulos, M. A. Bertolero, D. S. Bassett, Proc. Natl. Acad. Sci. U.S.A. 118, e2109889118 (2021). 13. J. Li, J. M. Horowitz, T. R. Gingrich, N. Fakhri, Nat. Commun. 10, 1666 (2019). 14. É. Roldán, J. Barral, P. Martin, J. M. Parrondo, F. Jülicher, New J. Phys. 23, 083013 (2021). 15. A. C. Barato, U. Seifert, Phys. Rev. Lett. 114, 158101 (2015). 16. J. M. Horowitz, T. R. Gingrich, Nat. Phys. 16, 15–20 (2020). 17. G. Bisker, M. Polettini, T. R. Gingrich, J. M. Horowitz, J. Stat. Mech. 2017, 093210 (2017). 18. G. Teza, A. L. Stella, Phys. Rev. Lett. 125, 110601 (2020). 19. D. J. Skinner, J. Dunkel, Proc. Natl. Acad. Sci. U.S.A. 118, e2024300118 (2021). 20. A. Dechant, S.-i. Sasa, Phys. Rev. X 11, 041061 (2021). 21. C. Dieball, A. Godec, Phys. Rev. Lett. 129, 140601 (2022). 22. E. Dieterich, J. Camunas-Soler, M. Ribezzi-Crivellari, U. Seifert, F. Ritort, Nat. Phys. 11, 971–977 (2015). 23. R. Rodríguez-García et al., Biophys. J. 108, 2794–2806 (2015). 24. C. Manzo, M. F. Garcia-Parajo, Rep. Prog. Phys. 78, 124601 (2015). 25. S. Scott et al., Phys. Chem. Chem. Phys. 25, 1513–1537 (2023). 26. W. W. Ahmed et al., Biophys. J. 114, 1667–1679 (2018). 27. S. Salinas-Almaguer et al., Sci. Rep. 12, 933 (2022). 28. R. Garcia-Millan, G. Pruessner, J. Stat. Mech. 2021, 063203 (2021). 29. H. Turlier, T. Betz, Annu. Rev. Condens. Matter Phys. 10, 213–232 (2019). 30. Y.-Z. Yoon et al., Biophys. J. 97, 1606–1615 (2009). 31. T. Betz, M. Lenz, J.-F. Joanny, C. Sykes, Proc. Natl. Acad. Sci. U.S.A. 106, 15320–15325 (2009). y y g y , Di Terlizzi et al., Science 383, 971–976 (2024) 1 March 2024 6 of 6
RES EARCH MARINE CONSERVATION Divergent responses of pelagic and benthic fish body-size structure to remoteness and protection from humans Tom B. Letessier1,2,3*, David Mouillot4, Laura Mannocci4,1, Hanna Jabour Christ3, Elamin Mohammed Elamin5, Sheikheldin Mohamed Elamin6, Alan M. Friedlander7,8, Alex Hearn9,10, Jean-Baptiste Juhel11, Alf Ring Kleiven12, Even Moland12,13, Nicolas Mouquet1,4, Portia Joy Nillos-Kleiven12, Enric Sala7, Christopher D. H. Thompson3, Laure Velez4, Laurent Vigliola11, Jessica J. Meeuwig3,14 1 March 2024 1 of 7 , Letessier et al., Science 383, 976–982 (2024) Our surveys, conducted from January 2006 to May 2020, recorded a total 823,849 individual fish (pelagic: 106,424, benthic: 717,425; Fig. 2), representing 139 families and 1460 species of fishes and sharks (211 pelagic, 1376 benthic, and 127 species recorded in both systems) and weighing a combined 744 metric tons (pelagic: 325 tons; benthic: 418 tons). Our dataset lacked representation from the North Pacific, and representation in the central Pacific and in most of the Atlantic was limited to pelagic systems only. Size-frequency distributions were generated by aggregating sizes within six broad brackets of absolute latitude (Fig. 3), which revealed distinct patterns within each system that were robust to an unbalanced survey design (17). Benthic median sizes were generally larger than pelagic medians (range of medians: pelagic 4 to 134 g, benthic 27 to 120 g) owing to the greater representation of smaller size classes (<30 g). Upper size classes were better represented in pelagic size distributions than in benthic size distributions (range of 95th percentiles, pelagic 0.4 to 83.3 kg, benthic 1.3 to 2.9 kg; Fig. 3A). Size spectra slopes, a measure of the proportion of large to small individuals (17), were contrasted between systems by regressing normalized size-frequency distributions on the log10-log10 scale (Fig. 3B). Slope values were consistently steeper (more negative) in benthic systems than in pelagic systems (table S1), y *Corresponding author. Email: tom.letessier@ioz.ac.uk Body-size structure across systems y g CESAB – FRB, Montpellier, France. 2Institute of Zoology, Zoological Society of London, Regent’s Park, London, UK. 3Marine Futures Lab, School of Biological Sciences, University of Western Australia, Perth, WA, Australia. 4MARBEC, Université de Montpellier, CNRS, Ifremer, IRD, Montpellier, France. 5Red Sea Fisheries Research Station, P.O. Box 730, Port Sudan, Red Sea State, Sudan. 6Faculty of Marine Science and Fisheries, Red Sea State University, P.O. Box 24, Port Sudan, Red Sea State, Sudan. 7National Geographic Society, Washington, DC 20036, USA. 8Hawai‘i Institute of Marine Biology, University of Hawai‘i, Kāne‘ohe, Hawai‘i, USA. 9Galapagos Science Center, Universidad San Francisco de Quito, Quito, Ecuador. 10MigraMar, Olema, CA, USA. 11ENTROPIE, Institut de Recherche pour le Développement, IRD-UR-UNC-IFREMER-CNRS, Centre IRD de Nouméa, Nouméa Cedex, New-Caledonia, France. 12Institute of Marine Research, Nye Flødevigveien 20, 4817 His, Norway. 13 Centre for Coastal Research (CCR), Department of Natural Sciences, University of Agder, P.O. Box 422, N-4604 Kristiansand, Norway. 14Oceans Institute, University of Western Australia, Perth, WA, Australia. 1 y the next, for example, plankton, planktivorous fishes, and piscivorous fishes (10, 11). However, assessing such size-structured variation across marine habitats and regulations is particularly challenging because dedicated survey methodologies with different size selectivity are used in pelagic and benthic systems. For instance, whereas pelagic fishes are conventionally sampled through longlines and midwater trawls or acoustic techniques (12, 13), benthic fishes are mainly surveyed by underwater visual census (14) or with bottom trawls and other habitat-specific gears (15), which makes intersystem comparisons difficult. Stereo baited remote underwater video stations (BRUVS) represent a unifying, nondestructive, and fisheries independent method that can estimate relative abundance and body size across virtually any marine system (16). In this work, we conducted a widespread size-based assessment of marine pelagic and benthic nekton fishes (>1 g), spanning six orders of magnitude in body size, from zooplankton size classes (~3 to 4 cm) to large oceanic predators (~1000 kg; Fig. 1). We combined records from multiple surveys inside and outside MPAs, resulting in 6701 BRUVS deployed in pelagic systems and 10,710 BRUVS deployed in ben- g B ody size is a universal biological property that influences ecological processes at the individual, population, and ecosystem levels (1). Measuring size spectra (size frequencies plotted on a log-log scale) is therefore a useful framework through which to understand and predict overexploitation (2), nutrient cycling (3), and productivity (4). Moreover, understanding how body sizes are distributed in the oceans has ramifications for conservation and fisheries science and is highly relevant to several of the United Nations (UN) Sustainable Development Goals. In particular, effective biodiversity conservation (5) and 30% protection coverage by 2030 (“30 by 30” goal) (6) require understanding of how successful marine protected areas (MPAs) are likely to be in different socioenvironmental contexts (7). Within a given pelagic or benthic system, size spectra typically show consistent alternations between overrepresented and underrepresented sizes, resulting in regular peaks and troughs (8, 9). When slopes of size spectra are shallow and peaks are prominent, the spread between peaks is generally considered to reflect predator-prey relationships, with each peak representing a different trophic group that is preyed upon by p Animal body-size variation influences multiple processes in marine ecosystems, but habitat heterogeneity has prevented a comprehensive assessment of size across pelagic (midwater) and benthic (seabed) systems along anthropic gradients. In this work, we derive fish size indicators from 17,411 stereo baited-video deployments to test for differences between pelagic and benthic responses to remoteness from human pressures and effectiveness of marine protected areas (MPAs). From records of 823,849 individual fish, we report divergent responses between systems, with pelagic size structure more profoundly eroded near human markets than benthic size structure, signifying greater vulnerability of pelagic systems to human pressure. Effective protection of benthic size structure can be achieved through MPAs placed near markets, thereby contributing to benthic habitat restoration and the recovery of associated fishes. By contrast, recovery of the world’s largest and most endangered fishes in pelagic systems requires the creation of highly protected areas in remote locations, including on the High Seas, where protection efforts lag. thic systems, which corresponds to 13,402 and 10,710 hours of footage, respectively, across the Atlantic, Indian, and Pacific Oceans. This database yielded length measurements for individual fish, which were converted to weights using taxa-specific allometric conversion parameters (17, 18) (Fig. 2 and fig. S1). To better understand how MPAs may effectively protect fish size structure in the context of the “30 by 30” goal, we tested two competing and mutually exclusive hypotheses regarding the influence of human pressures on fish size structure in pelagic and benthic systems. First, we hypothesized a greater human footprint in pelagic systems compared with benthic systems because the larger body size and longer life of many oceanic species renders them more vulnerable to fisheries (19). Therefore, we expect that pelagic fish size structure is more sensitive to protection status and human pressures than benthic fish size structure. As an alternative hypothesis, the migratory capacity of many large pelagic species and the widespread activities of highsea fishing fleets (20) result in a comparatively low human footprint and low MPA effectiveness in pelagic systems in contrast to benthic systems, where local human pressure has acted longer (21) and where fish size structure would therefore be more affected and sedentary species would benefit more from MPAs (22).
RES EARCH | R E S E A R C H A R T I C L E y g slope theoretically reflecting the steepness of the trophic pyramid (25). We then built explanatory generalized least-square (GLS) models (35) to test the two competing hypotheses by identifying how human pressure and protection status affected pelagic and benthic fish size indicators. In addition to controlling for spatiotemporal autocorrelation and socioenvironmental conditions that are known to influence the effectiveness of spatial protection status (36) (fig. S3 and table S2), our models considered interactions between systems (pelagic or benthic) and protection status, as 1 March 2024 represented by three different categories of spatial protection (37) (not protected, partially protected, or highly protected) (17), and human pressure, as represented by travel time to human markets (38) (log10 minutes). GLS models of relatively small and relatively large fishes achieved moderate explanatory power [R2 adjusted for nonsignificant explanatory variables (adjR2), small individuals: 0.257, large individuals: 0.343], revealing an effect of market proximity and protection status, which was consistent in direction but specific in magnitude to each system (P < 0.05; Fig. 4A, figs. S4 2 of 7 , Fig. 1. Body-size variability in pelagic and benthic systems, recorded by stereo BRUVS. Pelagic systems are shown on the left and benthic systems on the right. (A) Great white shark (Carcharodon carcharias). (B) Grey reef shark (Carcharhinus amblyrhynchos). (C) Yellowfin tuna (Thunnus albacares). (D) Horse-eye jack (Caranx latus). (E) Juvenile jack (Carangidae sp). (F) Tiger shark (Galeocerdo cuvier). (G) Two-spot red snapper (Lutjanus bohar). (H) Spiny dogfish (Squalus acanthias). (I) Goldband fusilier (Caesio chrysozona). (J) Creole wrasse (Clepticus parrae). [Credits: Photos were taken by the authors]. y Letessier et al., Science 383, 976–982 (2024) y We tested our hypotheses concerning the difference in relative sensitivity of pelagic and benthic size structure by extracting three size indicators (33) from frequency-size distributions of nekton fishes aggregated by survey date (17) (fig. S2); the typical body sizes (log10, kg) of relatively small individuals and of relatively large individuals, as represented by the values at the first and second modal frequency peaks; and the exponent b of the size spectra slope (34). These three indicators capture the main dimensions of size structure within each system, at the scale of the survey day, with the size of relatively small and large individuals representing relatively lower and higher trophic levels, respectively (10), and the size spectra g Human footprint on size structure p reflecting the greater absolute and relative number of large individuals in pelagic systems (17). Both the spread between peaks and sizespectra slope values were distinct between pelagic and benthic systems across biogeographical scales, which suggests that each system supports distinct food webs and energy pathways (23). The presence of prominent peaks in pelagic systems is consistent with previous reports (10) and suggests that each peak reflects a trophic group that is preyed upon by the next, with shallower slopes reflecting carnivorous feeding (11). In benthic systems, peaks were less clearly defined and slopes steeper, consistent with greater levels of herbivorous feeding (11) likely stemming from greater dependence on seabed algae compared with in the midwater (24). Greater prevalence of carnivory in pelagic systems implies that the proportion of production retained between trophic levels is higher (25) as a result of more-direct energy transfer in these systems than in benthic systems. Overrepresentation of intermediate size classes (30 to 500 g) in benthic systems is consistent with complex habitat structure in coastal ecosystems such as kelp forests and coral reefs (26) that provide size-selective refugia (27). Elevated benthic productivity within these size classes is further promoted through system connectivity and benthic-pelagic coupling (28), whereby passively drifting plankton are consumed by planktivorous and piscivorous fishes near the seabed (29). Conversely, pelagic productivity and energetic needs in upper trophic levels are promoted by more-direct energy transfer (11) and are facilitated by greater home ranges such that individuals in upper trophic levels can forage from the top of multiple benthic food webs (30) or from more productive geographical regions such as those in temperate latitudes (31). Mobile strategies in upper trophic levels typically involve pelagic foraging incursions or are associated with fully pelagic lifestyles (32), which results in a greater prevalence of upper trophic levels in pelagic systems.
RES EARCH | R E S E A R C H A R T I C L E p g y y g y , Fig. 2. Body sizes of pelagic and benthic fishes identified on BRUVS. (A) Survey effort of BRUVS, showing the outlines of the world’s Economic Exclusive Zones in gray contours (some of which are contested). Each circle represents a single expedition, with the circle diameter being proportional to the number of BRUVS deployed. Circles are jittered to minimize overplotting. (B) Pelagic and benthic fish body sizes (kg, n = 823,849) categorized by species identity (n = 1460) and rankordered by median species body size. (C) Marginal density distribution plots of body sizes. and S5, and tables S3 and S4). In both systems, individuals were larger if highly protected and remote from markets, consistent with our present understanding re-garding how vulnerability and exploitation vary with protection and accessibility (36). However, relatively small and large individuals in pelagic systems Letessier et al., Science 383, 976–982 (2024) were both consistently more sensitive to protection status and to market remoteness, with a cumulative impact of protection status and market remoteness. In benthic systems, relatively small individuals were less sensitive to protection than large individuals, in keeping with expectations on how vulnerability to exploitation varies with 1 March 2024 differences in life history (14, 19). Moreover, the effect of protection status saturated with remoteness, with remoteness having increasingly less relative impact under higher protection. GLS models of size spectra (adjR2, sizespectra slope: 0.273; Fig. 4B, fig. S6, and table S5) showed divergent effects in each 3 of 7
RES EARCH | R E S E A R C H A R T I C L E p Fig. 3. Pelagic size spectra are shallower than those of their benthic counterparts across biogeographical scales. (A) Frequency density distribution of fish body sizes aggregated into six absolute latitude brackets (0 to 10, 10 to 15, 15 to 20, 20 to 23, 23 to 33, 33 to 65) of equal numbers of body sizes (n = 137,308), with vertical line and number showing median and 95th percentile values, respectively. (B) Abundance size spectra, normalized by dividing the frequency counts by the width of the bin, with lines representing fit of linear regressions (pelagic slope mean: −1.38, range: −1.47 to −1.29; benthic mean: −1.58, range: −1.63 to −1.54). g y 4 of 7 , 1 March 2024 Our results suggest that size-structure resilience to human pressure is lower in pelagic systems than in benthic systems. In theory, size spectra slopes are expected to steepen with increasing human exploitation as a consequence of predator depletion, leading to a commensurate decline in mean trophic level (39). However, reports of human pressure responses in benthic systems are conflicting, with both a steepening size spectra slope (39) and a modest increase in mean trophic level reported (14, 40). This apparent conflict may stem from difficulties in establishing appropriate baselines in “pristine” benthic systems, which show wide-ranging size spectra slope values (39) (i.e, −1.95 to −1.13) and both inverse and concave trophic pyramids (14, 30). Our observations of only a marginal effect on benthic slopes are, in any case, consistent with reports of a comparatively modest impact of human pressure on mean trophic level, which has been corroborated from across a wide range of benthic systems and arguably by a y Letessier et al., Science 383, 976–982 (2024) inclusion of the Indian Ocean data (fig. S9). Our main findings concerning the direction of both remoteness and protection in pelagic and benthic systems remained largely unchanged from those derived using the full dataset. Taken together, our models support our first hypothesis, that pelagic fish size structures are more vulnerable to human pressure than their benthic counterparts. That both relatively small and relatively large individuals in pelagic systems were consistently affected near markets means that greater sensitivity in pelagic systems cannot be attributed solely to the greater occurrence of larger (and therefore more vulnerable) individuals. In benthic systems, the magnitude of protection effect declined with market distance, in contrast to a cumulative effect with market distance in pelagic systems. This contrasting result means that high protection status can, even near markets, mitigate human pressures in benthic systems, whereas effective protection in pelagic systems requires market remoteness. y g system, with size spectra slopes in pelagic systems showing a pronounced and rapid steepening with market proximity under high protection and marginal effects of protection status and market proximity after that. By contrast, slopes in benthic systems were marginally affected, becoming less negative (shallower) near markets, independently of protection status. Without protection, steepening of pelagic slopes and shallowing of benthic slopes resulted in converging size structure between systems with considerable overlap in slope values near markets in unprotected locations. A sensitivity analysis testing the model robustness to the unbalanced survey reported similar effects of market proximity, with minor differences between models rerun with 10% of randomly dropped data points (17). Greater differences were observed between model reruns with ocean-specific data dropped. Notably, the results that showed that pelagic systems were highly responsive to highly protected remote areas were conditional on the
RES EARCH | R E S E A R C H A R T I C L E p g y y g y , Fig. 4. Human influences on fish body-size structure in pelagic and benthic systems. Marginal plots of the influence of increased travel time to market (log10, min) on fish size indicators under different levels of protection status (not protected, partly protected, and highly protected). (A) Mean body size of relatively small and relatively large fishes (log10, kg). (B) Slopes of fish size spectra. Lines indicate predictions from GLS models, and shaded areas indicate 95% confidence intervals. greater range of survey methods, including underwater visual censuses, scientific trawl surveys, and stock assessments (14, 40). Our confidence that human pressure results in only marginally shallower benthic size spectra as a reflection of a comparatively minor change in relative proportion of larger size classes is strengthened by the observed consistency of this shallowing across protection status but is Letessier et al., Science 383, 976–982 (2024) in contrast with expectation from “fishing down the food web” and other predictions from sizestructured biodiversity loss (41). Our results add to a body of evidence that suggests that benthic systems are relatively resilient compared with their pelagic counterparts. The emergence of benthic resilience is not fully understood, and any proposed mechanism in support is speculative. However, one 1 March 2024 possible explanation may be related to the emergence of alternative energy pathways when heavy exploitation triggers trophic cascades (42). Prey releases are generally predicted to occur as a consequence of trophic cascades under predator depletion (43). However, in benthic systems such as coral reefs, prey releases can be counteracted through size-based redundancy and feeding flexibility, which exist 5 of 7
RES EARCH | R E S E A R C H A R T I C L E Policy implications Our size-based assessment has enriched our understanding of ongoing marine biodiversity loss, revealing divergent impacts across pelagic and benthic communities, which may, as a result, converge toward a common intermediate and artificial size structure. Many processes that are important for maintaining productivity across trophic levels are supported by size-structured association within coupled benthic-pelagic systems. Convergence of pelagic and benthic communities toward an artificial size structure should be of concern if this results in a decoupling of pelagic and benthic ecosystem components, thereby disrupting fundamental processes that underpin functionality. Alternatively, it is plausible that these processes are buffered by the emergence of previously unknown benthic-pelagic associations, thereby ensuring resilience under sizestructured biodiversity loss. To help address the uncertainty concerning the functional consequence of size structure erosion, we recommend that future research efforts explore the link between size structure, ecosystem functioning, and connectivity, particularly in the context of coupled benthic-pelagic systems. Such knowledge would also have application within biodiversity conservation and ecosystem restoration. REFERENCES AND NOTES , 6 of 7 y 1. R. H. Peters, The Ecological Implications of Body Size, Cambridge Studies in Ecology (Cambridge Univ. Press, 1983). 2. C. F. Clements, M. A. McCarthy, J. L. Blanchard, Nat. Commun. 10, 1681 (2019). 3. P. Le Mézo, J. Guiet, K. Scherrer, D. Bianchi, E. Galbraith, Biogeosciences 19, 2537–2555 (2022). 4. A. Rogers, J. L. Blanchard, P. J. Mumby, J. Appl. Ecol. 55, 1041–1049 (2018). 5. E. Sala et al., Nature 592, 397–402 (2021). 6. Convention on Biological Diversity, Conference of the Parties to the Convention on Biological Diversity (CBD/COP/15/Part-II/ L.1) (United Nations Environment Programme, 2022). 7. J. E. Cinner et al., Proc. Natl. Acad. Sci. U.S.A. 115, E6116–E6125 (2018). 8. P. M. Yurista et al., Can. J. Fish. Aquat. Sci. 71, 1324–1333 (2014). 9. F. J. Heather, R. D. Stuart-Smith, J. L. Blanchard, K. M. Fraser, G. J. Edgar, Ecol. Lett. 24, 2146–2154 (2021). 10. A. G. Rossberg, U. Gaedke, P. Kratina, Nat. Commun. 10, 4396 (2019). 11. J. P. W. Robinson, J. K. Baum, Can. J. Fish. Aquat. Sci. 73, 496–505 (2016). 12. M. A. Peck et al., Prog. Oceanogr. 191, 102494 (2021). 13. S. Medoff, J. Lynham, J. Raynor, Science 378, 313–316 (2022). 14. N. A. J. Graham et al., Curr. Biol. 27, 231–236 (2017). 15. M. McLean et al., Glob. Change Biol. 25, 3972–3984 (2019). 16. N. E. Bosch et al., Conserv. Biol. 36, e13807 (2022). 17. See supplementary materials and methods. 18. R. Froese, P. Pauly, FishBase (2022); https://www.fishbase.org. 19. N. Pacoureau et al., Nature 589, 567–571 (2021). 20. D. A. Kroodsma et al., Science 359, 904–908 (2018). 21. D. Tickler, J. J. Meeuwig, M.-L. Palomares, D. Pauly, D. Zeller, Sci. Adv. 4, eaar3279 (2018). 22. M. Di Lorenzo et al., Nat. Commun. 13, 4381 (2022). 23. J. L. Blanchard, R. F. Heneghan, J. D. Everett, R. Trebilco, A. J. Richardson, Trends Ecol. Evol. 32, 174–186 (2017). 24. C. M. Duarte et al., Glob. Ecol. Biogeogr. 31, 1422–1439 (2022). 25. R. Trebilco, J. K. Baum, A. K. Salomon, N. K. Dulvy, Trends Ecol. Evol. 28, 423–431 (2013). y g 1 March 2024 Conclusions y International policy, including the KunmingMontreal Global Biodiversity Framework (GBF) COP15 declaration of 30% of the ocean to be protected by 2030 (6), requires that extensive areas of the oceans are set aside for protection in order to enhance biodiversity, ecosystem function, and ecological integrity and connectivity. To meet multiple GBF targets and address several of the UN Sustainable Development Goals, our analysis addressed two questions that are critical to the implementation of MPAs, related to ecological indicators and MPA placement, and one question concerning sustainable fisheries practices more broadly. 1) Particular characteristics of pelagic systems result in size structure that is highly sensitive to human pressure and render size indicators a powerful guide for priority placements of spatial protection, monitoring, and ecosystem-based management. In benthic systems, size indicators are comparatively less sensitive, so decisions should be informed through other indicators such as biomass (7) or functional diversity (49). 2) Pelagic vulnerability across multiple size classes reinforces the need for protection to provide refugia and rebuild depleted populations. A reversal of ongoing marine megafauna loss (19) is possible but requires intervention efforts that include implementation of highly protected MPAs in remote locations, including on the High Seas, consistent with the new High Seas Treaty (50). Homogenization of pelagic and benthic size structures signals the extent of already-experienced human impacts on benthic systems. For benthic systems, we confirm that protection would offer greater relative benefits in accessible locations (7), which should also be prioritized in order to rebuild coastal habitats and ecosystems. 3) Human impact across pelagic size classes indicates that it is not just the large predators that are vulnerable but also smaller-sized species, which underpin major fisheries, such as the anchoveta and sardines (12). Whether for single species or “balanced harvesting” strategies that target the entire size spectra, pelagic fisheries remain attractive to the commercial industry (12, 19). However, top-down control and low body-size redundancy are characteristics that render pelagic ecosystems inherently dynamic and vulnerable to overexploitation. We therefore caution against further expansion in pelagic fisheries, many of which are already overexploited or fully exploited, particularly as long as pelagic megafauna and the top-down control they exert remain threatened (19). g Letessier et al., Science 383, 976–982 (2024) habitat degradation scenarios, benthic size spectra are in fact expected to adopt characteristics more reminiscent of those of pelagic systems, with more pronounced peaks and greater spread (4), which reflects loss in sizestructured refugia at intermediate sizes. p as a result of high species richness (14). For example, increases in the relative proportion of trigger fish and wrasse are observed to counteract prey release of sea urchin, after depletion in high trophic levels (14), which results in greater food web flexibility and resilience. Benthic habitat complexity, which offers refugia for fish of intermediate sizes (30 to 500 g), may act further to moderate top-down control (4). Conversely, pelagic systems are associated with lower species richness and carnivorous feeding strategies with larger movement scales (19) across a wider range of body sizes, which results in low size-based redundancy. Trophic replacements have been reported in a pelagic food web (44): In the Benguela upwelling, a benthic species (the bearded goby Sufflogobius bibarbatus) was discovered to thrive after the depletion of sardines (Sardinops sagax) as a result of distinctive foraging behavior and physiological adaptations to anoxia. This replacement, which involved the emergence of a previously unknown benthic-pelagic association in response to external pressure, suggests that lack of resilience in pelagic food webs is associated with low size-based redundancy and limited alternative energy pathways. Disentangling ecological processes from human pressures is notoriously complicated by the correlated and often confounding nature of human activities. In this work, potentially confounding differences in exploitation histories and fisheries practices exists between pelagic and benthic ecosystems. Benthic trawl fisheries were some of the first to be developed after industrialization (45), whereas pelagic fisheries developed comparatively later (21), under rising profit requirements (46). As such, a loss of baseline and a preselection of particular sizes likely occurred before our surveys (47). However, potentially confounding histories in each system is unlikely to explain the distinction in size-structured characteristics or the divergent responses to human pressure. This is because human pressure near markets resulted in pelagic and benthic systems that are more similar in size structure than their remote and more pristine counterparts, with greater overlap in size spectra slope values and convergent size structure. If the effect of market distance on size spectra or the general distinction between pelagic and benthic systems were confounded by historical size preselection, we would expect to see remote pelagic and benthic systems with greater overlap in size spectra value than those near market, as a reflection of more pristine and therefore less distinct states in those remote locations, in contrast to our results. Moreover, that historical baselines in pelagic and benthic systems are likely more characteristic and dissimilar to each other than they are in their present state is consistent with hypothesized preselection from historical habitat loss (45, 48): Under
RES EARCH | R E S E A R C H A R T I C L E SUPPLEMENTARY MATERIALS science.org/doi/10.1126/science.adi7562 Materials and Methods Supplementary Text Figs. S1 to S9 Tables S1 to S5 References (53–80) MDAR Reproducibility Checklist y This work and associated analyses were only made possible through the dedicated video-processing efforts from numerous la république en Polynésie Française; Galapagos National Park Directorate, El rol de los islotes oceánicos para la protección de especies marinas migratorias; Government of French Polynesia Declaration 01/03/2013; Government of New Caledonia Convention 120325; Marine Fisheries Administration, Port Sudan, Red Sea State; Ministerio de Medio Ambiente y Desarrollo Sostenible, Ministry of Fisheries, Marine Resources and Agriculture; Environment Protection Agency Permit for route through MPA work; Ministry of Foreign Affairs of the Kingdom of Tonga; Niue Department of Fisheries, Agriculture and Forestry; Regional Government of the Azores; Palau National Government; Sistema Nacional de Áreas de Conservación (SINAC); Ministerio de Medio Ambiente y Energía; Serviço do Parque Natural da Madeira; Norwegian Directorate of Fisheries; Southern and Northern Province of New Caledonia; Tristan da Cunha Government. Author contributions: Authors 4 to 17 appear in alphabetical order and contributed equally to this work. Conceptualization: T.B.L., D.M., L.Vi., and J.J.M.; Data curation: T.B.L., J.J.M., H.J.C., L.M.; Formal analysis: T.B.L., D.M., L.M.; Funding acquisition: J.J.M., E.S., T.B.L., L.Vi., D.M., N.M., E.M.; Visualization: T.B.L.; Writing – original draft: T.B.L., D.M., L.M.; Writing – review and editing: D.M., L.M., H.J.C., E.M.E., S.M.E., A.M.F., A.H., J.-B.J., A.R.K., E.M., N.M., P.J.N.-K., E.S., C.D.H.T., L.Ve., J.J.M. Competing interests: The authors declare no competing interests. Data and materials availability: Data from New Caledonia, Tonga, and French Polynesia for seabed BRUVS (51) and for midwater BRUVS (52) are available at Zenodo. The remaining data from the other 77 locations and reproducible code for this analysis are available at https://github.com/LauraMannocci/sizespectra and can be found on the FishBase BRUVS portal (www.fishbase.org). License information: Copyright © 2024 the authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original US government works. https://www.science.org/about/science-licenses-journalarticle-reuse g ACKN OW LEDG MEN TS colleagues, technicians, and students. In particular, we thank P. Bouchet, T. Langlois for Global Archive, S. Weber, A. López, G. Kendrick, J. Clough, N. Casajus, J. Monk, D. Tickler, and G. Boussarie. We are also grateful for the assistance of the master and crew of the numerous vessels from which the field work was conducted. T.B.L. acknowledges OKEANOS, Department of Oceanography and Fisheries, University of the Azores, for hosting him and thus facilitating collegial discussions around the analysis. Other aspects of this work also benefited from discussions with experts and colleagues at the Institute of Marine and Antarctic Studies, University of Tasmania, and at the Australian Antarctic Program. Funding: This work was funded by the Australian Institute of Marine Science; PTT Exploration and Production PLC; Australian Academy of Science; Chevron; Darwin Initiative (grant no. DPLUS063); European Union’s BEST initiative (grant no. 1599); Fisheries Research and Development Corporation; Ian Potter Foundation; Jock Clough Foundation; MERL; National Geographic Pristine Seas; Natural Heritage Trust; National Environmental Research Program (UK); National Environmental Science Program (AUS); Pilbara Marine Conservation Partnership (AUS); Rottnest Island Authority; TeachGreen; Totale (Fr); Vermilion Oil and Gas Australia; Waitt Institute; WA Marine Science Institute; Woodside Energy; Galapagos Conservation Trust; Galapagos Science Center; MigraMar (EC); European Union, MARHAB (grant no. 101135307); Norwegian Agency for Development Cooperation (NORAD); Norwegian Embassy in Khartoum (SD) through UNIDO (SAP ID 130130); Norway county municipality of Trøndelag; municipalities of Hitra, Frøya, and Tvedestrand; French Oceanographic fleet through Pristine and Apex campaigns; and the IMR Coastal Ecosystems Programme. T.B.L. was funded by the synthesis center CESAB of the French Foundation for Research on Biodiversity (FRB), the Mediterranean Centre for Environment and Biodiversity Laboratory of Excellence (CeMEB LabEx) (https://www.labex-cemeb.org), and the Bertarelli Foundation. Permits: All research activities were conducted under national authority permits issued by Ascension Island Government (ERP-2017-08); Australian Commonwealth Government [PKNP_2016_1, PA2018-00091-1 (variation PA2018-00091-3), PA2018-00091-2 (variation PA2018-00091-4),CMR-16-000426, CMR-18-000550, CMR-17-000526, PA2018-00036-1, PA201800079-1, CMR-17-000526, CMR-17-000526]; Australian Government Great Barrier Reef Marine Park Authority G17/39150.1, DBCA 01-000049-8; Delegation regionale à la recherche et à la technologie - Haut-commissariat de la Republique en Polynesie Francaise, 05/08/2014; Department of Parks and Wildlife 01000049-7; Directorate of Fisheries 23/4532; Foreign and Commonwealth Office, British Indian Ocean Territory Directorate; France’s Ministry of Ecological Transition, Le Haut commissariat de p 26. K. L. Nash, N. A. J. Graham, S. K. Wilson, D. R. Bellwood, Ecosystems 16, 478–490 (2013). 27. A. Rogers, J. L. Blanchard, P. J. Mumby, Curr. Biol. 24, 1000–1005 (2014). 28. J. L. Blanchard et al., J. Anim. Ecol. 78, 270–280 (2009). 29. R. A. Morais, D. R. Bellwood, Curr. Biol. 29, 1521–1527.e6 (2019). 30. J. Mourier et al., Curr. Biol. 26, 2011–2016 (2016). 31. C. S. Bird et al., Nat. Ecol. Evol. 2, 299–305 (2018). 32. P. D. van Denderen, M. Lindegren, B. R. MacKenzie, R. A. Watson, K. H. Andersen, Nat. Ecol. Evol. 2, 65–70 (2018). 33. Y.-J. Shin, M.-J. Rochet, S. Jennings, J. G. Field, H. Gislason, ICES J. Mar. Sci. 62, 384–396 (2005). 34. A. M. Edwards, J. P. W. Robinson, M. J. Plank, J. K. Baum, J. L. Blanchard, Methods Ecol. Evol. 8, 57–67 (2017). 35. A. C. AitkenIV, Proc. R. Soc. Edinb. 55, 42–48 (1936). 36. G. J. Edgar et al., Nature 506, 216–220 (2014). 37. K. Grorud-Colvert et al., Science 373, eabf0861 (2021). 38. E. Maire et al., Ecol. Lett. 19, 351–360 (2016). 39. J. P. W. Robinson et al., Glob. Change Biol. 23, 1009–1022 (2017). 40. T. A. Branch et al., Nature 468, 431–435 (2010). 41. D. Pauly, V. Christensen, J. Dalsgaard, R. Froese, F. Torres Jr., Science 279, 860–863 (1998). 42. W. J. Ripple et al., Trends Ecol. Evol. 31, 842–849 (2016). 43. T. Fung, K. D. Farnsworth, D. G. Reid, A. G. Rossberg, Nat. Commun. 6, 6657 (2015). 44. A. C. Utne-Palm et al., Science 329, 333–336 (2010). 45. C. Roberts, The Unnatural History of the Sea: The Past and Future of Humanity and Fishing (Gaia, 2007). 46. S. A. Sethi, T. A. Branch, R. Watson, Proc. Natl. Acad. Sci. U.S.A. 107, 12163–12167 (2010). 47. D. Pauly, Trends Ecol. Evol. 10, 430 (1995). 48. N. A. J. Graham et al., Conserv. Biol. 21, 1291–1300 (2007). 49. A. Dalongeville et al., J. Appl. Ecol. 59, 2803–2813 (2022). 50. United Nations General Assembly, “Draft agreement under the United Nations Convention on the Law of the Sea on the conservation and sustainable use of marine biological diversity of areas beyond national jurisdiction” (United Nations, 2023). 51. L. Vigliola, G. Mou Tham, J.-B. Juhel, BRUVS_Seabed_APEX. Zenodo (2024); https://doi.org/10.5281/zenodo.7793637. 52. L. Vigliola, G. Boussarie, T. Letessier, J. Meeuwig, BRUVS_Midwater_APEX. Zenodo (2024); https://doi.org/10.5281/ zenodo.7793697. Submitted 16 May 2023; accepted 24 January 2024 10.1126/science.adi7562 y g y , Letessier et al., Science 383, 976–982 (2024) 1 March 2024 7 of 7
RES EARCH EVOLUTION A morphological basis for path-dependent evolution of visual systems Rebecca M. Varney1*, Daniel I. Speiser2, Johanna T. Cannon1, Morris A. Aguilar1, Douglas J. Eernisse3, Todd H. Oakley1* Path dependence influences macroevolutionary predictability by constraining potential outcomes after critical evolutionary junctions. Although it has been demonstrated in laboratory experiments, path dependence is difficult to demonstrate in natural systems because of a lack of independent replicates. Here, we show that two types of distributed visual systems recently evolved twice within chitons, demonstrating rapid and path-dependent evolution of a complex trait. The type of visual system that a chiton lineage can evolve is constrained by the number of openings for sensory nerves in its shell plates. Lineages with more openings evolve visual systems with thousands of eyespots, whereas those with fewer openings evolve visual systems with hundreds of shell eyes. These macroevolutionary outcomes shaped by path dependence are both deterministic and stochastic because possibilities are restricted yet not entirely predictable. , 1 March 2024 y Varney et al., Science 383, 983–987 (2024) y g *Corresponding author. Email: varney@ucsb.edu (R.M.V.); oakley@ucsb.edu (T.H.O.) y University of California, Santa Barbara, Santa Barbara, CA, USA. 2University of South Carolina, Columbia, SC, USA. California State University, Fullerton, Fullerton, CA, USA. 3 g 1 could be identified as critical junctions. These functionally similar outcomes may still differ in form, so critical junctions may act to direct evolutionary pathways toward functionally similar but morphologically distinct outcomes. Second, even if convergent evolution reveals potential critical junctions, convergent evolution of traits occurs most commonly in organisms with very different body plans and ecologies, which are likely to exert different selective pressures on traits. Therefore, most instances of convergent evolution are not effective replicates for establishing path dependence (12). Finally, accurately reconstructing the evolutionary histories of convergent traits requires understanding of ancestral conditions and knowledge of the timing of key transitions in character states. This requires a detailed fossil record and/or a robust phylogenetic history beyond that which is available for many lineages. Together, these obstacles make identification of critical junctions and path dependence in natural systems enormously challenging. By overcoming the challenges imposed by other natural traits, the visual systems of chitons (Mollusca; Polyplacophora) provide a compelling case to test hypotheses about path-dependent evolution. First, morphologically distinct visual systems may have evolved separately in different lineages of chitons (21). Chiton visual systems likely evolved from aesthetes, which are numerous, microscopic sensory organs embedded in the eight articulating shell plates of these heavily armored mollusks (22). Aesthetes likely have multiple sensory functions, including sensitivity to light, but they do not confer vision (21, 23, 24). In most chitons, nerves from aesthetes run through narrow channels in the shell plates before exiting through slits at the edges of each plate (Fig. 1, A and B) (25, 26). In some lineages, pigmented clusters of photoreceptors (20 to 35 mm wide), hereafter referred to as eyespots, are attached to p E stablishing the extent to which the evolutionary trajectories of complex systems are contingent on historical events, a phenomenon called path dependence (1, 2), is fundamental for understanding the predictability of evolution. If there is a single, locally optimal solution to an environmental problem, then evolution will tend to be predictable; if many functionally similar solutions exist, then evolution will tend to be unpredictable (3–6). Path dependence occurs when evolutionary trajectories contain “critical junctions,” which we define as events that commit lineages to one of multiple possible evolutionary pathways, thereby constraining the suite of possible outcomes. Path dependence is well established for the evolution of particular proteins in unicellular laboratory systems [e.g., (7–13)]. Although specific evolutionary outcomes are restricted by earlier events in some natural systems [e.g., (14–16)], path dependence is very difficult to establish in any system outside of the laboratory. Demonstrating path dependence in natural systems is challenging because it requires the identification of critical junctions and elucidation of the constraints that those junctions impose on future evolutionary paths (17–20). First, critical junctions are difficult to identify because alternative evolutionary pathways are often not observable along the singular history of life. Path dependence may be inferred from convergent origins of complex traits because these events illustrate multiple evolutionary pathways, analogous to replicates in controlled laboratory experiments. If splits in evolutionary trajectories lead to functionally similar outcomes in separate lineages, then those splits aesthetes (Fig. 1, D, G, and J) (27, 28). In other lineages, the aesthetes are interspersed with camera-type eyes with image-forming lenses made of shell material (up to 145 mm wide), hereafter referred to as shell eyes [(22, 29–32); see Fig. 1, C, F, I]. If eyespots and shell eyes evolved separately in chitons, then these distributed visual systems may represent distinct evolutionary paths to a convergent functional outcome: spatial vision. Indeed, computational modeling and behavioral experiments indicate that both the eyespot- and shell eye–based distributed visual systems of chitons provide spatial vision (26, 31–33). Second, chitons have a relatively rich fossil record, permitting timecalibrated phylogenetic analyses (34). If the distributed visual systems of chitons have recent origins, then their evolutionary histories may be reconstructed with greater confidence than those of other visual systems, which largely have ancient histories (35). Finally, fossil and extant chitons are found in similar environments and thus tend to be ecologically similar: Most species live (or lived) on hard substrates in intertidal or shallow subtidal habitats. The body plan present in both fossil and extant chitons is consistent across clades and evolutionary time (36–39). Species exhibiting the full range of shell-embedded sensory organs can even be found living on the same rock (40). Here, we investigated whether the evolution of distributed visual systems in chitons is path dependent by mapping the origins of eyespots and shell eyes onto the most comprehensive chiton phylogeny produced to date. We then used the rich fossil record of chitons to timecalibrate our phylogeny, and graphed outcomes onto a phylomorphospace to identify specific points where earlier events committed some lineages to one or another specific evolutionary pathway, resulting in multiple solutions to the evolution of spatial vision. Our discoveries show that the evolution of complex visual systems, which are often portrayed as deterministic [e.g., (41)], is path dependent: Events at specific points (critical junctions) constrain lineages to one of a subset of possible pathways. Chitons rapidly evolved visual systems four times in two distinct forms To characterize patterns of visual system evolution in chitons, we used genomic target capture and Bayesian inference to produce the most complete phylogeny of chitons to date, with emphasis on Chitonina, the suborder that includes more than half of all extant chiton species and most species with eyespots or shell eyes. We found that distributed visual systems evolved separately in chitons at least four times: two lineages through eyespots and two other lineages through shell eyes (Fig. 2, A and B). The two lineages that contain species with eyespots, Callochitonida (28) and Chitonidae: Chitoninae (27, 42), are distantly related to 1 of 5
RES EARCH | R E S E A R C H A R T I C L E A B C D E F G H I J i.s. s.r. p g y 1 March 2024 placophorans (38) have or had aesthetes, but, as ASR reveals, eyespots and shell eyes are recent and nonhomologous additions to chiton sensory systems. Eyespots evolved independently in Callochitonida and Chitonidae: Chitoninae, and likewise shell eyes evolved independently within Chitonidae: Acanthopleurinae + Toniciinae and in Schizochitonidae. Within Chitonidae, eyespots evolved in a subclade in Chitoninae and shell eyes evolved in the last common ancestor of the other two subfamilies, Acanthopleurinae and Toniciinae. ASR showed that these visual systems evolved separately: The last common ancestor of Chitonidae only had aesthetes (95% 2 of 5 , Varney et al., Science 383, 983–987 (2024) imens available. Nevertheless, we are confident in our results because tests of branch stability do not indicate phylogenetic uncertainty in the placement of S. incisus in any of our analyses (see the supplementary materials, section 5.3, “Leaf instability testing”). Next, to assess support for independent origins of distributed visual systems in chitons, we performed ancestral state reconstruction (ASR). Using ASR, we found high support (≥95% proportional marginal likelihood) for all four instances of visual system evolution in chitons occurring independently. Not only all Chitonina, but all living chitons and even ancient fossil poly- y one another, consistent with previous molecular phylogenies (43–45). Likewise, distributed visual systems based on shell eyes also evolved twice separately, once in Chitonidae: Acanthopleurinae + Toniciinae and once in Schizochitonidae, which in our phylogeny is a sister to the rest of Chitonina, making it a distant relative of Acanthopleurinae + Toniciinae. The placement of the sole extant genus of Schizochitonidae, Schizochiton, has been uncertain across studies of chitons (43, 46, 47) in part because Schizochiton contains only two accepted species, S. incisus (46) and S. jousseaumei (Dupuis, 1917), and S. incisus were the only spec- from it. (F) Internal morphology of a shell eye, with photoreceptor cells forming a retina (orange) beneath a lens (blue) and a large optic nerve running through the upper layer of the shell plate (gray). (G) Internal morphology of an aesthete with an attached eyespot, with a patch of photoreceptor cells (orange) beneath a clear portion of the shell plate (red) and a nerve running through the upper layer of the shell plate (gray). Note that panels (B) to (G) are not to scale. (H) SEM image of the surface of an anterior shell plate from Katharina tunicata, a chiton with aesthetes only. The location of a single macraesthete is circled in green. Scale bar, 100 mm. (I) SEM of the surface of an anterior shell plate from Acanthopleura brevispinosa, a chiton with shell eyes. The location of a single macraesthete is circled in green, and a single shell eye is circled in blue. Scale bar, 100 mm. (J) SEM image of the surface of an anterior shell plate from Chiton marmoratus, a chiton with eyespots. The location of a single macraesthete is circled in green, and a single eyespot is circled in red. Note that eyespots are connected to macraesthetes but appear as open regions of shell plate on SEM. The pigment of eyespots is only visible through decalcification of shell plates. Scale bar, 100 mm. y g Fig. 1. Sensory organs embedded in chiton shell plates differ in morphology. (A) A chiton (top) with the most anterior shell plate outlined in orange and popped out below. On the ventral side (middle), slit rays (s.r.) are visible leading to each insertion plate slit (i.s.). On the dorsal side (bottom), only insertion slits are visible. (B) Distribution of aesthetes (green) on the shell plate of a chiton with only aesthetes. Nerves (green lines) from aesthetes run through channels in the tegmentum, the visible outer layer of the shell (gray), exit the shell plate through an insertion slit, and then join the lateral neuropil (black circle), a part of the chiton nervous system. (C) Distribution of aesthetes (green) and shell eyes (blue) on the shell plate of a chiton with shell eyes. The density of aesthetes is higher, and nerves from both aesthetes and shell eyes travel through the shell plate to exit through an insertion slit. (D) Distribution of aesthetes (green) and eyespots (red) on the shell plate of a chiton with eyespots. Each eyespot is paired with one aesthete, and nerves from both aesthetes and eyespots travel through the shell plate to exit through several insertion slits. (E) Internal morphology of an aesthete, the simplest sensory structure embedded in the upper layer of the shell plate (gray). Here, a macraesthete (green) is depicted with a micraesthete (pink) branching
RES EARCH | R E S E A R C H A R T I C L E A B Aesthetes only Eyespots Shell eyes p slit # 300 Outer ring indicates broader phylogenetic groups of chitons (gray boxes). (B) Time-calibrated phylogeny generated with Bayesian inference showing four independent origins of visual systems in chitons. Divergence times correspond to the geologic time scale below. ASR implies that all origins of eyespots or shell eyes in chitons come from an aesthete-only starting point, where all proportional marginal likelihoods are >95%. Additional support metrics are included in the supplemental materials (tables S2 and S8 and figs. S2, S3, and S9). Number of slits in shell plates is a critical junction in the evolution of chiton visual systems To demonstrate path dependence in natural systems, it is first necessary to identify critical junctions. To discover critical junctions during the evolution of visual systems in chitons, we examined morphological differences between the shell plates of species with only aesthetes, species with eyespots, and species with shell eyes, and examined ancestral states for these traits. Most chitons integrate their shell-embedded sensory organs into their nervous system by passing nerves through slits along the edges of 3 of 5 , 1 March 2024 visual system in 2 million years, within an order of magnitude of the 7 million years that we estimate for visual system evolution within Chiton. For comparison, the only published estimate of the time required to evolve an eye is from vertebrates, in which eyes evolved in ~30 million years (35, 54). Recent origins of shell eyes and eyespots in chitons allow us to calibrate the timing of visual system evolution with greater confidence from fossils. Thus, the recent origins and rapid evolution of visual systems in chitons make them particularly valuable for understanding how complex traits evolve. y from the Lower Paleocene (66 to 59.2 Ma ago) (48–50). Time-calibrated phylogeny and fossil evidence together indicate that both instances of shell eyes in chitons represent the most recent origins of camera-type eyes known. By comparison, the more ancient camera-type eyes of vertebrates and cephalopods originated at least 500 and 425 Ma ago, respectively (35, 51). Distributed visual systems based on eyespots may have evolved even more recently than those based on shell eyes. Time-calibrated phylogeny and fossil evidence places the origin of eyespots in Chiton between 25 and 75 Ma ago. By contrast, eyespots in Callochiton could be as old as 260 Ma ago, but this date is less certain. To determine how rapidly chitons evolved visual systems based on eyespots, we quantified the time between the origin of eyespots in Chiton and the most recent ancestor in Chitonina lacking pigmented eyespots. Using our fossil-calibrated time tree, we found that eyespots in Chiton originated within a period of seven million years. Theoretical models estimate that eyes can evolve within 363,992 generations (3, 52), so if we assume that chitons have a generation time of 3 years [based on available studies of other chiton genera, e.g., (53)], then a lineage of chitons could evolve a y g Varney et al., Science 383, 983–987 (2024) Ma ago y proportional marginal likelihood). Thus, each of the four separate origins of visual systems in chitons is inferred to have evolved independently, including convergent origins of two different types of distributed visual systems, one based on eyespots and the other on shell eyes (Fig. 2A). Further, we found that eyespots and shell eyes evolved from aesthetes separately in Chitonidae, rather than eyes evolving from eyespots that evolved from aesthetes, a stepwise pattern that would have corresponded to the relative levels of morphological complexity demonstrated by these sensory organs. To understand the timing of separate origins of visual systems in chitons, we used fossil occurrence data to time-calibrate the phylogeny and found that all four convergent visual systems in chitons evolved within the past 260 million years (Fig. 1B and fig. S8). Our time-calibrated phylogeny indicates shell eyes evolved in the last common ancestor of Acanthopleurinae + Toniciinae between 150 and 100 million years (Ma) ago and in Schizochitonidae between 250 and 200 Ma ago, estimates considerably older than the earliest verified fossil evidence of shell eyes in fossil Toniciinae from the middle Eocene (48 to 38 Ma ago) and fossil Schizochitonidae represented by two species of Incisiochiton 100 g Fig. 2. Two types of distributed visual systems evolved convergently in chitons, one based on eyespots (red) and the other on shell eyes (blue). (A) The full maximum likelihood phylogeny of chitons produced by this study (outgroups not shown). Branch coloration indicates ASR of the number of slits in the anterior shell plate, where dark green represents 0 slits and pink represents >10 slits. Inner ring indicates the sensory organs embedded in the shell plates of taxa (aesthetes only, aesthetes and eyespots, or aesthetes and shell eyes), as well as phylogenetic affiliations. 200
RES EARCH | R E S E A R C H A R T I C L E 800 700 600 500 400 Macraesthetes/mm² 300 200 100 15 20 Slits (head valve) , 4 of 5 y 1 March 2024 In light of the four separate origins of visual systems in chitons and of the different morphological characters associated with them, we hypothesized that evolutionary outcomes in chiton visual systems were constrained by path-dependent evolution. From this hypothesis, we predicted that critical junctions have resulted in gaps in the morphospace of chiton visual systems due to the absence of intermediate forms: Chitons can have either eyespots or shell eyes, but not visual systems that share morphological characters with both. To test our hypotheses about path-dependent evolution in chitons, we constructed a phylomorphospace based on morphological traits associated with visual systems: aesthete density and number of slits in anterior shell plates. From museum specimens representing taxa across our phylogeny (fig. S4), we removed anterior shell plates and counted slits. We then quantified macraesthete densities (Fig. 1, H to J, green circles) from scanning electron microscope (SEM) images of these same plates and plotted these values alongside the number of slits in each species. Consistent with our prediction, we found a pronounced gap in the phylomorphospace, which suggests that slit number acts as a constraint on the type of visual system that a lineage of chitons can evolve (Fig. 3). The absence of intermediates in the phylomorphospace of chiton visual systems shows that chitons evolved vision through one of two distinct paths and suggests that the morphological characters that define each type of visual system are mutually exclusive. As in our ASR analysis, our phylomorphospace analysis indicated that increases in slit number preceded the evolution of eyespots in chitons. The number of slits in the anterior shell plates of chitons with eyespots was consistently higher than the ancestral number of slits in those lineages, and only those lineages of chitons that increased the number of slits in their plates evolved eyespots. Slit number therefore acts as a critical junction, an event that commits a lineage of chitons to one or the other evolutionary pathway toward spatial vision despite being unrelated to vision at the time of change. These critical junctions make the evolution of visual systems in chitons path dependent, and they are visible as a gap in phylomorphospace created by mutually exclusive solutions for spatial vision that are morphologically divergent yet functionally convergent. y g Fig. 3. Path dependence of visual system evolution in chitons is indicated by a phylomorphospace of vision-related morphological traits, showcasing two mutually exclusive solutions to vision. Phylomorphospace of chiton visual systems with number of slits on the anterior shell plate on the x axis and aesthete density (in aesthetes/mm2) on the y axis (37 species). Lepidopleurida are excluded for visualization, but a complete phylomorphospace is available in fig. S12 (39 species). There are two separate origins of shell eyes (blue squares indicate members of Acanthopleurinae + Toniciinae, and the blue diamond indicates the position of Schizochiton incisus) and two separate origins of eyespots (red triangles indicate the members of Chitoninae with eyespots and red inverted triangles indicate the members of Callochitonidae). Green circles indicate chitons with only aesthetes. As predicted, there is a gap in the morphospace, indicating that slit number is a critical junction in chiton visual system evolution. The gap results from the absence of intermediate forms of visual systems in chitons. Lineages are committed to one or the other visual system at a critical junction (the central split in lineages). Ancestral states of each lineage of chitons with either shell eyes or eyespots are included as open polygons of shapes corresponding to those denoting extant species. A phylomorphospace supports path-dependent evolution of chiton visual systems y 10 and Chitonida had eight or nine slits, indicating an independent origin of the increased number of slits in Callochitonida (fig. S8). In chitons, the evolution of eyespots appears to follow an increase in slit number, but the evolution of shell eyes does not, indicating that slit number is a critical junction during visual system evolution. g Varney et al., Science 383, 983–987 (2024) which we infer lacked eyespots, likely had 12 to 13 slits (fig. S8). Therefore, slits became more numerous in the Chiton + Radsia + Sypharochiton clade before the evolution of eyespots within Chiton. In Callochitonida, the other clade of chitons that evolved eyespots, an eyeless sister species or clade is unavailable because all Callochitonida examined to date appear to have eyespots (28). All species of Callochitonida in our analysis had >16 slits. Ancestral state reconstruction suggests that the last common ancestor of Callochitonida p their shell plates [(22, 25, 46, 55, 56); fig. S5]. In species with shell eyes, these slits are a vital part of the distributed visual system, because they make space for optic nerves to exit shell plates and make synaptic contact with the central nervous system (21). We predicted that as lineages of chitons added new types of sensory organs to their shell plates (like eyespots or shell eyes), they would require larger or more numerous slits for additional nerves to pass through. We compiled data on the number of slits in the anterior shell plates of all chitons in our phylogeny (table S2). Chitons may add slits to their shell plates as they grow, but slit number is not correlated with body size in chitons (larger chiton species do not have more slits) (fig. S14). Members of the clade sister to all remaining extant chitons, Lepidopleurida, lack slits. They innervate their aesthetes by running nerves through pores in their relatively thin shell plates, and outgroup comparisons indicate this is the ancestral state of crowngroup chitons [table S2; (34, 57)]. In the remaining orders of chitons, Chitonida and Callochitonida, species have thicker shell plates, so slits are necessary to innervate aesthetes; all of these chitons have at least five slits on their anterior shell plates, and most have fewer than 10 (37). Like most chitons that only have aesthetes, most extant species with shell eyes have 10 or fewer slits on their anterior shell plates, including S. incisus, which has seven, and the inferred ancestor of Acanthopleurinae + Toniciinae (fig. S8), which has eight. In contrast to species with shell eyes, all extant chitons with eyespots that we examined have anterior shell plates with between 14 and 21 slits. We thus hypothesized that an increased number of slits is a critical junction in the evolution of visual systems in chitons, favoring the evolution of eyespots but not shell eyes. If an increased number of slits is a critical junction that imposes a functional constraint favoring the evolution of eyespots instead of shell eyes, then an increase in the number of slits will predate the origin of eyespots themselves. Within Chitoninae (Fig. 2B), we compared the number of slits between species with eyespots and those with only aesthetes. All species with eyespots that we examined had ≥14 slits across their anterior shell plates. Chiton cumingsii, sister to the remaining members of Chiton in our phylogeny, does not have eyespots but has 14 slits (table S2 and personal observation by D.E. and D.I.S.). Sister to Chiton, species in the Radsia + Sypharochiton clade, all of which lack eyespots, have 13 to 16 slits. Sister to Chiton + Radsia + Sypharochiton, species in the Rhyssoplax + Tegulaplax clade have eight to 10 slits. We performed ancestral state reconstruction and found that the ancestors of Chitonidae and of Chitoninae each most likely had eight or nine slits, whereas the last common ancestor of Chiton + Radsia + Sypharochiton,
RES EARCH | R E S E A R C H A R T I C L E SUPPLEMENTARY MATERIALS science.org/doi/10.1126/science.adg2689 Materials and Methods Supplementary Text Figs. S1 to S14 Tables S1 to S9 References (61–100) MDAR Reproducibility Checklist Submitted 21 December 2022; resubmitted 16 June 2023 Accepted 11 January 2024 10.1126/science.adg2689 5 of 5 , We thank P. Bouchet, B. Buge, and N. Puillandre at MNHN, Paris; G. Paulay, J. Slapcinsky, and A. Bemis at UF, Florida Museum of Natural History; D. Geiger and V. Delnavaz at SBMNH, Santa Barbara, CA; and T. Gosliner and C. Piotrowski at CASIZ, San Francisco, CA for help with their respective collections. We are grateful to the following people for providing specimens in accordance with each country’s collection regulations: I. Shita Arlyza, P. Barber, L. Brooker, C. Cáceres Martínez, B. Dell’Angelo, R. Emlet, A. França, M. Hendrickx, A. Hodgson, C. Ibáñez, J. Whelpley, M. Langdon, S. Lockhart, P. Marko, T. Nakano, R. Noseworthy, J. Noseworthy, R. Sagarin, B. Sirenko, J. Sigwart, H. W. Detrich, C. Starger, S. Wiedrick, M. Weber, D. Willette, and C. Young. We also thank J. Wolfe, N. Hensley, and members of the Oakley lab for insightful remarks on the manuscript and L. Brooker and K. Kocot for providing additional chiton transcriptome data and support. J.T.C. thanks A. Swafford for assistance with code. Funding: This work was supported by the National Science Foundation (grant DEB 1354831 to D.I.S. and T.H.O.; grant DEB 1355230 to D.J.E.; grant EAGER 1045257 to T.H.O.; and grant IOS 1754770 to T.H.O.). The Center for Scientific Computing (CSC) is supported by the California NanoSystems Institute and the Materials Research Science and Engineering Center (supported by NSF grant DMR 1720256) at UC Santa Barbara. Use was made of computational facilities purchased with funds from the National Science Foundation (CNS-1725797) and administered by the CSC. Author contributions: Conceptualization: D.I.S., D.J.E., T.H.O.; Funding acquisition: D.I.S., D.J.E., T.H.O.; Investigation: R.M.V., D.I.S., J.T.C., M.A.A., D.J.E.; Methodology: R.M.V., D.I.S., J.T.C., M.A.A., D.J.E., T.H.O.; Project administration: T.H.O.; Supervision: T.H.O.; Visualization: R.M.V.; Writing – original draft: R.M.V., D.I.S., T.H.O.; Writing – review & editing: R.M.V., D.I.S., J.T.C., M.A.A., D.J.E., T.H.O. Competing interests: The authors declare no competing interests. Data and materials availability: All data and code used in the analyses are available in the main text, the supplementary materials, and in the Dryad repository (60). License information: Copyright © 2024 the authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original US government works. https://www.science.org/ about/science-licenses-journal-article-reuse y 1 March 2024 AC KNOWLED GME NTS y g Varney et al., Science 383, 983–987 (2024) 1. J. B. Losos, T. R. Jackman, A. Larson, K. Queiroz, L. Rodriguez-Schettino, Science 279, 2115–2118 (1998). 2. B. C. Dickinson, A. M. Leconte, B. Allen, K. M. Esvelt, D. R. Liu, Proc. Natl. Acad. Sci. U.S.A. 110, 9007–9012 (2013). 3. D. E. Nilsson, S. Pelger, Proc. Biol. Sci. 256, 53–58 (1994). 4. D. Arendt, Int. J. Dev. Biol. 47, 563–571 (2003). 5. T. K. Suzuki, S. Tomita, H. Sezutsu, BMC Evol. Biol. 14, 229 (2014). 6. U. Schlüter, A. P. M. Weber, Plant Cell Physiol. 57, 881–889 (2016). 7. J. R. Meyer et al., Science 335, 428–432 (2012). 8. A. Spor et al., Evolution 68, 772–790 (2014). 9. M. J. Harms, J. W. Thornton, Nature 512, 203–207 (2014). 10. E. R. Jerison, M. M. Desai, Curr. Opin. Genet. Dev. 35, 33–39 (2015). 11. M. S. Johnson et al., eLife 10, e63910 (2021). 12. V. C. Xie, J. Pu, B. P. Metzger, J. W. Thornton, B. C. Dickinson, eLife 10, e67336 (2021). 13. K. Karkare, H.-Y. Lai, R. B. R. Azevedo, T. F. Cooper, Mol. Biol. Evol. 38, 2869–2879 (2021). 14. N. J. Dominy, J. C. Svenning, W. H. Li, J. Hum. Evol. 44, 25–45 (2003). 15. R. S. Waples, D. J. Teel, J. M. Myers, A. R. Marshall, Evolution 58, 386–403 (2004). 16. B. P. Williams, I. G. Johnston, S. Covshoff, J. M. Hibberd, eLife 2, e00961 (2013). 17. Z. D. Blount, R. E. Lenski, J. B. Losos, Science 362, eaam5979 (2018). 18. J. Beatty, J. Philos. 103, 336–362 (2006). 19. J. Beatty, I. Carrera, Journal of the Philosophy of History 5, 471–495 (2011). 20. E. Desjardins, Biol. Philos. 26, 339–364 (2011). 21. D. R. Chappell, D. I. Speiser, D. J. Eernisse, A. C. N. Kingston, in Distributed vision: From simple sensors to sophisticated combination eyes, E. Buschbeck, M. Bok, Eds. (Springer, 2023), pp. 147–167. 22. H. N. Moseley, J. Cell Sci. S2, 37–60 (1885). 23. D. J. Eernisse, P. D. Reynolds, in Microscopic Anatomy of Invertebrates, F. W. Harrison, A. J. Kohn, Eds. (Wiley-Liss, 1994), vol. 5, Mollusca 1, pp. 56–110. 24. M. J. Vendrasco, C. Z. Fernandez, D. J. Eernisse, B. Runnegar, Am. Malacol. Bull. 25, 51–69 (2008). 25. H. von Knorre, Jena Z. Naturwiss 61, 469–632 (1925). 26. D. R. Chappell, D. I. Speiser, J. Exp. Biol. 226, jeb244710 (2023). 27. W. Haas, K. Kriesten, Zoomorphologie 90, 253–268 (1978). 28. J. M. Baxter, M. G. Sturrock, A. M. Jones, J. Zool. 220, 447–468 (1990). 29. M. Nowikoff, Zoologie 88, 154–186 (1907). 30. P. R. Boyle, Nature 222, 895–896 (1969). 31. D. I. Speiser, D. J. Eernisse, S. Johnsen, Curr. Biol. 21, 665–670 (2011). 32. L. Li et al., Science 350, 952–956 (2015). 33. A. C. N. Kingston, D. R. Chappell, D. I. Speiser, J. Exp. Biol. 221, jeb.183632 (2018). 34. S. S. Puchalski, D. J. Eernisse, C. C. Johnson, Am. Malacol. Bull. 25, 87–95 (2008). 35. T. D. Lamb, E. N. Pugh Jr., S. P. Collin, Evolution (N. Y.) 1, 415–426 (2008). 36. P. Kaas, A. M. Jones, K. L. Gowlett-Holmes, in Mollusca: The Southern Synthesis, vol. 5, P. L. Beesley, G. J. B. Ross, A. Wells, Eds. (CSIRO, 1998), pp. 161–194. 37. C. Z. Fernandez, M. J. Vendrasco, B. Runnegar, The Veliger 49, 51–69 (2007). 38. M. J. Vendrasco, T. E. Wood, B. N. Runnegar, Nature 429, 288–291 (2004). 39. J. Vinther, E. A. Sperling, D. E. G. Briggs, K. J. Peterson, Proc. Biol. Sci. 279, 1259–1268 (2012). 40. P. Glynn, “On the ecology of the Carribean chitons Acanthopleura granulata Gmelin and Chiton tuberculatus Linné: Density, mortality, feeding, reproduction, and growth” in Smithsonian Contributions to Zoology (Smithsonian, 1970). 41. R. Dawkins, Climbing Mount Improbable (Norton, 1997). 42. M. Nowikoff, Z. Wiss. Zool. 93, 668–680 (1909). 43. A. Okusu, Org. Divers. Evol. 3, 281–302 (2003). y Convergent evolution is often portrayed as an inevitable feature of lineages moving toward an optimal solution to an environmental problem (58). Such arguments dismiss contingency as a lesser force than selective pressure and assert that, given sufficient time, an optimized trait will evolve in a deterministic manner. However, chiton visual systems present a morphospace with multiple solutions: Networks of either eyespots or shell eyes provide chitons with spatial vision. We found evidence for a critical junction that defines convergent evolutionary pathways to spatial vision in chitons, where lineages split into two discrete trajectories that led to mutually exclusive types of visual systems. A gap in the phylomorphospace of chiton visual systems suggests that critical junctions have constrained lineages of chitons to particular evolutionary paths such that they can evolve one type of visual system but not another. Thus, no intermediate visual systems appear in the phylomorphospace. The two types of distributed visual systems of chitons rely on differing morphological innovations, like slit number in shell plates, that predate the evolution of spatial vision. Therefore, evolutionary outcomes are constrained by earlier evolutionary events. Previous studies, which RE FERENCES AND NOTES 44. I. Irisarri, J. E. Uribe, D. J. Eernisse, R. Zardoya, BMC Evol. Biol. 20, 22 (2020). 45. J. Moles, T. J. Cunha, S. Lemer, D. J. Combosch, G. Giribet, J. Molluscan Stud. 87, eyab019 (2021). 46. B. Sirenko, Venus (Tokyo) 65, 27–49 (2006). 47. E. Schwabe, Ruthenica 30, 55–68 (2020). 48. B. Dell’Angelo, M. Sosso, A. Kroh, A. Dulai, Bull. Geosci. 90, 359–370 (2015). 49. B. Dell’Angelo, J.-F. Lesport, A. Cluzaud, M. Sosso, Boll. Malacol. 54, 1–47 (2018). 50. B. I. Sirenko, B. Dell’Angelo, Tr. Zool. Inst. 327, 128–134 (2023). 51. Y. Zhang et al., Nat. Ecol. Evol. 5, 927–938 (2021). 52. D. Berlinski, “A scientific scandal” (Discovery Institute, 2002); https://www.discovery.org/a/1408/. 53. N. M. Otway, Mar. Biol. 121, 105–116 (1994). 54. T. D. Lamb, S. P. Collin, E. N. Pugh Jr., Nat. Rev. Neurosci. 8, 960–976 (2007). 55. P. R. Boyle, Cell Tissue Res. 153, 383–398 (1974). 56. F. P. von Fischer, Am. Malacol. Bull. 6, 153–159 (1988). 57. J. D. Sigwart, E. Schwabe, H. Saito, S. Samadi, G. Giribet, Invertebr. Syst. 24, 560–572 (2011). 58. S. C. Morris, Philos. Trans. R. Soc. Lond. B Biol. Sci. 365, 133–145 (2010). 59. P. Shah, D. M. McCandlish, J. B. Plotkin, Proc. Natl. Acad. Sci. U.S.A. 112, E3226–E3235 (2015). 60. Data and code for: R. M. Varney, D. I. Speiser, J. Cannon, M. Aguilar, D. J. Eernisse, T. H. Oakley, A morphological basis for path- dependent evolution of visual systems, Dryad (2024); https://doi.org/10.25349/D9FC8D. g Conclusions were confined to molecular experiments in laboratory environments, demonstrated that path dependence can dictate the order of adaptations and the persistence of changes across evolutionary time (2, 9, 59). Here, we have demonstrated path dependence in a naturally evolving system. Evolution is as much historical as biological, so clarifying the role of history in shaping evolutionary outcomes is critical to our understanding of the extent to which complex systems evolve in predictable ways. p Increases in aesthete density are associated with the evolution of visual systems in chitons, but aesthete density is not a critical junction because it does not constrain the type of visual system that a lineage can evolve. Most chitons with either shell eyes or eyespots have a greater density of aesthetes than chitons with only aesthetes (Fig. 3). The ancestral states predicted for both clades of chitons with shell eyes (Fig. 3, open blue square and open blue diamond, and fig. S11) and the clade in Chitoninae with eyespots (Fig. 3, open red triangle, and fig. S11) indicate increases in aesthete density before or concurrent with the evolution of distributed visual systems. Because species in all four lineages that gained visual systems tend to have denser arrays of aesthetes than their sister lineages, an increase in aesthete density may be a preadaptation for a lineage of chitons evolving a visual system. Slit number is a critical junction and not a preadaptation because slit number constrains the type of visual system that may evolve, but slit number can increase without the subsequent evolution of a visual system. When slit number increased in a lineage of chitons but aesthete density did not (Fig. 3, green circles), neither eyespots nor eyes evolved, emphasizing the role of increased aesthete density as a preadaptation. The evolution of visual system type in chitons is thus constrained, rather than being deterministic or stochastic: When aesthete density increases alongside slit number, lineages can evolve eyespots, and when aesthete density increases but slit number does not, lineages can evolve shell eyes.
RES EARCH STAR FORMATION A far-ultraviolet–driven photoevaporation flow observed in a protoplanetary disk Olivier Berné1*, Emilie Habart2, Els Peeters3,4,5, Ilane Schroetter1, Amélie Canin1, Ameek Sidhu3,4, Ryan Chown3,4, Emeric Bron6, Thomas J. Haworth7, Pamela Klaassen8, Boris Trahin2, Dries Van De Putte9, Felipe Alarcón10, Marion Zannese2, Alain Abergel2, Edwin A. Bergin10, Jeronimo Bernard-Salas11,12, Christiaan Boersma13, Jan Cami3,4,5, Sara Cuadrado14, Emmanuel Dartois15, Daniel Dicken2, Meriem Elyajouri2, Asunción Fuente16, Javier R. Goicoechea14, Karl D. Gordon9,17, Lina Issa1, Christine Joblin1, Olga Kannavou2, Baria Khan3, Ozan Lacinbala2, David Languignon6, Romane Le Gal1,18,19, Alexandros Maragkoudakis13, Raphael Meshaka2, Yoko Okada20, Takashi Onaka21,22, Sofia Pasquini3, Marc W. Pound23, Massimo Robberto9,17, Markus Röllig20, Bethany Schefter3, Thiébaut Schirmer2,24, Thomas Simmer2, Benoit Tabone2, Alexander G. G. M. Tielens23,25, Sílvia Vicente26, Mark G. Wolfire23, PDRs4All Team† Berné et al., Science 383, 988–992 (2024) 1 March 2024 1 of 5 , *Corresponding author. Email: olivier.berne@irap.omp.eu †PDRs4All Team authors and affiliations are listed in the supplementary materials. y 1 Institut de Recherche en Astrophysique et Planétologie, Université de Toulouse, Centre National de la Recherche Scientifique (CNRS), Centre National d’Etudes Spatiales, 31028 Toulouse, France. 2Institut d’Astrophysique Spatiale, Université Paris-Saclay, CNRS, 91405 Orsay, France. 3Department of Physics and Astronomy, The University of Western Ontario, London, ON N6A 3K7, Canada. 4Institute for Earth and Space Exploration, The University of Western Ontario, London, ON N6A 3K7, Canada. 5Carl Sagan Center, Search for ExtraTerrestrial Intelligence Institute, Mountain View, CA 94043, USA. 6Laboratoire d’Etudes du Rayonnement et de la Matière, Observatoire de Paris, Université Paris Science et Lettres, CNRS, Sorbonne Universités, F-92190 Meudon, France. 7School of Physics and Astronomy, Queen Mary University of London, London E1 4NS, UK. 8UK Astronomy Technology Centre, Royal Observatory Edinburgh, Blackford Hill EH9 3HJ, UK. 9Space Telescope Science Institute, Baltimore, MD 21218, USA. 10Department of Astronomy, University of Michigan, Ann Arbor, MI 48109, USA. 11ACRI-ST, Centre d’Etudes et de Recherche de Grasse, F-06130 Grasse, France. 12Innovative Common Laboratory for Space Spectroscopy, 06130 Grasse, France. 13NASA Ames Research Center, Moffett Field, CA 94035, USA. 14 Instituto de Física Fundamental, Consejo Superior de Investigaciones Científicas, 28006 Madrid, Spain. 15Institut des Sciences Moléculaires d’Orsay, Université Paris-Saclay, CNRS, 91405 Orsay, France. 16Centro de Astrobiología, Consejo Superior de Investigaciones Científicas, and Instituto Nacional de Técnica Aeroespacial, 28850 Torrejón de Ardoz, Spain. 17Johns Hopkins University, Baltimore, MD 21218, USA. 18Institut de Planétologie et d’Astrophysique de Grenoble, Université Grenoble Alpes, CNRS, F-38000 Grenoble, France. 19Institut de Radioastronomie Millimétrique, F-38406 Saint-Martin d’Hères, France. 20I. Physikalisches Institut, Universität zu Köln, 50937 Köln, Germany. 21Department of Astronomy, Graduate School of Science, The University of Tokyo, Tokyo 113-0033, Japan. 22Department of Physics, Faculty of Science and Engineering, Meisei University, Hino, Tokyo 191-8506, Japan. 23Astronomy Department, University of Maryland, College Park, MD 20742, USA. 24Department of Space, Earth and Environment, Chalmers University of Technology, Onsala Space Observatory, SE-439 92 Onsala, Sweden. 25Leiden Observatory, Leiden University, 2300 RA Leiden, Netherlands. 26Instituto de Astrofísica e Ciências do Espaço, P-1349-018 Lisboa, Portugal. y g  y (FUV) photons, those with energies below the Lyman limit (energy E < 13.6 eV), dominate the photoevaporation process. The effect affects the disk mass, radius, and lifetime (7, 10, 12–18); its chemical evolution (19–21); and the growth and migration of any planets forming within the disk (22). However, these processes have not been directly observed. Most observational constraints on the massloss rates associated with photoionization have been obtained for objects in the Orion Nebula known as proplyds, in which the ionization of FUV-driven photoevaporation flows from disks produces comet-shaped ionization fronts (23, 24). Modeling of the observed ionization fronts of proplyds has indicated mass-loss rates M ≈ 10−8 to 10−6 solar masses per year (M⊙ year−1) (25–27). However, those observations did not determine the physical conditions (radiation field, gas temperature, and density) at the locations where the photoevaporation flows are launched. Figure 1 shows optical and near-infrared images of the Orion Bar, a ridge in the Orion Nebula (31) situated about 0.25 pc southeast of the Trapezium Cluster of massive stars. The western edge of the bar constitutes the ionization front (Fig. 1B), which separates regions where the gas is fully ionized and at temperature T ~ 10 4 K from the neutral atomic region at T ~ 500 to 1000 K. We investigated the source [BOM2000] d203-506 (hereafter d203-506) (32, 33), a protoplanetary disk seen in absorption against the bright background, which is located at the following coordinates: right ascension 5h35m20s.357 and declination −5°25′05″.81 (J2000 equinox). Previous observations of d203-506 found no sign of an ionization front (32–34), indicating that the radiation field reaching the disk is dominated by FUV photons. We obtained near-infrared and submillimeter observations of d203-506, with the James Webb Space Telescope (JWST) and the Atacama Large Millimeter Array (ALMA), respectively, both at angular resolution ~0.1″ (corresponding to ~40 au at the distance of the Orion Nebula). JWST images were taken in multiple broad and narrow band filters using the Near-Infrared Camera (NIRCam) instrument (35). We also obtained near-infrared spectroscopic observations using the integral field unit (IFU) of the Near-Infrared Spectrograph (NIRSpec) instrument on JWST (35). The ALMA interferometric data cubes provided maps of rotational emission lines from the molecules HCN and HCO+, with a velocity resolution of 0.2 km s−1 (35). Figure 2 compares the JWST and ALMA images to archival optical images from the Hubble g Y oung low-mass stars are surrounded by protoplanetary disks of gas and dust, which have lifetimes of a few million years (1–3) and are the sites of planet formation (4). Planet formation is limited by processes that remove mass from the disk, such as photoevaporation (5). This occurs when the upper layers of protoplanetary disks are heated by x-ray or ultraviolet photons. Radiative heating increases the gas temperature, which brings the local sound speed above the escape velocity of the disk, causing the gas to escape from the system. Those photons could be from the central star (6) or from nearby massive stars (7). Because most low-mass stars form in clusters that also contain massive stars, most protoplanetary disks are exposed to external radiation, and so they are expected to experience photoevaporation driven by ultraviolet photons during their lifetime (7–11). Theoretical models predict that far-ultraviolet Images of a photoevaporation flow p Most low-mass stars form in stellar clusters that also contain massive stars, which are sources of farultraviolet (FUV) radiation. Theoretical models predict that this FUV radiation produces photodissociation regions (PDRs) on the surfaces of protoplanetary disks around low-mass stars, which affects planet formation within the disks. We report James Webb Space Telescope and Atacama Large Millimeter Array observations of a FUV-irradiated protoplanetary disk in the Orion Nebula. Emission lines are detected from the PDR; modeling their kinematics and excitation allowed us to constrain the physical conditions within the gas. We quantified the mass-loss rate induced by the FUV irradiation and found that it is sufficient to remove gas from the disk in less than a million years. This is rapid enough to affect giant planet formation in the disk. In the regions where FUV photons penetrate the disk, a photodissociation region (PDR) (28) forms at the disk surface. Most observational tracers of PDR physics (spectral lines of H2, O, and C+) are in the near- and far-infrared wavelength ranges. The spatial scale of PDRs in externally illuminated disks is a few hundred astronomical units (au), which corresponds to angular sizes <1 arc sec (″) for the closest starforming clusters (12, 29, 30).
RES EARCH | R E S E A R C H A R T I C L E A B C d203-506 50 au p 4000 au g Fig. 1. Optical and near-infared images of the Orion Bar region. (A) HST optical image centered at coordinates right ascension 5h35m20s.183 and declination −5°25′06″.14. [O III] filter at 502 nm is in blue, Ha filter at 656 nm is in green, and [N II] filter at 658 nm is in red. [Credit: NASA/STScI/Rice University/C. O’Dell et al. (47)]. (B) JWST near-infrared image of the same region at the same scale. Filters centered at 1.4 and 2.0 mm are in blue; at 2.77, 3.00, 3.23, 3.35, and 3.32 mm in green; at 4.05 mm in orange; and at 4.44, 4.80, and 4.70 mm in red. In (A) and (B), the Orion Bar separates regions where the gas is fully ionized (upper right) from those where it is in neutral form (lower left). (C) Zoomed-in view of the d203-506 disk. Red is the NIRCam image in the 2.12-mm filter, which traces molecular hydrogen; blue is the 1.64-mm filter, which traces [Fe II] emission lines; and green is the emission in the 1.40-mm broad-band filter, which traces scattered light. A B C D E F G H I y y g y , Fig. 2. Multiwavelength images of the d203-506 disk. (A) HST optical image in a Ha filter (23). (B to F) JWST near-infrared images (35). [(E) is reproduced with permission from (33)]. (G to I) ALMA submillimeter images (35). In all panels, the white-filled ellipse indicates the size and shape of the point spread function or reconstructed telescope beam, and the horizontal bar is 100 au. The white-dashed ellipse in (D) indicates the shape of the aperture used for the extraction of the NIRSpec spectrum in Fig. 4. The wavelength and physical assignment of each image is labeled above each panel; in (H) and (I), (4-3) is an abbreviation of (v = 0, J = 4 → 3). 1 Jy = 1 × 10−26 Wm−2 Hz−1. and NIRCam H2 (v = 1 → 0, J = 3 → 1) at 2.12 mm, respectively, which both show emission from the PDR surrounding the disk and absorption at the center. Both the H2 rovibrational and HCO+ rotational emission lines trace warm (gas kinetic temperatures Tgas ~ 500 to 1000 K) (v = 0, J = 4 → 3) line, where v and J denote the vibrational and rotational quantum numbers, respectively, at 354.505 GHz (845.664 mm), which traces cold molecular gas. Figure 2, I and E, shows emission maps of ALMA HCO+ (v = 0, J = 4 → 3) at 356.734 GHz (840.381 mm) Tow maard Tr ssiv ape e s ziu tars m Space Telescope (HST). The nearly edge-on (35) dusty disk of d203-506 is visible in absorption in all the HST and JWST images (Fig. 2, A to F) but in emission in the 344-GHz (870 mm) dust continuum (Fig. 2G). It is also seen in emission with ALMA in Fig. 2H, which shows the HCN Berné et al., Science 383, 988–992 (2024) 1 March 2024 2 of 5
RES EARCH | R E S E A R C H A R T I C L E molecular gas in PDRs (31). The PDR is also bright in the 3.35-mm NIRCam filter (Fig. 2F), which is dominated by aromatic infrared band (AIB) emission from ultraviolet-excited polycyclic aromatic hydrocarbon (PAH) molecules. PAHs are known to be tracers of PDRs (36) and have been previously mapped in a proplyd in the Orion Nebula (37). The PDR in d203506 is spatially resolved and extends south from the disk, forming a lobe shape. A jet is visible in the NIRCam [Fe II] filter at 1.62 mm (Fig. 2C). A bright emission spot is present in the H2 and HCO+ images in the northwestern part of the PDR and is also visible in the broad-band filter at 1.4 mm (Fig. 2B). The loca- tion of this bright spot coincides with the region of interaction between the jet and the PDR, which is visible only on the side facing the Trapezium Cluster. There is also AIB emission in the 3.35-mm NIRCam filter at this location (Fig. 2F), which indicates ultraviolet excitation. Figure 3 shows a schematic diagram of our interpretation of the morphological features in d203-506. Physical properties of the PDR Figure 4 shows the NIRSpec spectrum of d203506 (35). Numerous rovibrational emission lines of CO (v = 1 → 0 and v = 2 → 1), OH (v = 1 → 0), CH+ (v = 1 → 0), and H2 (up to J = 15) are p g y    y g Fig. 3. Schematic diagram of our interpretation of d203-506. Dark brown is the edge-on disk of cold molecular gas, which appears in absorption in the NIRCam images but in emission in the ALMA HCN and dust continuum images (Fig. 2). Brown arrows indicate molecular gas escaping from this disk, which feeds the photoevaporation flow. This produces an envelope around the disk (light brown shading), which is delimited by the dissociation front (orange band), where molecular hydrogen is dissociated into hydrogen atoms by FUV photons (pink arrows) coming from the Trapezium Cluster. The transition from molecular gas in the disk to atomic gas under ultraviolet irradiation constitutes the PDR. Blue shows the jet from the central star, which corresponds to the [Fe II] emission (Fig. 2C). The jet interacts with the envelope, producing a bright emission spot (yellow). The surroundings of d203-506 (gray) consist of diffuse atomic gas. detected. We interpreted these lines as coming from the PDR, so we traced the physical conditions of gas in that region. We modeled (35) the H2 lines using the Meudon PDR code (38), which calculates the H2 excitation in PDRs (Fig. 5). We derived the hydrogen number density nH and temperature of the gas in the H2 emitting layer (compare with Figure 2E) as nH = 5.5 × 105 to 1.0 × 107 cm−3 and Tgas = 1240 to 1260 K. We fitted a Keplerian orbit model to the HCN emission map (fig. S2) and used it to set an upper limit on the mass of d203-506’s central star M∗ < 0:3 M⊙ (35). Taking Tgas ~ 1250 K asqdetermined above, the speed of ffiffiffiffiffiffiffiffiffiffiffiffiffiffi B Tgas soundcS ≡ 7=5k ¼ 3:3 km s1, where kB is the mmH Boltzmann constant, mH is the mass of the hydrogen atom, and m is the ratio of total mass to hydrogen mass of the gas, which we assume equals the interstellar value [m = 1.4 (39)]. This value of cS exceeds the escape velocity at distances from the central star above a critical value, defined as the gravitational radius ∗ rg ≡ GM cS 2 (40), where G is Newton’s gravitational constant. For M∗ < 0:3 M⊙ and Tgas ~ 1250 K, we found rg < 26 au. This is much smaller than the observed radial extent of the H2 emission rH2 ¼ 132T13 au [and its height hH2 ¼ 56T13 au (35)]. Therefore, the gas in this layer is not gravitationally bound and flows outward from the disk, at roughly the speed of sound. The associated mass flux through the PDR is j = mmHnHcS, and the total mass loss rate is M = j × S, where S is the surface area of the H2emitting layer (35). Including the uncertainties on rH2 , hH2 , nH, and Tgas (table S1), we calculated M = 1.4 × 10−7 to 4.6 × 10−6 M⊙ year−1. We also investigated an alternative method of determining the mass-loss rate, using 1D dynamical models, and found a consistent value of M (35). All the physical quantities that we derived are listed in table S1. Implications for planet formation 1 March 2024  3 of 5 , Berné et al., Science 383, 988–992 (2024)  y Fig. 4. JWST NIRSpec spectrum of d203-506. Colored tick marks indicate detected species, as labeled. The broad emission bands at 3.3 and 3.4 mm are C-H vibrational emission from PAH molecules. Other unlabeled lines are mostly atomic (e.g., [O I] or [Fe II]). There are no data at wavelengths 2.40 to 2.50 mm and 4.05 to 4.18 mm owing to gaps in the NIRSpec detectors. Gas in protoplanetary disks is the raw material from which giant planets form, so mass loss due to photoevaporation can limit the formation of such planets. The effects of FUV radiation depend on the stellar mass, which sets the strength of the gravitational field that acts to retain the gas. Theoretical models of planet growth under the influence of external FUV photoevaporation have predicted that FUV radiation fields with intensityG0 ≳ 500 [where G0 is the ratio of the ultraviolet radiation field to the average value in the interstellar medium (41)] suppress giant planet formation around stars with masses≲ 0:5 M⊙ (22). Our results for d203506 are consistent with this prediction: We found that M∗ < 0:3 M⊙ and the radiation field is G0 ≲ 105 (35), whereas the mass-loss rate M = 1.4 × 10−7 to 4.6 × 10−6 M⊙ year−1 implies a disk depletion timescale t ≡ Md/M < 0.13 million years, where Md is the disk mass
RES EARCH | R E S E A R C H A R T I C L E Best model (small grains) Best model (large grains) Observed intensities p 38. F. Le Petit, C. Nehme, J. Le Bourlot, E. Roueff, Astrophys. J. Suppl. Ser. 164, 506–529 (2006). 39. B. T. Draine, Physics of the Interstellar and Intergalactic Medium (Princeton Univ. Press, 2011). 40. D. Hollenbach, D. Johnstone, S. Lizano, F. Shu, Astrophys. J. 428, 654 (1994). 41. H. J. Habing, Bull. Astron. Inst. Neth. 19, 421 (1968). 42. A. Stolte et al., Astron. Astrophys. 578, A4 (2015). 43. P. D. Sheehan, J. A. Eisner, Astrophys. J. 857, 18 (2018). 44. J. A. Johnson, K. M. Aller, A. W. Howard, J. R. Crepp, Publ. Astron. Soc. Pac. 122, 905–915 (2010). 45. S. Reffert, C. Bergmann, A. Quirrenbach, T. Trifonov, A. Künstler, Astron. Astrophys. 574, A116 (2015). 46. E. A. Bergin, C. Alexander, M. Drozdovskaya, M. Gounelle, S. Pfalzner, arXiv:2301.05212 [astro-ph.EP] (2023). 47. NASA Hubblesite, Star Factory at the Center of the Orion Nebula, Space Telescope Science Institute (2005); https://hubblesite.org/contents/media/images/2005/12/ 1674-Image.html. 48. J. Champion, ALMA cubes and integrated maps of the d203-506 protoplanetary disk. Zenodo (2023); https://doi.org/ 10.5281/zenodo.8196030. 49. I. Schroetter, JWST NIRSpec spectrum of the d203-506 protoplanetary disk. Zenodo (2023); https://doi.org/10.5281/ zenodo.10260214. 50. The Meudon PDR Team, Meudon PDR Code, version used for Berné et al. Science 2024. Zenodo (2023); https://doi.org/ 10.5281/zenodo.10488834. AC KNOWLED GME NTS 1 March 2024 4 of 5 , Berné et al., Science 383, 988–992 (2024) y 1. J. P. Williams, L. A. Cieza, Annu. Rev. Astron. Astrophys. 49, 67–117 (2011). 2. K. E. Haisch Jr., E. A. Lada, C. J. Lada, Astrophys. J. 553, L153–L156 (2001). 3. S. M. Andrews, Annu. Rev. Astron. Astrophys. 58, 483–528 (2020). 4. M. Keppler et al., Astron. Astrophys. 617, A44 (2018). 5. U. Gorti, R. Liseau, Z. Sándor, C. Clarke, Space Sci. Rev. 205, 125–152 (2016). 6. U. Gorti, D. Hollenbach, Astrophys. J. 690, 1539–1552 (2008). 7. F. C. Adams, D. Hollenbach, G. Laughlin, U. Gorti, Astrophys. J. 611, 360–379 (2004). 8. C. J. Lada, E. A. Lada, Annu. Rev. Astron. Astrophys. 41, 57–115 (2003). 9. M. Fatuzzo, F. C. Adams, Astrophys. J. 675, 1361–1374 (2008). 10. A. J. Winter, J. D. Kruijssen, M. Chevance, B. W. Keller, S. N. Longmore, Mon. Not. R. Astron. Soc. 491, 903–922 (2020). 11. A. J. Winter, T. J. Haworth, Eur. Phys. J. Plus 137, 1132 (2022). y g RE FE RENCES AND N OT ES 12. H. Störzer, D. Hollenbach, Astrophys. J. 515, 669–684 (1999). 13. A. Scally, C. Clarke, Mon. Not. R. Astron. Soc. 325, 449–456 (2001). 14. C. J. Clarke, Mon. Not. R. Astron. Soc. 376, 1350–1356 (2007). 15. F. Concha-Ramírez, M. J. C. Wilhelm, S. Portegies Zwart, T. J. Haworth, Mon. Not. R. Astron. Soc. 490, 5678–5690 (2019). 16. A. J. Winter et al., Mon. Not. R. Astron. Soc. 478, 2700–2722 (2018). 17. R. B. Nicholson et al., Mon. Not. R. Astron. Soc. 485, 4893–4905 (2019). 18. G. A. L. Coleman, T. J. Haworth, Mon. Not. R. Astron. Soc. 514, 2315–2332 (2022). 19. C. Walsh, T. J. Millar, H. Nomura, Astrophys. J. Lett. 766, L23 (2013). 20. T. J. Haworth, Mon. Not. R. Astron. Soc. 503, 4172–4182 (2021). 21. R. D. Boyden, J. A. Eisner, Astrophys. J. 947, 7 (2023). 22. A. J. Winter, T. J. Haworth, G. A. Coleman, S. Nayakshin, Mon. Not. R. Astron. Soc. 515, 4287–4301 (2022). 23. C. R. O’Dell, Z. Wen, Astrophys. J. 436, 194 (1994). 24. C. R. O’Dell, Astron. J. 115, 263–273 (1998). 25. D. Johnstone, D. Hollenbach, J. Bally, Astrophys. J. 499, 758–776 (1998). 26. W. Henney, S. Arthur, Astron. J. 116, 322–335 (1998). 27. W. J. Henney, C. R. O’Dell, Astron. J. 118, 2350–2368 (1999). 28. A. Tielens, D. Hollenbach, Astrophys. J. 291, 722 (1985). 29. H. Chen et al., Astrophys. J. 492, L173–L176 (1998). 30. J. Champion et al., Astron. Astrophys. 604, A69 (2017). 31. J. R. Goicoechea et al., Nature 537, 207–209 (2016). 32. J. Bally, C. R. O’Dell, M. J. McCaughrean, Astron. J. 119, 2919–2959 (2000). 33. O. Berné et al., Nature 621, 56–59 (2023). 34. E. Habart et al., Astron. Astrophys. 673, A149 (2023). 35. Materials and methods are available as supplementary materials. 36. E. Peeters et al., Astron. Astrophys. 390, 1089–1113 (2002). 37. S. Vicente et al., Astrophys. J. Lett. 765, L38 (2013). y (35). This is faster than even very early planet formation (42, 43). A positive correlation has been observed between stellar mass and the frequency of Jupiter-mass exoplanets orbiting those stars (44, 45), which we suggest could be due to FUV radiation in stellar clusters during the planet formation process. Dynamical and compositional studies of the Solar System indicate that it formed in a stellar cluster that contained one or more massive stars (46), and so it might have been affected by FUV radiation. g Fig. 5. Observed and modeled H2. Line intensities for d203-506. Blue squares show the observed line intensities (table S2), with error bars enclosing 50% uncertainty, estimated from the c2 (35). The instrumental uncertainties are smaller than the symbols. Colored lines are the best-fitting models (35) using small dust grains (orange) or large dust grains (green); circles show the model intensities of each line. H2 line identifications are abbreviated; the full quantum levels corresponding to this notation are listed in table S2. We thank the anonymous referees for helpful feedback and comments and C. O’Dell for providing comments. The JWST helpdesk provided support with data reduction. Part of this work used the DiRAC Data Intensive service at Leicester, operated by the University of Leicester IT Services, which forms part of the STFC DiRAC HPC Facility. Funding: A.F. thanks the Spanish MICIN for funding support from grant PID2019-106235GB-I00. O.B., I.S., and A.C. are funded by the Centre National d’Etudes Spatiales (CNES) through the APR program. J.R.G. and S.C. thank the Spanish MCINN for funding support under grant PID2019106110GB-I00. P. Guillard thanks the University Pierre and Marie Curie, the Institut Universitaire de France, the CNES, the Programme National de Cosmologie and Galaxies (PNCG), and the Physique Chimie du Milieu Interstellaire (PCMI) programs of Centre National de la Recherche Scientifique/INSU for financial support. E.P. and J.C. acknowledge support from the Institute for Earth and Space Exploration, the Canadian Space Agency, and the Natural Sciences and Engineering Research Council of Canada. C.B. acknowledges funding from the San José State University Research Foundation (grant 80NSSC22M0107) and the Internal Scientist Funding Model (ISFM) Laboratory Astrophysics Directed Work Package at NASA Ames. T.O. is supported by JSPS Bilateral Program grant 120219939. T.J.H. is funded by a Royal Society Dorothy Hodgkin Fellowship. A.F. was supported by the Spanish program Unidad de Excelencia María de Maeztu CEX2020-001058M, financed by grant MCIN/AEI/10.13039/501100011033. NN is funded through UAEU Program for Advanced Research (UPAR) grant G00003479. Y. Zhang is funded by the National Science Foundation of China (NSFC) grant 11973099 and the China Manned Space Project grants CMS-CSST-2021-A09 and -A10. M. Rö and Y.O. are supported by the Collaborative Research Centre 956, sub-project C1, funded by the Deutsche Forschungsgemeinschaft (DFG) project ID 184018867. P. Merino acknowledges grants EUR2021-122006, TED2021-129416A-I00 and PID2021-125309OA-I00 funded by MCIN/AEI/10.13039/501100011033 and European Union NextGenerationEU/PRTR. A. Pathak acknowledges financial support from the Department of Science and Technology Core Research Grant (DST-CRG) SERB-CRG/2021/000907, and the Institutes of Eminence (IoE) grant BHU incentive/2021-22/32439. M. Buragohain acknowledges a DST INSPIRE Faculty fellowship. J. He is sponsored by the Chinese Academy of Sciences (CAS), through a grant to the CAS South America Center for Astronomy (CASSACA) in Santiago, Chile. H. Zettergren acknowledges support from the Swedish Research Council contract 2020-03437. Author contributions: O.B., E.H., and E.P. led the JWST observing program. O.B. led the study and drafted the manuscript and produced Figs. 1, 3, and 4 and figs. S1, S3, and S4. E. B. and F.L.P. produced the PDR models and Fig. 5 and figs. S4 to S6. T.J.H. produced the 1D dynamical models and fig. S7. F.A. produced the disk 3D radiative transfer models and fig. S2. A. Canin produced Fig. 2. J. Champion was principal investigator of the ALMA observing program. J. Champion and E. Chapillon performed the ALMA data reduction. P.K. analyzed the ALMA data. I.S., A.S., R.C., D.V.D.P., and F.A. reduced the NIRSpec data. A.C. and B.Tr. reduced the
RES EARCH | R E S E A R C H A R T I C L E NIRCam data. I.S. extracted the NIRSpec spectrum. I.S. and M.Z. measured the line intensities. M.Z. produced the LTE radiative transfer models of CH+ and OH. J.C. provided the radiative transfer models for CO. All other authors contributed to the research presented in this paper or provided detailed feedback on the manuscript. All authors meet the journal’s authorship requirements. Competing interests: The authors declare no competing interests. Data and material availability: The JWST and HST data are available on the MAST portal http://mast. stsci.edu under the proposal IDs 1288 and 6603, respectively. The ALMA raw data are available on the ALMA archive at https:// almascience.eso.org/aq under project code 2017.1.01478.S. Our reduced ALMA data cubes and maps are archived at Zenodo (48), as is our reduced NIRSPec spectrum of d203-506 (49). The modified Meudon PDR code used in this paper is available at Zenodo (50). License information: Copyright © 2024 the authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original US government works. https://www.science.org/about/sciencelicenses-journal-article-reuse SUPPLEMENTARY MATERIALS science.org/doi/10.1126/science.adh2861 PDRs4All Team Authors and Affiliations Materials and Methods Figs. S1 to S7 Tables S1 and S2 References (51–78) Submitted 24 February 2023; accepted 12 January 2024 10.1126/science.adh2861 p g y y g y , Berné et al., Science 383, 988–992 (2024) 1 March 2024 5 of 5
RES EARCH NEUROSCIENCE Touch sensation requires the mechanically gated ion channel ELKIN1 Sampurna Chakrabarti1, Jasmin D. Klich1, Mohammed A. Khallaf1,2, Amy J. Hulme3, Oscar Sánchez-Carranza1, Zuzanna M. Baran1,4, Alice Rossi1, Angela Tzu-Lun Huang1, Tobias Pohl4, Raluca Fleischer1, Carina Fürst1,5, Annette Hammes5, Valérie Bégay1, Hanna Hörnberg4,6, Rocio K. Finol-Urdaneta3, Kate Poole7, Mirella Dottori3, Gary R. Lewin1,8,9* Touch perception is enabled by mechanically activated ion channels, the opening of which excites cutaneous sensory endings to initiate sensation. In this study, we identify ELKIN1 as an ion channel likely gated by mechanical force, necessary for normal touch sensitivity in mice. Touch insensitivity in Elkin1−/− mice was caused by a loss of mechanically activated currents (MA currents) in around half of all sensory neurons activated by light touch (low-threshold mechanoreceptors). Reintroduction of Elkin1 into sensory neurons from Elkin1−/− mice restored MA currents. Additionally, small interfering RNA–mediated knockdown of ELKIN1 from induced human sensory neurons substantially reduced indentation-induced MA currents, supporting a conserved role for ELKIN1 in human touch. Our data identify ELKIN1 as a core component of touch transduction in mice and potentially in humans. The absence of ELKIN1 did not alter the neurochemical makeup of the sensory ganglia 1 of 7 , 1 March 2024 Sensory deficits in Elkin1−/− mice y Chakrabarti et al., Science 383, 992–998 (2024) We hypothesized that ELKIN1 could also be involved in mammalian touch sensation. We generated a CRISPR-Cas9–mediated genomic deletion of the mouse Tmem87a/Elkin1 gene locus spanning sequences coding for transmembrane domains 2 to 6, which includes the proposed ion-conduction pathway (fig. S3A) (11). Mice homozygous for the genomic deletion (Elkin1−/− mice) were viable and born at the expected Mendelian ratios [wild type (WT), 25.7%; Elkin1+/−, 46.2%; Elkin1−/−, 28%; n = 132] (table S2). Single-molecule fluorescent in situ hybridization (smFISH) and immunohistochemistry with an antibody against ELKIN1 showed that Elkin1−/− mice were complete null mutants (Fig. 2A). Our validated ELKIN1 antibody revealed that ELKIN1 protein levels appeared to be especially high in sensory neurons of the DRGs. ELKIN1 protein was robustly detected in all subsets of DRG neurons, which is consistent with single-cell expression data from mice, macaques, and humans (17–21); around 60% of neurons showed high ELKIN1 expression (fig. S3, B and C). Sensory neurons expressing high amounts of ELKIN1 made up 34% of neurofilament heavy chain positive (NF200+) large neurons with myelinated axons. High ELKIN1 expression was also found in 75% of isolectin-B4 positive (IB4+) nonpeptidergic small neurons (22) and 45% of small neurons positive for the capsaicin-gated transient receptor potential channel, TRPV1 (fig. S3, B and C). Both of these two neurochemically distinct nociceptor types are reported to be responsive to mechanical force (23). y g *Corresponding author. Email: glewin@mdc-berlin.de Mouse sensory neurons express ELKIN1 y Molecular Physiology of Somatic Sensation Laboratory, Max Delbrück Center for Molecular Medicine in the Helmholtz Association (MDC), 13125 Berlin-Buch, Germany. 2 Department of Zoology and Entomology, Faculty of Science, Assiut University, Assiut 71516, Egypt. 3School of Medical, Indigenous and Health Sciences, Molecular Horizons, University of Wollongong, Wollongong, NSW 2522, Australia. 4 Molecular and Cellular Basis of Behavior, Max Delbrück Center for Molecular Medicine in the Helmholtz Association (MDC), 13125 Berlin-Buch, Germany. 5Molecular Pathways in Cortical Development, Max Delbrück Center for Molecular Medicine in the Helmholtz Association (MDC), 13125 Berlin-Buch, Germany. 6NeuroCure Cluster of Excellence, Humboldt-Universität zu Berlin, 10117 Berlin, Germany. 7 School of Biomedical Sciences, Faculty of Medicine & Health, University of New South Wales, Sydney, NSW 2052, Australia. 8Charité-Universitätsmedizin Berlin, 10117 Berlin, Germany. 9German Center for Mental Health (DZPG), partner site Berlin, 10117 Berlin, Germany. We previously identified ELKIN1 (TMEM87A) as a protein that is both necessary and sufficient to confer mechanosensitivity to highly metastatic human melanoma cells (9). Cryo– electron microscopy (cryo-EM) structures of human ELKIN1 recently revealed a monomeric seven-transmembrane protein with an N-terminal extracellular Golgi-dynamics domain fold (GOLD domain) (10). A second, higher-resolution structure recently identified a cation-conduction pathway through the protein (11). We overexpressed Elkin1 in human embryonic kidney (HEK) 293T cells lacking PIEZO1 channels (HEK293TPiezo1−/− cells) (12) and found large indentation-induced mechanically activated currents (MA currents) in a majority of transfected cells (Fig. 1, A and B). Cells were plated on laminin 511 and poly-L-lysine (PLL), a substrate that supports increased mechanosensitivity (13); untransfected cells showed no indentation-induced currents. ELKIN1-dependent currents were rapidly-adapting (RA) with fast inactivation time constants (<10 ms), similar to those of PIEZO2 ion channels (5, 14) (Fig. 1, A to C). Using substrate deflection by means of pillar arrays (9, 14), we also found robust, mechanically activated currents in all HEK293TPiezo1−/− cells transfected with Elkin1-expression constructs, but also in cells transfected with Elkin1 lacking the N-terminal GOLD-domain (Elk1D170) (Fig. 1, C and D, and fig. S1A) (9). Most of the pillar-evoked currents were RA (inactivation <10 ms) or intermediately adapting [(IA), inactivation between 10 and 50 ms]. Measurements of pillar-gated currents at different holding potentials revealed a linear current-voltage relationship with a reversal potential of 0 mV for both Elkin1- and Elk1D170-transfected cells (Fig. 1E). Therefore, our results suggest that the GOLD domain is not necessary for me- g 1 ELKIN1 can detect mechanical force p T ouch sensation is fundamental to our sense of self, our social interactions, and our exploration of the tactile world (1, 2). Sensation is initiated at specialized end organs in the skin, innervated by lowthreshold mechanoreceptors (LTMRs) with their cell bodies in the dorsal root ganglia (DRGs). The peripheral endings of LTMRs are equipped with mechanically gated ion channels that can be opened by very small forces to initiate and enable touch perception (3, 4). The mechanically gated ion channel PIEZO2 is expressed by most sensory neurons in the DRGs (5), and in the absence of PIEZO2, around half of LTMRs no longer respond to mechanical stimuli (6–8). The DRGs also contain so-called nociceptors, sensory neurons specialized to detect potentially damaging and painful stimuli, including intense mechanical force (3). Many nociceptors express PIEZO2 channels but remain mechanosensitive in its absence. The preservation of mechanosensitivity in many LTMRs in the absence of PIEZO2 channels (6–8) led us to search for other mechanically gated ion channels that could account for PIEZO2-independent sensory mechanotransduction. chanical activation of ELKIN1. ELKIN1 currents showed a distinctive pharmacological profile, being sensitive to the nonspecific pore blocker Gd3+(30 mM) but barely affected by ruthenium red (30 mM), a compound that completely blocks other mechanosensitive channels, such as PIEZO1 and PIEZO2 (5, 15) (Fig. 1F and fig. S1B). Additionally, in agreement with recent reports (11, 15), we found that cells expressing mouse Elkin1 display prominent leak currents at very positive (>+60 mV) and very negative potentials (<−100 mV) (Fig. 1G and fig. S1C). ELKIN1 reconstituted into proteoliposomes reportedly show single-channel activity at very positive potentials (16). We also found that Elkin1-transfected HEK293TPiezo1−/− cells showed currents, which were substantially potentiated by application of mild positive-pressure pulses (20 mm of Hg) applied via the cell-attached pipette (fig. S2, A to C). Therefore, we provide multiple lines of evidence that ELKIN1 is likely an ion channel that can detect mechanical force.
RES EARCH | R E S E A R C H A R T I C L E B C D 800 Elkin1 500 12 12 7 50 -400 El 1 kin l3 R dC +R µM +G µM 30 30 0 8 -200 100 -100 100 Voltage (mV) -100 -50 -100 -150 -200 n1 ki El , 2 of 7 y Large sensory neurons of the DRGs are predominantly mechanoreceptors required for touch (4, 24). We therefore recorded MA currents from isolated sensory neurons evoked by mechanical indentation and substrate deflection (Fig. 3, A and D) (24, 25). Normally, almost all large neurons exhibit robust, predominantly RA MA currents to both cell indentation and substrate deflection (14, 25), which we confirmed in WT animals (Fig. 3, A to F). However, only half of the large neurons (diameter >30 mm, fig. S4A) from Elkin1−/− mice displayed any MA current (Fig. 3, B and E). The insensitivity to mechanical stimuli was therefore concomitant to a loss of RA MA currents in Elkin1−/− mice (Fig. 3, C and F). The current amplitude of MA currents in the remaining mechanosensitive neurons was sim- y g Sensory neuron mechanically activated currents are lost in Elkin1−/− mice ilar in WT and Elkin1−/− mice; however, there was a small but significant (P = 0.01, unpaired Student’s t test) increase in the deflection threshold in neurons from Elkin1−/− mice as assessed through the pillar assay (fig. S4, B and C). Large sensory neurons recorded from Elkin1−/− mice also showed a slightly depolarized resting membrane potential (P = 0.001, unpaired Student’s t test), which is consistent with the idea that this channel may contribute to membrane leak (fig. S4D). A significant loss of MA currents was even detectable after loss of just one Elkin1 allele (P = 0.005, unpaired Student’s t test) (fig. S4E). To show that the loss of MA currents was not due to indirect effects of Elkin1 gene inactivation, we conducted an acute rescue experiment. Using an adeno-associated virus neurotropic for sensory neurons (AAV-PHP.S-hSyn-dtommElkin1), we reintroduced Elkin1 back into acutely isolated sensory neurons from Elkin1−/− mice. ELKIN1 protein was detected in infected sensory neurons from Elkin1−/− mice, and there was a significant (P = 0.01, c2 test) rescue of MA currents: Only 40% of neurons had MA y cells. (F) Quantification of pillar-deflection threshold and properties of ELKIN1dependent currents in the presence of pore blockers ruthenium red (RR) and GdCl3. Each dot represents a cell, and numbers in bars are number of MA-pillar stimuli. (G) Current-voltage relationship of Elkin1-transfected cells (each dot is a mean of n = 14 mock and n = 15 Elkin1 cells) as assessed through a series of voltage steps from −150 to 90 mV. Three group comparisons were made with one-way ANOVA followed by multiple comparison test, and two group comparisons were made with Student’s t test. Proportions were compared using c2 test. *P < 0.05, **P < 0.01. Error bars indicate SEM. as heat withdrawal thresholds, were unaltered in Elkin1−/− mice (fig. S3D). Elkin1−/− mice also showed no deficits in open-field locomotion (fig. S3E). 1 March 2024 200 g Chakrabarti et al., Science 383, 992–998 (2024) 17 1 Cl 3 kin +RR µM +Gd M µ El 30 30 I A RA SA Fig. 1. ELKIN1 forms a mechanically gated channel. (A) Pie charts show total number of mechanically responsive transfected cells. Shown in (A) (top) and (B) are indentation-induced currents in HEK293TPiezo1−/− cells upon transfection with mouse Elkin1 cDNA. Dots represent individual cells. (C) Representative MA currents evoked by pillar deflection at −60 mV along with (D) quantification of MA-current amplitude and properties at 100- to 250-nm force bin (each dot represents a cell, and numbers in bars are number of MA-pillar stimuli). (E) Currentvoltage relationship of MA currents evoked in cells transfected with Elkin1 or Elk1D170. Dots are mean of n = 10 in Elkin1 and n = 15 in Elk1D170-transfected because the percentage of DRG neurons positive for markers such as NF200, IB4, TRPV1, and tyrosine hydroxylase (TH) was unchanged in the Elkin1−/− mice as compared with WT (Fig. 2B). Ultrastructural analysis of the saphenous nerve revealed no pathology or loss of myelinated or unmyelinated axons in Elkin1−/− mice (Fig. 2C and table S1). However, behavioral indicators of touch sensitivity, such as percentage of responses to a cotton swab, were profoundly reduced in Elkin1−/− mice as compared with WT animals (WT, 90% paw withdrawal versus Elkin1−/−, 47.5% paw withdrawal; P < 0.0001, unpaired Student’s t test) (Fig. 2D). Paw-withdrawal thresholds to von Frey filaments were also significantly elevated [P < 0.0001, two-way analysis of variance (ANOVA) with Sidak post hoc test], with substantial deficits observed across a range of von Frey force filaments in Elkin1−/− mice (Fig. 2E). However, responses to brush stimuli in Elkin1−/− were similar to those for WT mice (fig. S3E). These results confirm reduced sensitivity to mechanical forces in Elkin1−/− mice. However, nonmechanosensory modalities, such 14 6 29 0 Current (pA/pF) 1000 Elkin1 k -200 50 Voltage (mV) 300 0 m -50 mock 8 % MA current 200 1500 Threshold (nm) 400 * 100 Elkin1 Elk1 Δ170 1 kin El 37 Elkin1 Elk1Δ170 IA RA SA p MA current (pA) 600 G ** * 22 0 m F E 19 14 50 oc Elk1 Δ170 1 0 Elkin1 35 nm % of MA currents 2 300 250 200 150 100 50 0 Current (pA/pF) @ -150 mV 0 10 ms 70 200 3 Δ1 400 Elkin1 50 pA 600 El k1 Elkin1 Untransfected Mechanically responsive 11 11 7 oc k 8/15 100 * 600 40 nm Inactivation Tau (ms) 0/12 2s MA current (pA) 200 pA Untransfected Elkin1 ** -60 mV 5 μm 4 μm MA current (pA) A
RES EARCH | R E S E A R C H A R T I C L E p g y Fig. 2. Elkin1−/− mice are touch insensitive. (A) Representative images of ELKIN1 expression pattern, obtained using a smFISH probe against Elkin1 (top panel; scale bar, 20 mm) and antibody staining against ELKIN1 (bottom panel; scale bar, 50 mm) from WT and Elkin1−/− DRGs. (B) (Top panels) Representative images of NF200 (red), IB4 (blue), TRPV1 (magenta), and TH (yellow) staining in WT and Elkin1−/− DRGs and (bottom) quantification of percent of positive neurons in each group from three male mice. More than 500 neurons were counted in each category. (C) Ultrastructural analysis of saphenous nerve. Scale bar, 1 mm. (D) Percent response of WT and Elkin1−/− mice (n = 16) to brushing of a cotton swab. (E) Paw withdrawal threshold (left, n = 16) and ascending-dose response (right, n = 10) of WT and Elkin1−/− mice to von Frey filaments. Two group comparisons were made with Student’s t test and two-way ANOVA with Sidak post hoc test (for von Frey ascending-dose response). **P < 0.01, ***P < 0.001. Error bars indicate SEM. Data from both male and female mice. y g currents in mock transfected cells as compared with 75% of cells 48 hours after infection with AAV-PHP.S-hSyn-dtom-mElkin1 (Fig. 3, G and H, and fig. S5A). Chakrabarti et al., Science 383, 992–998 (2024) ELKIN1 and PIEZO2 share roles in sensory mechanotransduction The phenotype that we observed in Elkin1−/− sensory neurons was similar to the knockdown or genetic ablation of the PIEZO2 mechanosensitive ion channel (5–7). Using smFISH, we detected colocalization of Elkin1 and Piezo2 mRNA in WT DRG neurons, but no change in Piezo2 mRNA expression was observed 1 March 2024 3 of 7 , Human stem cells can be differentiated into sensory neuron–like cells that have characteristic electrophysiological properties of DRG neurons, including MA currents (26, 27). We could detect ELKIN1 protein in NEUROGENIN2induced human sensory neurons (26), the staining for which was abolished by small interfering RNA (siRNA)–mediated mediated knockdown of ELKIN1 (Fig. 3I and fig. S6A). Our induced human sensory neurons also had robust MA currents, which increased in size with increasing indentation amplitudes. MA currents required higher indentation amplitudes and attained much smaller peak amplitudes in induced sensory neurons transfected with in Elkin1−/− sensory neurons (fig. S5B). Thus, Elkin1 ablation does not affect Piezo2 expression. As shown previously (5), we found that in WT DRG neurons, siRNA-mediated knockdown of Piezo2 approximately halved the number of neurons with MA currents (fig. S5C). If Elkin1 exerts its function through Piezo2, knockdown of Piezo2 in Elkin1−/− neurons should not cause a further decrease in MA currents. By contrast, our results show that MA currents in Elkin1−/− neurons could be reduced further after Piezo2 knockdown (fig. S5C). Thus, neurons retaining MA currents in Elkin1−/− mice appear to have predominantly PIEZO2-dependent MA currents. We next asked whether there is a functional interaction between these two proteins by expressing Piezo2 or Piezo2 and Elkin1 in N2aPiezo1−/− cells. We found no differences in the amplitude or kinetics of MA currents found in single- and double-transfected cells, indicating no substantial functional interaction y Mechanically activated currents in human sensory neurons depend on ELKIN1 ELKIN1 siRNA, as compared with control scrambled siRNA (Fig. 3I and fig. S6, B and C). Thus, ELKIN1 is required for normal MAcurrent expression in both mouse and human sensory neurons. Additionally, in these induced human sensory neurons, knockdown of PIEZO2 with siRNA also decreased MA currents, and very few MA currents remained after the knockdown of both ELKIN1 and PIEZO2 (fig. S6C). We therefore postulated that there may be some functional interaction between PIEZO2 and ELKIN1.
RES EARCH | R E S E A R C H A R T I C L E SA 4 80 60 12 40 20 19 20 pA 3 80 * RA 60 5 40 4 WT SA RA H IA 20 0 WT Elkin1-/Non-responders Responders 200 ms 1 15 10 E Elkin1-/IA SA 1 80 4 9 60 40 20 17 0 100 80 60 32 0 6 14 +mock +AAV-Elkin1 Non-responders Responders siCTRL 4 2 0 +mock +AAV-Elkin1 *** 80 MA current (pA/pF) 20 Inactivation Tau (ms) % responsive large neurons 10 siELKIN1 2s 9 μm 40 90 siCTRL siELKIN1 70 60 50 40 30 20 g 50 pA 8 μm 60 DAPI ELKIN1 6 Elkin1-/IA p 7 μm 4 10 WT SA RA Induced human sensory neurons 8 80 6 0 * 100 13 16 20 11 WT Non-responders Responders 2s 15 40 Elkin1-/- I Elkin1-/- F ** 100 % MA large neurons 2 0 G 1 % responsive large neurons IA D 100 % MA large neurons RA C ** 100 200 pA B % responsive large neurons A 10 0 0 1 2 3 4 Indentation (µm) 5 y Severe mechanoreceptor deficits in Elkin1−/− mice We next investigated whether ELKIN1 is required for the mechanosensory function of identified mouse mechanoreceptors. First, we used an ex vivo saphenous skin-nerve preparation to trace the trajectory of single units by means of an electrical stimulus until the point of exit from the nerve branch. Using a mechanical stimulus, we then searched for the mechanosensitive receptive field of the same unit, which was usually located close to the exit point from the nerve branch (6, 7, 24, 31). Single identified Ab fibers with the fastest conduction velocities (>10 m/s) usually al- 1 March 2024 ways have a mechanosensitive receptive field, as confirmed for WT mice (Fig. 4A). However, blinded recordings made from Elkin1−/− mice revealed that 40% of the Ab fibers had no detectable mechanosensitive receptive field (9/26 Ab fibers) (Fig. 4A). Next, we examined the stimulus-response properties of the remaining identified mechanoreceptors in the hairy skin. Ab-fiber LTMRs innervating Merkel cells are classified as slowly adapting mechanoreceptors (SAMs) with a dynamic and static response to ramp-and-hold force stimuli (Fig. 4B). Around 50% of Ab fibers are typically classified as SAMs in the hairy skin (24, 32), and this was the case in both WT and Elkin1−/− mice (fig. S8A). However, the firing rates of SAMs to the static constant force phase of the stimulus were strongly reduced at all stimulus strengths in Elkin1−/− mice as compared 4 of 7 , Chakrabarti et al., Science 383, 992–998 (2024) creased mechanical thresholds and increased current amplitude in the presence of STOML3 (fig. S7B). y between these proteins in a heterologous expression system (fig. S5D). A known PIEZO2 modulator is the MEC-2– related mechanotransduction protein STOML3, which was shown to sensitize PIEZO2 channels to substrate deflection (14, 24, 28–30). We next asked whether there is also a molecular interaction between STOML3 and ELKIN1. Using a tripartite green fluorescent protein (GFP)–based protein complementation assay, we observed a robust green fluorescent signal, indicating close association between STOML3 and ELKIN1 (fig. S7A). The protein complementation signal for a STOML3/ELKIN1 interaction was also blocked in the presence of the STOML3 oligomerization blocker OB1 (fig. S7A) (30). Coexpression of Stoml3 with Elkin1 in HEK293TPiezo1−/− cells revealed that ELKIN1-dependent MA currents displayed de- of Elkin1−/− DRG neurons stained by anti-RFP after being transduced by AAV-PHP.S-hSyn-dtom-mElkin1. Scale bar, 20 mm. (Bottom) Representative traces of indentation-induced currents from a transduced neuron. (H) (Left) Percent of mechanically active large-diameter neurons upon transduction with AAV-PHP.S-hSyn-eGFP (mock) or AAV-PHP.S-hSyn-dtom-mElkin1. (Right) Quantification of inactivation time constants of the measured currents. Each data point represents a single cell measured. (I) Representative images of NEUROGENIN2induced human sensory neurons before (top) and after (bottom) transfection with ELKIN1 siRNA (left, scale bars, 50 mm; right, two-way ANOVA). Proportions were compared using c2 test; four group comparisons were made using ANOVA followed by multiple comparison test. *P < 0.05, ** P < 0.01, ***P < 0.001. Error bars indicate SEM. Data from both male and female mice. DAPI, 4′,6-diamidino-2-phenylindole. y g Fig. 3. ELKIN1 is necessary and sufficient for mechanically gated currents in mouse and human sensory neurons. (A) Representative traces of currents generated by large-diameter neurons from Elkin1−/− mice. Scale bar, 20 mm. (B) Percent of large-diameter neurons with an MA current in WT and Elkin1−/− mice. (C) Percent of rapidly adapting (RA), intermediately adapting (IA), and slowly adapting (SA) MA currents in large-diameter neurons. Number of cells is denoted in the bars. (D) Representative traces of currents generated by pillar deflection of a large-diameter neuron from an Elkin1−/− mouse. Scale bar, 20 mm. (E) Percent of mechanically sensitive large-diameter neurons in WT and Elkin1−/− mice in pillar assay. Number of cells is denoted in the bars. (F) Percent of RA, IA, and SA MA currents in large-diameter neurons. Number of MA-pillar stimulations is denoted in the bars. (G) (Top) Representative image
RES EARCH | R E S E A R C H A R T I C L E Discussion , 5 of 7 y Here we show that ELKIN1 is necessary for the mechanosensory function of most LTMRs. Elkin1−/− mice have electrically excitable sensory axons in the skin that were completely unable to respond to mechanical stimuli. The sustained firing of SAMs to constant force partly depends on PIEZO2 expressed in mechanosensory Merkel cells (39). Our data suggest that ELKIN1 is required for the PIEZO2 independent transduction in SAMs because sustained responses were severely reduced in Elkin1−/− mice. The ability of induced human sensory neurons to transduce mechanical forces was severely diminished after knockdown of ELKIN1. Thus, ELKIN1 is an ion channel gated by mechanical force that likely has a conserved role in the transduction of light touch in mice and humans. Consistent with the expression pattern of ELKIN1, maintained firing of C-fiber nociceptors to constant force was also impaired in the absence of the ELKIN1 protein. The loss of mechanically gated currents, impaired touchdriven behavior, and deficits in LTMR function are reminiscent of mice lacking Stoml3 and of conditional Piezo2 mutants (6, 7, 24, 28). Our data support a model in which ELKIN1 and PIEZO2 channels share roles in sensory mechanotransduction in LTMRs and in which both channels can be modulated by STOML3. There is evidence that STOML3 can also modulate MA currents in nociceptors, which is consistent y g 1 March 2024 mice (Fig. 5, F and G, and fig. S10). Reduced firing rates toward the end of the stimulus were observed for all intensities of stimulation (fig. S10). Thus, unlike in mechanoreceptors, ELKIN1 has a limited role in nociceptors but may be necessary for maintaining sensitivity to constant forces in these neurons. y Chakrabarti et al., Science 383, 992–998 (2024) of MA currents in small- and medium-diameter neurons that displayed broad-humped action potentials characteristic of nociceptors (22, 25, 37) (Fig. 5A and fig. S9). Many nociceptors in WT mice lack MA currents to cell indentation (~40%) (23, 25), but this was not different in neurons recorded from Elkin1−/− animals (Fig. 5, A and B). However, when the MA currents were classified as RA (inactivation time <10 ms), IA (inactivation time constant 10 to 50 ms), and SA (slowly adapting, inactivation time constant >50 ms), we identified a significant (P = 0.03, c2 test) reduction in the proportion of RA MA currents in Elkin1−/− mice as compared with those in WT animals (Fig. 5C). In addition, we found a small but significant (P = 0.01, unpaired Student’s t test) elevation in the amplitude of indentation needed to evoke the first MA current in nociceptors from Elkin1−/− mice (Fig. 5D). MA currents evoked through substrate deflection showed no change between WT and Elkin1−/− mice (fig. S9B). We next focused our analysis on nonpolymodal C fibers that respond exclusively to mechanical stimuli and not to thermal stimuli because this population shows robust firing to mechanical force (38). In the ramp-and-hold force protocol, the firing of mechanosensitive C fibers from Elkin1−/− mice was no different from that in WT animals (Fig. 5, E and F). We next analyzed the time course of C-fiber activation during a 10 s–long constant-force stimulus. C fibers generally show a moderate degree of adaptation during constant-force stimuli (7). However, we found that even though initial firing rates were similar between genotypes at a stimulus strength of 100 mN, firing rates dropped significantly more (P = 0.004, twoway ANOVA with multiple comparison test) during the stimulus in C fibers from Elkin1−/− g with those in controls (Fig. 4B). A plot of the peristimulus time histogram for SAMs stimulated with 150 mN of force reveals that firing rates decrease to almost zero just 3 s into a 10-s stimulus (Fig. 4C). However, the same SAMs from WT and Elkin1−/− mice showed similar dynamic phase responses (fig S8C). The remaining Ab mechanoreceptors were classified as rapidly adapting mechanoreceptors (RAMs), which only respond to skin movement and code the velocity of skin movement (3, 4, 33). As a population, RAMs still coded the velocity of ramp stimuli, but the overall firing rates were significantly lower in Elkin1−/− mice as compared with those in controls (P = 0.03, twoway ANOVA with multiple comparison test) (Fig. 4D). These results could easily reflect loss of MA currents in mechanoreceptors but could also be due to morphological disruption of sensory endings. However, an analysis of mechanoreceptor endings in the skin of Elkin1−/− mice did not reveal any obvious deficits (fig. S8C). These results show that around half of the LTMRs are insensitive to mechanical forces in Elkin1−/− mice, but in addition, the remaining LTMRs showed profound functional deficits in their ability to detect mechanical force. We also made recordings from single mechanosensitive nociceptors in the saphenous nerve. Sensory neurons with thinly myelinated Ad axons can be classified as A-fiber mechanonociceptors (AMs), which signal fast pain (34), or as down hair (D-hair) receptors, which are specialized LTMRs with directional sensitivity (35, 36). We found no change in the stimulus properties of D-hair or AM afferents in Elkin1−/− mice as compared with those of controls (fig. S8D). Many DRGs with high amounts of ELKIN1 also appear to be nociceptors, an assertion based on the presence of markers such as IB4 and TRPV1 (22). We thus made a focused analysis fibers). (D) Representative spikes evoked from rapidly adapting mechanoreceptors to a moving ramp stimulus and quantification of the mean firing rates to ramps of increasing speed. Proportions were compared using c2 test with results from (A). All other group comparisons were made using two-way ANOVA followed by multiple comparison test. *P < 0.05, **P < 0.01, ***P < 0.001. Error bars indicate SEM. Data from both male and female mice. p Fig. 4. ELKIN1 is required for LTMR function. (A) Percent of mechanosensitive fast-conducting Ab fibers in the saphenous nerve assessed with an electrical search protocol. (B) (Top) Representative spikes evoked from SA mechanosensitive Ab fibers in WT and Elkin1−/− mice and (bottom) quantification of mean spike rates with increasing force. (C) Absolute number of spikes over a 10-s time period in the 150-mN force bin (each dot represents average response from
RES EARCH | R E S E A R C H A R T I C L E p g y 1. A. R. Sobinov, S. J. Bensmaia, Nat. Rev. Neurosci. 22, 741–757 (2021). 2. M. Mikkelsen, E. L. Wodka, S. H. Mostofsky, N. A. J. Puts, Dev. Cogn. Neurosci. 29, 140–150 (2018). 3. G. R. Lewin, R. Moshourab, J. Neurobiol. 61, 30–44 (2004). 4. S. G. Lechner, G. R. Lewin, Physiology 28, 142–150 (2013). 5. B. Coste et al., Science 330, 55–60 (2010). 6. S. S. Ranade et al., Nature 516, 121–125 (2014). 7. S. E. Murthy et al., Sci. Transl. Med. 10, eaat9897 (2018). 8. B. U. Hoffman et al., Proc. Natl. Acad. Sci. U.S.A. 119, e2115821119 (2022). 9. A. Patkunarajah et al., eLife 9, e53308 (2020). Chakrabarti et al., Science 383, 992–998 (2024) 1 March 2024 25. J. Hu, G. R. Lewin, J. Physiol. 577, 815–828 (2006). 26. A. J. Hulme et al., Front. Cell. Neurosci. 14, 600895 (2020). 27. K. Schrenk-Siemens et al., Nat. Neurosci. 18, 10–16 (2015). 28. M. Huang, G. Gu, E. L. Ferguson, M. Chalfie, Nature 378, 292–295 (1995). 29. R. O’Hagan, M. Chalfie, M. B. Goodman, Nat. Neurosci. 8, 43–50 (2005). 30. C. Wetzel et al., Nat. Neurosci. 20, 209–218 (2017). 31. M. Kress, M. Koltzenburg, P. W. Reeh, H. O. Handwerker, J. Neurophysiol. 68, 581–595 (1992). 32. M. Koltzenburg, C. L. Stucky, G. R. Lewin, J. Neurophysiol. 78, 1841–1850 (1997). 33. F. Schwaller et al., Nat. Neurosci. 24, 74–81 (2021). 34. A. Arcourt et al., Neuron 93, 179–193 (2017). 35. J. Walcher et al., J. Physiol. 596, 4995–5016 (2018). 36. M. Rutlin et al., Cell 159, 1640–1651 (2014). 37. H. R. Koerber, R. E. Druzinsky, L. M. Mendell, J. Neurophysiol. 60, 1584–1596 (1988). 38. N. Milenkovic, C. Wetzel, R. Moshourab, G. R. Lewin, J. Neurophysiol. 100, 2771–2783 (2008). 39. S.-H. Woo et al., Nature 509, 622–626 (2014). 6 of 7 , RE FE RENCES AND N OT ES 10. C. M. Hoel, L. Zhang, S. G. Brohawn, eLife 11, e81704 (2022). 11. A. Han et al., bioRxiv 2023.01.03.522544 [Preprint] (2023). https://doi.org/10.1101/2023.01.03.522544. 12. A. E. Dubin et al., Neuron 94, 266–270.e3 (2017). 13. L.-Y. Chiang et al., Nat. Neurosci. 14, 993–1000 (2011). 14. K. Poole, R. Herget, L. Lapatsina, H.-D. Ngo, G. R. Lewin, Nat. Commun. 5, 3520 (2014). 15. L. Pope, M. Lolicato, D. L. Minor Jr., Cell Chem. Biol. 27, 511–524.e4 (2020). 16. H. Kang et al., bioRxiv 2023.01.03.522543 [Preprint] (2023). https://doi.org/10.1101/2023.01.03.522543. 17. D. Usoskin et al., Nat. Neurosci. 18, 145–153 (2015). 18. N. Sharma et al., Nature 577, 392–398 (2020). 19. J. Kupari et al., Nat. Commun. 12, 1510 (2021). 20. H. Yu et al., bioRxiv 2023.03.17.533207 [Preprint] (2023). https://doi.org/10.1101/2023.03.17.533207. 21. P. Ray et al., Pain 159, 1325–1345 (2018). 22. C. L. Stucky, G. R. Lewin, J. Neurosci. 19, 6497–6505 (1999). 23. L. J. Drew, J. N. Wood, P. Cesare, J. Neurosci. 22, RC228 (2002). 24. C. Wetzel et al., Nature 445, 206–209 (2007). y with a role for ELKIN1 in conferring robustness to the C-fiber responses to force (14). The identification of ELKIN1 as a mechanically gated ion channel necessary for somatosensory function increases our understanding of the entirety of touch transduction. mechanosensitive C fibers in WT and Elkin1−/− mice. (F) Quantification of the firing rates to increasing forces. (G) Mean spiking rate over a 10-s time period to a 100-mN force stimulus. Dots in (F) and (G) represent average of all fibers. Proportion was compared using c2 test. Two group comparisons were made using Student’s t test. All other group comparisons were made using two-way ANOVA followed by multiple comparison test. *P < 0.05, **P < 0.01, ***P < 0.001. Error bars indicate SEM. Data from both male and female mice. y g Fig. 5. C mechanonociceptors show reduced firing to sustained mechanical force in Elkin1−/− mice. (A) Representative indentation-induced current evoked from WT and Elkin1−/− small DRG neurons. Scale bar, 20 mm. (B) Percent of mechanically sensitive small- and medium-diameter neurons in WT and Elkin1−/− mice. (C) Percent of RA, IA, and SA MA currents found in small- and medium-diameter neurons and their threshold for activation. (D) The number of cells is denoted as dots in the bar graph. (E) Representative spikes from
RES EARCH | R E S E A R C H A R T I C L E 40. S. Chakrabarti et al., Touch sensation requires the mechanically gated ion channel ELKIN1, Dryad (2024); https://doi.org/10.5061/ dryad.0cfxpnw8s. ACKN OW LEDG MEN TS We thank F. Bartelt and L. Dalmasso for help with mouse genotyping and B. Purfürst for electron microscopy. We thank J. Poulet, S. Lechner, and members of the Lewin lab for constructive comments on the manuscript. M.D. thanks D. J. Adams for access to the patch-clamp rig. The H9 cell line (WA09) used in this study is available under a material transfer agreement with WiCell. Funding: This research was funded by ERC grant Sensational Tethers 789128 and ERA-NET NEURON Sensory Disorders project TRANSMECH to G.R.L., Deutsche Forschungsgemeinshaft grant CRC958 to A.H. and G.R.L., and University of Wollongong, Friedreich’s Ataxia Research Alliance (USA), and Friedreich Ataxia Research Association (Australia) to M.D. S.C. and A.R. were recipients of Alexander von Humboldt research fellowships. A.T.-L.H. was a recipient of a Ministry of Science and Technology (Taiwan) fellowship (111-2917-I-564-011). Author contributions: Conceptualization: S.C. and G.R.L. Mouse model design and validation: G.R.L. and V.B. Patch clamp physiology and anatomy and cell biology: S.C. with help from O.S.-C., K.P., and Z.M.B. Antibody validation: C.F. and A.H. Human induced sensory neurons and analyses: A.J.H. with help from R.K.F.-U. and M.D. Tripartite-GFP design and implementation: R.F., A.R., and A.T.-L.H. Molecular biology: A.T.-L.H. Skin nerve electrophysiology: J.D.K. (nociceptors), M.A.K. (mechanoreceptors, A-fiber mechanonociceptors, and D-hair receptors), and G.R.L. (electrical search). Behavioral assessment: S.C. with help from T.P. and H.H. Electron microscopy and analysis: J.D.K. and S.C. Writing: S.C. and G.R.L., with input from all authors. Supervision and funding: G.R.L., A.H., and M.D. Competing interests: The authors declare that they have no competing interests. Data and materials availability: All data are available in the manuscript or the supplementary materials. Prism files are available in Dryad (40). License information: Copyright © 2024 the authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original US government works. https://www.science.org/ about/science-licenses-journal-article-reuse SUPPLEMENTARY MATERIALS science.org/doi/10.1126/science.adl0495 Materials and Methods Figs. S1 to S10 Tables S1 and S2 References (41–45) MDAR Reproducibility Checklist Submitted 27 September 2023; accepted 26 January 2024 10.1126/science.adl0495 p g y y g y , Chakrabarti et al., Science 383, 992–998 (2024) 1 March 2024 7 of 7
RES EARCH CATALYSIS Stable anchoring of single rhodium atoms by indium in zeolite alkane dehydrogenation catalysts Lei Zeng1†, Kang Cheng1†, Fanfei Sun2†, Qiyuan Fan1,3†, Laiyang Li1†, Qinghong Zhang1, Yao Wei2, Wei Zhou1, Jincan Kang1, Qiuyue Zhang1, Mingshu Chen1, Qiunan Liu4, Liqiang Zhang4, Jianyu Huang4, Jun Cheng1, Zheng Jiang2*, Gang Fu1*, Ye Wang1* Maintaining the stability of single-atom catalysts in high-temperature reactions remains extremely challenging because of the migration of metal atoms under these conditions. We present a strategy for designing stable single-atom catalysts by harnessing a second metal to anchor the noble metal atom inside zeolite channels. A single-atom rhodium-indium cluster catalyst is formed inside zeolite silicalite-1 through in situ migration of indium during alkane dehydrogenation. This catalyst demonstrates exceptional stability against coke formation for 5500 hours in continuous pure propane dehydrogenation with 99% propylene selectivity and propane conversions close to the thermodynamic equilibrium value at 550°C. Our catalyst also operated stably at 600°C, offering propane conversions of >60% and propylene selectivity of >95%. 1 March 2024 1 of 7 , We chose Rh as the active metal for PDH because theoretical studies have predicted that y Zeng et al., Science 383, 998–1004 (2024) Catalyst design and preparation y g *Corresponding author. Email: jiangzheng@ustc.edu.cn (Z.J.); gfu@xmu.edu.cn (G.F.); wangye@xmu.edu.cn (Y.Wa.) †These authors contributed equally to this work. y State Key Laboratory of Physical Chemistry of Solid Surfaces, Innovation Laboratory for Sciences and Technologies of Energy Materials of Fujian Province (IKKEM), Collaborative Innovation Center of Chemistry for Energy Materials, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen 361005, China. 2Shanghai Synchrotron Radiation Facility, Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201210, China. 3School of Chemistry and Chemical Engineering, Shanxi University, Taiyuan 030006, China. 4Clean Nano Energy Center, State Key Laboratory of Metastable Materials Science and Technology, Yanshan University, Qinhuangdao, China. g 1 Despite these intensive research efforts, there is no reported catalyst demonstrating stability exceeding 500 hours in continuous PDH under industrially relevant conditions. Most of the state-of-the-art catalysts show continuous decreases in activity or selectivity even during short-term PDH reactions (3). The synthesis of confined bimetallic sites or alloys could extend the lifetime to between 100 and 200 hours, but their synthetic procedures are too intricate to be suitable for large-scale applications, and these catalysts also undergo deactivation during long-term operation (8, 12–14). The decline in performance of the alloy-based catalysts can be attributed to the separation of the bimetallic active phases fabricated by intricate procedures that lose their initial efficiency (1, 6, 15). This deactivation results from the dynamic nature of metals at high PDH temperatures. Preventing the active single-atom catalysts, even those with bimetallic sites or alloys, from deterioration under harsh reaction conditions remains a big challenge. Here, we present a strategy to use the dynamic migration characteristic of indium for facile construction of a single-atom rhodium-indium alloy catalyst that is highly efficient and robust for long-term alkane dehydrogenation without regeneration. By combining an In precursor with rhodium-bearing silicalite-1 (S-1), a pure siliceous zeolite with MFI structure, through simple physical mixing or impregnation, we prepared a PDH catalyst that achieved a propylene yield near the thermodynamic limit at 450° to 600°C and was stable for at least 5500 hours in the conversion of pure propane at 550°C. This catalyst could also work for the dehydrogenation of ethane and n-butane to ethylene and butenes, respectively. p T he escalating demand for propylene has driven studies of catalytic nonoxidative propane dehydrogenation (PDH) for onpurpose production of propylene with polymer-quality purity. Two types of catalysts, chromium oxide–based and platinumbased catalysts (CrOx/Al2O3 and PtSn/Al2O3, respectively), are currently used in the commercial processes, but both suffer from fast deactivation caused by coke deposition or catalyst-structure deterioration at the high temperatures (>500°C) needed to achieve high propane conversions (1–5) and thus require frequent catalyst regeneration. Generally, Ptbased catalysts show better performance and higher stability than do CrOx-based catalysts, which typically deactivate within minutes. Further improvements in Pt catalyst stability and coking suppression have been achieved through the use of metal additives (typically Sn, Zn, Ga, Cu, or even a rare-earth metal) to form nanoscale bimetallic sites or alloys (6–8). The beneficial effect of atomic dispersion of noble metals on activity and selectivity was disclosed in PDH (9–11). A few studies have reported that the stability could be enhanced by confining the metal active sites inside the pore channels of microporous materials (8, 12–14). it is the most active metal for C−H activation (16, 17). However, the Rh-based catalysts reported to date have not shown better performances than the Pt-based catalysts and underwent deactivation within tens of hours even in the presence of bimetallic improvement (10, 18). Hannagan et al. (10) found an enhancement in PDH, especially at low temperatures, by dispersing Rh onto Cu surfaces and observed a stable formation of propylene at 350°C for 50 hours, but the propane conversion is low under such conditions owing to the thermodynamic limitation. We performed CH4–D2 exchange reactions to probe the abilities of a series of S-1–confined noble metal (denoted as NM@S-1, where NM = Rh, Pt, Pd, Ir, or Ru) catalysts toward the C–H bond activation. The Rh@S-1 catalyst showed the highest activity in the formation of hydrogen deuteride (HD) and deuterated methane molecules (Fig. 1A) and thus was experimentally confirmed to be the most efficient in terms of the C−H bond activation. However, only a very low propane conversion was observed over Rh@S-1 even at 600°C, probably because of the quick catalyst deactivation at the very initial stage. The reactions with propane pulses to monitor the conversion of propane at such a stage revealed that Rh@S-1 mainly catalyzed the cracking of propane to methane (breakage of all C–C bonds) instead of the dehydrogenation to propylene, and it also quickly deactivated after several propane pulses (Fig. 1B). We succeeded in constructing a second metalmodified Rh@S-1 catalyst for selective PDH by harnessing the dynamic migration of a metal under reaction conditions. Dynamic migration of elements such as Zn and In in a catalyst under reaction conditions has been observed in a few studies (19–22), but harnessing this effect to construct an efficient heterogeneous catalyst has received less attention (23, 24). Zhao et al. (24) demonstrated that reductively treating a mixture of ZnO- and SiO2-based porous materials caused the migration of Zn0 with a low melting point onto the surface of porous material to generate a supported single ZnOx catalyst active for PDH. We note that the thermal treatment of In2O3 particles in contact with a zeolite at temperatures of 350° to 570°C led to the migration of In species into its micropores (20, 25, 26). The solid-state ion exchange was proposed for such a migration in an early work (26). Our Fourier transform infrared (FTIR) studies using pyridine as a probe molecule (27) revealed that the thermal treatment (600°C) of a physical mixture of In2O3 and S-1 powders (denoted bulk-In2O3+S-1) caused a decrease in silanol groups in S-1, and such a decrease became more pronounced with hydrogen treatment (Fig. 1C and fig. S1). However, this decrease was not observed after heat treatment of the mixtures of S-1 and Ga2O3 or CuO (Fig. 1C and fig. S1), which were
RES EARCH | R E S E A R C H A R T I C L E A Rh Pt Pd Ir Ru B Blank Rh H2 Intensity (a.u.) Intensity (a.u.) HD CH3D CH2D2 CH4 C2H6 C3H6 CHD3 CD4 1 2 3 1 2 3 1 2 3 1 2 3 1 2 3 1 D 2 3 4 5 6 60 40 Conv. Rh@S-11 Select. Rh@S-11 Conv. bulk-In2O3 + Rh@S-1 Select. bulk-In2O3 + Rh@S-1 20 y Conversion or selectivity (%) 80 g Intensity (a.u.) bulk-In2O3+S-1 (H2 600 oC) 1 p S-1 (600 oC) bulk-In2O3+S-1 (600 oC) 3 100 bulk-CuO+S-1 (600 oC) bulk-Ga2O3+S-1 (600 oC) Si-OH 2 Pulse reaction: C3H8 → C3H6 + H2 + [ CH4 + Cx ] Pulse reaction: CH4 + D2 → CH4-iDi (1≤i≤4) + HD C C3H8 fully converted 0 3800 3700 3600 3500 0 Wave number (cm−1) 12 16 quantity of silanol groups and to mitigate potential interference from water species. (D) Catalytic performance for PDH over Rh@S-1 and bulk-In2O3+Rh@S-1. Reaction conditions: C3H8/N2 = 1:3, WHSV = 10 hour–1, temperature (T) = 600°C. a.u., arbitrary units; Conv., conversion; Select., selectivity. 2 of 7 , 1 March 2024 pylene selectivity and the shortest induction period (<3 hours). We also synthesized RhM@S-1 catalysts (M = Zn, Ga, Sn, and Cu) with Rh and the second metal both confined inside S-1. The subsequent catalytic studies demonstrated the distinctive role of In in enhancing the propane conversion, propylene selectivity, and catalyst stability (fig. S6). Unlike the RhIn@S-1 catalyst, which displayed stable propane conversions of >60% and propylene selectivity of >95%, the other RhM@S-1 catalysts showed not only lower propane conversions but also monotonic decreases in performances. The RhIn/S-1 catalyst prepared by coimpregnation of Rh and In species onto S-1 exhibited much lower propane conversion and rapid deactivation (Fig. 2A). Thus, the confinement of Rh inside S-1 appeared to be necessary for obtaining high PDH activity and stability, whereas the location of In species in the fresh catalyst determined the induction period. A y We studied the effect of other introduction methods of In precursors on PDH performance. A physically mixed catalyst of In/S-1, which was preliminarily prepared by impregnation and contained nanosized In2O3 (fig. S3), and Rh@S-1 (denoted as In/S-1+Rh@S-1; see table S1 for the loading amounts of Rh and In) was also efficient for PDH to propylene, but a longer induction period of ~30 hours was required (Fig. 2A). An In/Rh@S-1 catalyst, prepared by simple impregnation and containing nanosized In2O3 largely located on the outer surface of Rh@S-1 (fig. S4), showed an induction period of ~7 hours. We next synthesized a RhIn@S-1 catalyst with Rh and In species introduced simultaneously into S-1 during hydrothermal synthesis. The confinement of both species inside S-1 was imaged with transmission electron microscopy (TEM) (fig. S5). This catalyst showed the highest initial propane conversion and pro- y g Zeng et al., Science 383, 998–1004 (2024) 8 Time on stream (hours) Fig. 1. Catalytic reactivity of Rh@S-1 and In-modified Rh@S-1. (A) CH4‒D2 exchange reactions over NM@S-1 catalysts. (B) Pulse reactions for propane conversion over Rh@S-1 catalyst. (C) Pyridine-adsorbed FTIR spectra for physical mixtures of metal oxides and S-1. Pyridine was used to monitor alterations in the previously used for modifying Rh catalysts (10, 18). The change in IR spectra for the In2O3-based system suggests that In species may migrate into pure siliceous S-1 zeolite without ion-exchange sites by occupying the silanol groups at high temperatures and that the reductive atmosphere expedites migration. Our catalytic PDH assessment showed improvement in performance when In2O3 powders were in contact with Rh@S-1 (Fig. 1D). Compared with the Rh@S-1, bulk-CuO+Rh@S-1, and bulk-Ga2O3+Rh@S-1 catalysts, which had negligible activity in PDH during the entire reaction period, the bulkIn2O3+Rh@S-1 catalyst (the physical mixture of In2O3 and Rh@S-1) had an induction period (Fig. 1D and fig. S2). Both propane conversion and propylene selectivity increased during the initial 6 hours and then remained above 50 and 95%, respectively, over the bulkIn2O3+Rh@S-1 catalyst. 4
RES EARCH | R E S E A R C H A R T I C L E C3H6 select. 80 C3H8 conv. 60 RhIn@S-1 In/Rh@S-1 In/S-1 + Rh@S-1 RhIn/S-1 40 20 0 0 10 20 30 C 100 1 C3H6 select. 80 60 C3H8 conv. 40 In/Rh@S-11 PtSnK/Al2O3 20 PtSnK@S-1 0 1000 1100 T = 550 oC, pure propane, WHSV = 8 h−1 40 Equilibrium yield of propylene C3H8 conv. 0 2000 3000 4000 5000 10 13 a 16 17 1* Time on stream (hours) 100 80 Select. C=4 (mixturea) Conv. n-Co4 Co3 C=3 C=2 Co2 60 40 20 0 450 500 550 600 650 catalytic results are listed in table S2. (D) Stability evaluation of the In/Rh@S-1 catalyst for the dehydrogenation of pure propane. Reaction conditions: T = 550°C, pure C3H8, WHSV = 8 hour–1. (E) The dependence of conversion and selectivity on temperature for the dehydrogenation of ethane, propane, and n-butane over the In/Rh@S-1 catalyst. The dotted lines represent the conversion levels of thermodynamic equilibrium. Reaction conditions: WHSV = 10 hour−1, alkane/N2 = 1:3. over some catalysts, they are transient and decrease rapidly because of the poor catalyst duration (Fig. 2C and table S2). A few studies have demonstrated long-term stability, but the catalyst is operated at a low space velocity or a low temperature that leads to low propylene STY. For the PDH catalysts reported, the propylene STY values have not exceeded 10 mol gnoble metal–1 hour–1 after 500 hours of reaction (Fig. 2C). Thus, simultaneously achieving both high propylene STY and catalytic stability has remained a challenging goal. Our present In/Rh@S-1 catalyst had propylene STYs of 45 mol gRh–1 hour–1 on the basis of Rh weight or 6.0 gC3H6 gcat–1 hour–1 on the basis of the entire catalyst weight after continuous operation at 600°C for 1200 hours (Fig. 2C and table S2) and avoided the trade-off between propylene STY and stability. We further performed rigorous PDH reactions with pure propane as the feed. Propane conversions near the thermodynamic equilibrium values and propylene selectivity of 99% were achieved at 550°C, and we observed no catalyst deactivation during a reaction period exceeding 5500 hours (Fig. 2D), representing a major step forward in PDH under such stringent 3 of 7 , to 650°C, and frequent catalyst regeneration is required owing to deactivation mainly by coke deposition (1). Our In/Rh@S-1 catalyst was surprisingly stable during a 1200-hour conversion of propane diluted by N2 with a weight hourly space velocity (WHSV) of 10 hour−1 at 600°C (Fig. 2B); propane conversion was sustained at as high as 63 ± 2.0%, and propylene selectivity was 98 ± 2.0%. The present catalyst not only exhibits high PDH stability (table S2) but also can work without the co-feeding of H2 that sacrifices propane conversion to alleviate catalyst deactivation by coke deposition. In contrast, the PtSnK/Al2O3 catalyst used in the current commercial process deactivated rapidly under the same reaction conditions. The PtSnK@S-1 catalyst, which displayed improved stability through the confinement of active bimetallic sites (12), also underwent deactivation under our reaction conditions (Fig. 2B). We further evaluated the propylene spacetime yield (STY)—which is the product yield per unit volume or weight of catalyst per unit time and the metric usually adopted for comparison of PDH reaction rates among different catalysts—versus the catalyst duration. Although high propylene STY values have been reported 1 March 2024 17 60 120 500 1500 2500 3500 4500 5500 y We performed intensive studies with the In/ Rh@S-1 catalyst. The optimization reveals that at a fixed Rh loading of 0.35 wt %, the catalyst with an In loading of 1.93 wt % that was typically used in this work shows high performance. A lower In loading led to not only a lower propane conversion and propylene selectivity but also poorer catalyst stability, whereas a higher In loading decreased the propane conversion (fig. S7). Next, the long-term stability was tested. A typical Pt catalyst–based commercial PDH process usually uses propane diluted by H2 with a space velocity of 4 to 13 hour−1 at 525° 15 y g Long-term activity and stability testing 10 9b y shorter distance or closer proximity between In and Rh species results in a shorter induction period, and thus the induction period may correspond to the generation of RhIn bimetallic active sites for PDH by migration of In species into the pore of zeolite S-1 for subsequent interaction with the confined Rh species. These results also offer a simpler protocol of physical mixing or impregnation for the fabrication of efficient bimetallic PDH catalysts despite relatively longer induction periods. Pure C3H8 g Fig. 2. Alkane dehydrogenation performance of In-modified Rh@S-1 catalysts. (A) Effect of the manner of introduction of In into Rh@S-1 on catalytic performances. (B) Stability of In/Rh@S-1 catalyst as well as typical Pt catalysts for PDH. Reaction conditions: T = 600°C, WHSV = 10 hour−1, C3H8/N2 = 1:3. (C) Comparison of STY versus time on stream of In/Rh@S-1 with some typical Pt- and Rh-based catalysts. STY is defined as the number of moles of propylene produced per gram of NMs per hour. All reaction conditions and PtCu/Al2O3 PtCuSiO3 PtCu/SiO2 PtGa/SiO2 PtGaPb/SiO2 PtLa/mz-deGa PtMn/SiO2 Pt@Ge-UTL 9a,b PtZn@S-1 6 14 8 2 3 10 11 12 13 14 15 16 17 Reaction temperature (°C) Time on stream (hours) Zeng et al., Science 383, 998–1004 (2024) 4 0 Conversion or selectivity (%) 80 1000 9 20 10 7 Time on stream (hours) C3H6 select. 0 30 1200 100 20 12 1 In/Rh@S-1 (This work) 2 RhCu/SiO2 3 RhGa/Al2O3 4 Rh/ZrO2 5 PtSn/CeO2 6 PtSnK@S-1 7 PtSn/Al2O3-S 8 PtSn/SiO2 p Conversion or selectivity (%) 900 E 60 40 0 100 Time on stream (hours) D 11 5 0 40 50 STY (molC3H6 gNMs -1 h -1) B 100 Conversion or selectivity (%) Conversion or selectivity (%) A
RES EARCH | R E S E A R C H A R T I C L E C Absorbance (a.u.) Rh Rh Rh@S-1(used) CO CO CO In/Rh@S-1(used) CO B CO A Rh Rh Rh Rh Rhx 2 nm 2 nm 2150 Rh@S-1 (used) Rh@S-1 (fresh) D 1950 1850 1750 Wave number (cm-1) F In edge 1.2 In0 0.8 0.4 g 20 nm In3+ p Normalized absorption (a.u.) E 20 nm 2050 In2O3 In foil In/Rh@S-1 (fresh) In/Rh@S-1 (used) 0.0 27960 27975 27990 Energy (eV) H I In edge In-O In-Rh In-In Rh-O Rh-Rh Rh edge Rh-In 0.8 0.4 Rh2O3 Rh foil Rh@S-1 (fresh) Rh@S-1 (used) In/Rh@S-1 (fresh) In/Rh@S-1 (used) In2O3 In foil In/Rh@S-1 (fresh) In/Rh@S-1 (used) FT magnitude (a.u.) FT magnitude (a.u.) Rh0 Rh2O3 Rh foil y g Normalized absorption (a.u.) 1.2 Rh edge Rh3+ 27945 y G 27930 In/Rh@S-1 (used) In/Rh@S-1 (fresh) Rh@S-1 (fresh) Rh@S-1 (used) In/Rh@S-1 (fresh) In/Rh@S-1 (used) 0.0 23232 23254 23276 1 23298 2 3 5 conditions. The selectivity of propylene was ≥95% for pure propane conversions at 600°C and ≥90% at 630°C, and only a slight deactivation was observed after 120 hours at 630°C (fig. S8). The high stability in pure propane conversions was also observed at conversions below thermodynamic equilibrium at a high WHSV, whereas the two reference catalysts, 2 3 4 5 R (Å) image) of S-1. (F) Normalized In K-edge XANES spectra of In/Rh@S-1 and reference samples. (G) Normalized Rh K-edge XANES spectra of Rh@S-1, In/Rh@S-1, and reference samples. (H) k2-weighted In K-edge EXAFS spectra of In/Rh@S-1 and reference samples. k denotes the wave vector of the photoelectron. (I) k2-weighted Rh K-edge EXAFS spectra of Rh@S-1, In/Rh@S-1, and reference samples. PtSnK/Al2O3 and PtSnK@S-1, underwent quick deactivation under the same conditions (fig. S9). To maximize the utilization of Rh, we investigated the effect of Rh loadings. At a fixed In loading of 1.93 wt %, the In/Rh@S-1 catalyst with a Rh loading of 0.010 wt % could still work for PDH with pure propane at a high WHSV of 150 hour−1 in spite of a low propane 1 March 2024 1 , Fig. 3. Migration of indium oxide and formation of RhIn clusters. (A and B) High-angle annular dark-field scanning transmission electron microscopy (HAADF-STEM) images of Rh@S-1 (fresh) and Rh@S-1 (used). (C) CO-adsorbed FTIR spectra for Rh@S-1 (used) and In/Rh@S-1 (used). (D and E) HAADFSTEM images for In/Rh@S-1 (fresh) and In/Rh@S-1 (used). The red arrows point to white aggregates of In2O3 species on the outer surface (edge in the Zeng et al., Science 383, 998–1004 (2024) 4 R (Å) Energy (eV) y 23210 conversion (fig. S10), offering a propylene STY of up to 1860 mol gRh–1 hour–1 (table S2). On the other hand, an increase in the Rh loading from 0.35 to 0.62 wt % was rather unbeneficial to the propane conversion and propylene selectivity. An In/Rh@S-1 catalyst with 0.95 wt % In and 0.05 wt % Rh provided a propylene STY of >600 mol gRh–1 hour–1 at a propane conversion 4 of 7
RES EARCH | R E S E A R C H A R T I C L E of >45% at 600°C (fig. S11), which is one or two orders of magnitude higher than those reported for Pt-based catalysts at comparable propane conversions (table S2). These results further suggest the existence of a suitable In/Rh ratio to achieve optimum performance, which may imply a specific configuration of the RhIn active site. We also found that the In/Rh@S-1 catalyst was very efficient for the dehydrogenation of ethane and n-butane to ethylene and butenes, respectively. As the temperature increased from 450° to 650°C, as was the case for propane, the conversions of ethane and n-butane increased and were near the thermodynamic equilibrium values (Fig. 2E), and the selectivity of corresponding alkenes (see fig. S12 for the distribution of butenes) was 98 ± 2%. The catalyst also displayed high stability for the dehydrogenation of ethane and butanes (fig. S13). y , 5 of 7 y g 1 March 2024 Density functional theory (DFT) calculations for the formation energies of some monometallic and bimetallic clusters composed of Rh and In atoms reveal that the RhIn clusters are energetically more stable than the monometallic Rh or In clusters (fig. S22). Taking Rh5 as a model of Rh clusters, we studied the dynamic evolution of a Rh5 cluster in the presence of In atoms at 550°C by an ab initio molecular dynamics (AIMD) simulation approach (30). The result suggests that the Rh atoms begin to disperse when the Rh5 cluster is combined with In5 or In80 ensembles (fig. S23). The presence of sufficient In atoms could enable the complete isolation of Rh atoms, forming RhIn clusters with single-atom Rh sites. The Bader charge analysis indicates a negative charge on Rh atoms (fig. S24, A and B), which would contribute to the dispersion and isolation of Rh atoms in the RhIn clusters because of the electrostatic repulsion. The total energy profile analysis shows energy gains from the formation of Rh–In bonds that can compensate for the energy cost for breaking Rh–Rh bonds in the Rh5/In20 or Rh5/In80 system (fig. S24, C and D). To validate the interactions between Rh and In and to mitigate possible biases arising from the distinctive nature of cluster models, we extended our studies to the evolution of Rh clusters on the In(100) plane and observed a comparable phenomenon of Rh–Rh separation (fig. S25). However, such a Rh–Rh separation was not observed on the Cu(100) plane (fig. S26). The role of In in preventing Rh from aggregation in zeolite was also studied with the AIMD simulation by taking the structure evolution of a Rh–Rh dimer inside S-1 as a model of y Zeng et al., Science 383, 998–1004 (2024) Theoretical results g We characterized the as-synthesized and postreaction Rh@S-1 catalyst using aberrationcorrected scanning transmission electron microscopy (AC-STEM). The Rh species in the as-synthesized Rh@S-1 catalyst existed as single atoms (Fig. 3A and fig. S14), whereas after PDH reaction, the Rh atoms tended to aggregate and form clusters with sizes close to or even larger than the channel dimension of S-1 (∼0.55 nm) (Fig. 3B and fig. S15). The presence of aggregated Rh clusters in the Rh@S-1 catalyst after PDH was further confirmed by the CO-adsorbed IR spectrum. The IR bands attributable to geminal CO adsorption (twin bands at around 2100 and 2000 cm–1), linear CO adsorption (at around 2050 cm–1), and bridge adsorption (at around 1960 and 1800 cm–1) were observed (Fig. 3C), and the appearance of intense bridge CO adsorption bands provided evidence for the formation of Rh clusters in the Rh@S-1 catalyst after PDH. For the fresh In/Rh@S-1 catalyst, nanoparticles or nanoaggregates could be observed (Fig. 3D), and with a combination of x-ray photoelectron spectroscopy (XPS) and argon ion sputtering, we identify these species as nanosized In2O3 largely located on the outer surface of S-1 (fig. S4). The In/Rh@S-1 catalyst after reaction contained fewer and smaller In2O3 clusters (Fig. 3E and fig. S4), whereas the In loading did not change notably (table S1). The disappearance of In2O3 aggregates was also clearly observed for the bulk-In2O3+Rh@S-1 catalyst after reaction (fig. S16), which also showed an induction period during the PDH reaction (Fig. 1D). These observations suggest that In species migrated into the channel of S-1 in these catalysts under reaction conditions, becoming finely dispersed. Small clusters of several angstroms were observed in the used RhIn@S-1 catalyst with the shortest induction period (fig. S17), suggesting that the spectra, we ascribed the peak at around 2.5 Å for the working In/Rh@S-1 catalyst to the Rh–In coordination. Neither the In K-edge nor the Rh K-edge EXAFS spectra showed the appearance of the In–Rh or Rh–In coordination in the fresh In/ Rh@S-1. For the working In/Rh@S-1catalyst, CNs of Rh–In bonds (Rh-edge) of 4.2 ± 0.6 and In–O bonds (In-edge) of 2.0 ± 0.2 (fig. S20 and table S3) were obtained from the EXAFS fitting analysis. Similar CNs were obtained for the RhIn@S-1 catalyst under reaction conditions (fig. S21 and table S3). The combination of operando EXFAS, AC-STEM, and CO-adsorbed FTIR results enables us to infer that the active structure for PDH is the RhIn4 site, which is anchored onto the framework of S-1 through the In–O linkage and is analogous to a ligandstabilized intermetalloid cluster (29). The operando XAS results supported our idea that the In species in a low valance state under reaction conditions migrated into S-1, resulting in a single-atom Rh site coordinated with In atoms and stabilized by the framework of S-1. p Catalyst characterization active site is the RhIn cluster composed of several atoms. In the CO-adsorbed IR spectra for the used In/Rh@S-1, In/S-1+Rh@S-1, and RhIn@S-1 catalysts, the bridge CO adsorption at around 1960 and ~1800 cm–1 was absent (Fig. 3C and fig. S18), unlike for the used Rh@S-1 catalyst, which suggests that the Rh species in the In-modified Rh@S-1 catalysts exist as single atoms. Thus, the migration of In species would prevent the aggregation of Rh single atoms into clusters during reaction. We performed operando x-ray absorption spectroscopy (XAS) studies on the structure of active sites and the dynamic migration of In species in the In/Rh@S-1 catalyst under PDH conditions. The In K-edge x-ray absorption near-edge structure (XANES) spectrum indicated that the oxidation state of In was reduced from +3 to between +1 and 0 (Fig. 3F). The operando Rh K-edge XANES spectrum showed a decrease in the white line and the position shift of the absorption edge toward the left side as compared with the Rh foil (Fig. 3G). This observation not only indicated the complete reduction of Rh3+ in the working catalyst but also the enrichment of electrons at the Rh site that likely occurred through interaction with In species. We infer that the reduced In species migrated into zeolite S-1 and formed bimetallic RhIn clusters with Rh, leading to the electron transfer from In to Rh (28). The operando extended x-ray absorption fine structure (EXAFS) spectroscopic analysis provides information on evolution of the RhIn cluster structure in the In/Rh@S-1 catalyst during the reaction. The real-space In K-edge EXAFS spectra (Fig. 3H) showed that the peak at 1.52 Å, which we assigned to the In–O bond, decreased, confirming the reduction of In species during the reaction. Despite its low intensity, the remaining In–O peak was the one dominant oxygen linkage and suggested the incomplete reduction of In3+ to Ind+. A peak at around 2.5 Å, which we attributed to the In–Rh coordination, was observed in the working catalyst and provided evidence for the direct interaction between In and Rh atoms. The operando Rh K-edge EXAFS spectra (Fig. 3I) confirmed the complete reduction of Rh species because of the lack of Rh–O coordination. The Rh–Rh coordination with peaks at around 1.9 and 2.5 Å could be observed in the used Rh@S-1 catalyst, and the EXAFS fitting analysis offered a Rh–Rh coordination number (CN) of 5.5 ± 0.8 (fig. S19 and table S3), which agreed well with the AC-STEM and CO-adsorbed FTIR results suggesting that this catalyst consisted of Rh clusters. The peak at around 1.9 Å of the Rh–Rh coordination did not appear in the In/Rh@S-1 catalyst. The AC-TEM and COadsorbed FTIR results for this catalyst indicate the atomic dispersion of Rh. By combining additional information from the In K-edge EXAFS
RES EARCH | R E S E A R C H A R T I C L E B 3.2 Rh2In8 evolution t = 0 ps Two RhIn4 cluster in vacuum Two RhIn4 cluster in S-1 4 t = 15 ps 3.0 3 Free energy (eV) Average Rh-Rh distance (Å) A 2.8 2.6 2.4 2 1 0 Initial -1 2.2 Rh2 Rh2In2 Rh2In4 Rh2In6 Rh2In8 Rh2In10 9 8 7 AIMD models (inside the silicalite-1) C 1 TS6u C3H8(g) -1 (2) TS6d 0 *CH2+*CHCH3+2*H TS3 (1) TS7u (3) *C3H7+*H TS7 d (4) C3H6(g)+2*H TS8 *C3H4+4*H TS11 0 TS12 *C3H5+3*H *C3H5+3*H −1 *C3H6+2*H C2H4(g)+*CH2+2*H TS9 *C2H4+*CH2+2*H -3 *C3H4+4*H TS10 *C2H4+*CH3+*H y Cracking on Rh 5 Dehydrogenation on Rh 5 C3H4(g)+4*H C3H4(g)+4*H 1 *CH2CH2*CH2+2*H -2 2 Deep dehydrogenation on Rh5 TS4 TS2 TS1 3 Rh-Rh distance (Å) TS5 Dehydrogenation on RhIn4 Deep dehydrogenation on RhIn4 Cracking on RhIn4 4 g Free energy (eV) 2 5 p 3 6 *C2H4+CH4(g) Reaction coordinate Fig. 4. Dynamics simulations of RhIn sites and DFT calculation results. (A) AIMD simulation of the evolution of Rh2Inx (x = 0 to 10) clusters with free In atoms in S-1. (B) Slow-growth method to simulate the agglomeration process of two RhIn4 clusters. (C) Free energy profiles for C3H8 dehydrogenation on Rh5 and RhIn4 clusters. (1), 2-*C3H7+*H; (2), *C3H6+2*H; (3), 2-*C3H7+*H (dashed line) and 1-*C3H7+*H (solid line); and (4), *C3H6+2*H. 6 of 7 , 1 March 2024 of the system decreased when Rh atoms in two separate sites converged toward each other in a vacuum, forming a Rh2In8 cluster with a Rh–Rh distance in the range of 5.7 to 2.7 Å (Fig. 4B). A further decrease in the Rh–Rh distance to ≤2.7 Å, the diameter of a Rh atom, increased the free energy as a result of the repulsion. In contrast, when the RhIn4 site was confined in S-1, the free energy increased continuously with the approach of the two RhIn4 moieties to form a dimeric complex and exceeded 2.00 eV when the Rh–Rh distance became shorter than 4 Å. The simulation result indicated that the RhIn4 site confined in zeolite S-1 had very little driving force to aggregate, hence providing an effective means of constructing highly stable PDH catalysts. DFT calculations were performed to gain insights into the effect of Rh dispersion on PDH catalysis. We adopted Rh5 and RhIn4 as models of Rh@S-1 and In/Rh@S-1 catalysts, respectively, for better computational efficiency (fig. S30). As indicated by the Gibbs free energy, y Zeng et al., Science 383, 998–1004 (2024) catalyst with such a low In content underwent deactivation within 5 hours (fig. S7). An increase in In content up to 1.93 wt % (In/Rh ratio ≈ 5) further increased the propane conversion at the steady state and achieved excellent catalyst stability. These results are in agreement with the AIMD simulation suggesting that an In/Rh ratio of 4 or more is necessary to acquire atomic dispersion of Rh. An overly high In content led to a decreased propane conversion (fig. S7), probably because of the covering of RhIn4 clusters or the blocking of micropores by excessive InOx. Thus, both the AIMD simulation and the catalytic results suggest the key function of In in separating Rh atoms, leading to an efficient catalyst for PDH. We further investigated the role of zeolite S-1 in enhancing the catalyst stability by simulating the aggregation of the RhIn4 site in vacuum and in S-1 using a slow-growth method (30) (Fig. 4B and fig. S29). The Gibbs free energy of the isolated RhIn4 site was set to zero. The simulation showed that the free energy y g the confined catalyst (fig. S27). In the stabilized structure, the Rh dimer had a bond distance of 2.3 Å and was located in the intersection of the straight and sinusoidal 10-membered ring channels. By adding In atoms to the original Rh2 cluster, the Rh–Rh bond rapidly elongated to ~2.8 Å at an In/Rh ratio of 4, which was even larger than the length of the Rh–Rh bond (2.67 Å) in Rh foil (31) (Fig. 4A). A snapshot of simulation progress at 15 ps illustrates the separation of the Rh–Rh bond by the presence of In atoms in particular at an In/Rh ratio of ≥4 (Fig. 4A and fig. S27). Moreover, the AIMD simulation for a RhIn4 cluster inside S-1 at 550°C shows that the Rh–In bond lengths in the cluster at the equilibrium position are close to those obtained by the fitting analysis of the operando EXAFS result (fig. S28 and table S3), confirming the reliability of the simulation results. Our catalytic experiments showed that the addition of In with a low loading (0.48 wt %) into Rh@S-1 could enhance both the propane conversion and propylene selectivity, but the
RES EARCH | R E S E A R C H A R T I C L E Discussion RE FERENCES AND NOTES AC KNOWLED GME NTS We thank L. Cui, H. Chen, J. Cheng, W. Wang, W. Li, and X. Xiong at Xiamen University for help with partial theoretical calculations, in situ XPS characterization, and PDH evaluation. We thank X. Chen from Tsinghua University and M. Tang from Utrecht University for help with AC-STEM characterization. We thank the BL14W1 XAFS beamline of Shanghai Synchrotron facilities (SSRF) for providing beamtime. Funding: This work was supported by the National Key Research and Development Program of the Ministry of Science and Technology of China (2022YFA1504603 and 2022YFA1504500) and the National Natural Science Foundation of China (22121001, 22222206, U22A20392, 22132004, 92045303, 91945301, and 92145301). Author contributions: L.Ze. conducted the catalyst exploration, catalytic reactions, basic catalyst characterizations, data analysis, and drafted the paper. K.C. and Qin.Z. guided the experimental design and data analysis and revised the paper. F.S. and Y.We. performed operando XAS studies and analyzed the data. Q.F. and L.L. contributed to DFT calculations and drafted the DFT section of the paper. W.Z. and J.K. assisted in the long-term stability evaluation and analyzed the data. Qiu.Z. and M.C. conducted part of the characterizations and analyzed the data. Q.L., L.Zh., and J.H. conducted major TEM characterizations and analyzed relevant images. J.C. provided suggestions and guidance about the DFT calculations. Z.J. guided the operando XAS measurements, analyzed the data, and drafted part of the paper. G.F. guided the simulations and DFT calculations, analyzed the data, and drafted part of the paper. Y.Wa. initiated the project, guided the study, and co-wrote the paper. All authors approved the final version of the manuscript. Competing interests: J.K., L.Ze., W.Z., Qin.Z., and Y.Wa. are inventors listed on Chinese patent (ZL201910260429.7) filed by Xiamen University, which covers the Rh-based catalysts reported in this paper. The authors declare that they have no other competing interests. Data and materials availability: All data are available in the main text or the supplementary materials. License information: Copyright © 2024 the authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original US government works. https://www.science.org/about/ science-licenses-journal-article-reuse y SUPPLEMENTARY MATERIALS science.org/doi/10.1126/science.adk5195 Materials and Methods Figs. S1 to S30 Tables S1 to S3 References (32–51) y g 1. J. J. Sattler, J. Ruiz-Martinez, E. Santillan-Jimenez, B. M. Weckhuysen, Chem. Rev. 114, 10613–10653 (2014). 2. Z. Nawaz, Rev. Chem. Eng. 31, 413–436 (2015). 3. S. Chen et al., Chem. Soc. Rev. 50, 3315–3354 (2021). 4. Y. Dai et al., Chem. Soc. Rev. 50, 5590–5630 (2021). 5. M. Monai, M. Gambino, S. Wannakao, B. M. Weckhuysen, Chem. Soc. Rev. 50, 11503–11529 (2021). 6. A. H. Motagamwala, R. Almallahi, J. Wortman, V. O. Igenegbai, S. Linic, Science 373, 217–222 (2021). 7. M. D. Marcinkowski et al., Nat. Chem. 10, 325–332 (2018). 8. R. Ryoo et al., Nature 585, 221–224 (2020). 9. Y. Nakaya, J. Hirayama, S. Yamazoe, K. I. Shimizu, S. Furukawa, Nat. Commun. 11, 2838 (2020). 10. R. T. Hannagan et al., Science 372, 1444–1447 (2021). 11. K. Searles et al., J. Am. Chem. Soc. 140, 11674–11679 (2018). 12. L. Liu et al., Nat. Mater. 18, 866–873 (2019). 13. Q. Sun et al., Angew. Chem. Int. Ed. 59, 19450–19459 (2020). 14. Y. Ma et al., Nat. Catal. 6, 506–518 (2023). 15. J. Wang et al., ACS Catal. 11, 4401–4410 (2021). 16. C.-T. Au, C.-F. Ng, M.-S. Liao, J. Catal. 185, 12–22 (1999). 17. Y. Wang, P. Hu, J. Yang, Y.-A. Zhu, D. Chen, Chem. Soc. Rev. 50, 4299–4358 (2021). 18. N. Raman et al., ACS Catal. 9, 9499–9507 (2019). 19. C. W. Andersen et al., Angew. Chem. Int. Ed. 56, 10367–10372 (2017). 20. J. L. Weber et al., Catal. Today 342, 161–166 (2020). 21. Y. Wang et al., Angew. Chem. Int. Ed. 60, 17735–17743 (2021). 22. Y. Ding et al., ACS Catal. 11, 9729–9737 (2021). 23. L. Xu et al., Science 380, 70–76 (2023). 24. D. Zhao et al., Nature 599, 234–238 (2021). 25. P. Gao et al., ACS Catal. 8, 571–578 (2018). 26. M. R. Mihályi, H. K. Beyer, Chem. Commun. 2001, 2242–2243 (2001). 27. B. Chakraborty, B. Viswanathan, Catal. Today 49, 253–260 (1999). 28. S. Nishimura, A. T. N. Dao, D. Mott, K. Ebitani, S. Maenosono, J. Phys. Chem. C 116, 4511–4516 (2012). 29. K. Mayer, J. Weßing, T. F. Fässler, R. A. Fischer, Angew. Chem. Int. Ed. 57, 14372–14393 (2018). 30. T. K. Woo, P. M. Margl, P. E. Blöchl, T. Ziegler, J. Phys. Chem. B 101, 7877–7880 (1997). 31. M. Harada, K. Asakura, Y. Ueki, N. Toshima, J. Phys. Chem. 97, 10742–10749 (1993). g We succeeded in constructing a highly efficient and highly stable alkane-dehydrogenation Rh single-atom catalyst by using the dynamic migration of In species under reaction conditions. The catalyst demonstrated C2–C4 alkane conversions approaching thermodynamic equilibrium values with excellent alkene selectivity in a wide temperature range of 450° to 650°C. The catalyst stability exceeds 1200 hours in PDH to propylene with a propylene yield of >60% at 600°C. No catalyst deactivation was observed for 5500 hours under a harsh atmosphere of pure propane, simulating industrial dehydrogenation conditions. A propylene STY of >600 mol gRh–1 hour–1 was attained at a propane conversion of >45%, which is one or two orders of magnitude larger than those reported for Pt-based catalysts under comparable propane conversions. Our studies revealed that In species function like solvents and alloying agents, which effectively created in situ dilute Rh atoms in the form of RhIn4 sites attached onto the zeolite framework through In–O linkages. This transformation turned the unselective and unstable Rh-based catalysts into highly selective and ultrastable PDH catalysts. Our findings also offer a simple protocol for synthesizing robust single-atom catalysts that are operated at harsh reaction conditions. p the dehydrogenation of propane to adsorbed propylene (*C3H6) was energetically favorable on the Rh5 cluster. However, the subsequent desorption of *C3H6 was endothermic, with an energy requirement of 1.2 eV (Fig. 4C). The deep dehydrogenation of *C3H6 into C3H4 was impeded by a substantial free energy barrier for the desorption of *C3H4 (2.1 eV). Alternatively, the formation of cracking products by means of *CH2CH2*CH2 on the Rh5 cluster was more feasible, characterized by a lower free energy barrier of 0.8 eV. For the RhIn4 cluster, although the dehydrogenation step of C3H8 encountered a higher free energy barrier of 1.3 eV, the energy required for the desorption of *C3H6 was largely reduced (0.24 eV). The deep dehydrogenation and cracking on the RhIn4 cluster presented free energy barriers of 1.5 and 2.8 eV, respectively (Fig. 4C). Thus, the propylene formation path became more favored. These DFT calculation results clearly demonstrate the contribution of atomic dispersion of Rh by In species to achieving high propylene selectivity during PDH. Submitted 26 August 2023; accepted 22 January 2024 10.1126/science.adk5195 y , Zeng et al., Science 383, 998–1004 (2024) 1 March 2024 7 of 7
RES EARCH ATMOSPHERIC DYNAMICS Large-scale self-organization in dry turbulent atmospheres Alexandros Alexakis1*, Raffaele Marino2, Pablo D. Mininni3, Adrian van Kan4, Raffaello Foldes2, Fabio Feraco2,5 How turbulent convective fluctuations organize to form larger-scale structures in planetary atmospheres remains a question that eludes quantitative answers. The assumption that this process is the result of an inverse cascade was suggested half a century ago in two-dimensional fluids, but its applicability to atmospheric and oceanic flows remains heavily debated, hampering our understanding of the energy balance in planetary systems. We show using direct numerical simulations with spatial resolutions of 122882 × 384 points that rotating and stratified flows can support a bidirectional cascade of energy, in three dimensions, with a ratio of Rossby to Froude numbers comparable to that of Earth’s atmosphere. Our results establish that, in dry atmospheres, spontaneous order can arise through an inverse cascade to the largest spatial scales. Set up @t u þ u  ∇u þ 2W  u ¼ ∇P  ez N f þ n∇2 u þ f ð1Þ @t f þ u  ∇f ¼ N ez  u þ k∇2 f ð2Þ where W is the solid body rotation rate, N is the Brunt-Väisälä frequency, P is the pressure, n is the viscosity, k is the density diffusivity, and f is an external forcing acting at scales 1 of 5 , We consider a fluid in a Cartesian, triply periodic domain of vertical height H and horizontal dimension L = 32H, in the presence of gravity, a stable mean density gradient, and solid body rotation in the vertical direction (30). The dynamics of the system are described by the incompressible velocity field u and the normalized density variation f, governed by the Boussinesq equations (31, 32) y 1 March 2024 y g Alexakis et al., Science 383, 1005–1009 (2024) y *Corresponding author. Email: alexakis@phys.ens.fr g 1 Laboratoire de Physique de l’Ecole normale supérieure, ENS, Université PSL, CNRS, Sorbonne Université, Université ParisDiderot, Sorbonne Paris Cité, Paris, France. 2Université de Lyon, CNRS, École Centrale de Lyon, INSA Lyon, Université Claude Bernard Lyon 1, Laboratoire de Mécanique des Fluides et d’Acoustique, UMR5509 - F-69134, Écully, France. 3Universidad de Buenos Aires, Facultad de Ciencias Exactas y Naturales, Departamento de Física, and CONICET - Universidad de Buenos Aires, Instituto de Física Interdisciplinaria y Aplicada (INFINA), Ciudad Universitaria, 1428 Buenos Aires, Argentina. 4Department of Physics, University of California Berkeley, Berkeley, CA 94720, USA. 5Leibniz-Institute of Atmospheric Physics at the University of Rostock, 18225 Kühlungsborn, Germany. ferring enstrophy to smaller scales, whereas energy is transferred to larger scales. This process takes place on a continuum of scales, forming a constant flux of energy from small to large scales in what is known as an inverse energy cascade, as opposed to the disordered forward energy cascade observed in 3D turbulence that is directed to small scales. Although planetary atmospheres are often very thin (Earth’s atmosphere has horizontal synoptic scales of the order of 1000 km and a pressure scale height of 7.6 km), the corresponding flows are far from being 2D. Nonetheless, two-dimensionality is not imperative for the appearance of self-organization. 3D rotating and stratified flows (two key ingredients of atmospheric dynamics) conserve a different invariant—the potential vorticity— that can also lead to an inverse cascade. This happens in the quasi-geostrophic limit, where rotation and stratification are asymptotically strong (6) and where gravito-inertial waves are filtered out. Inverse cascades can also be present in rotating Rayleigh-Bénard convection (7–11), where in this case, a generalized quasi-geostrophic limit can be considered that partially preserves gravito-inertial modes. However, for most planetary flows, the quasigeostrophic limit is, at best, a crude approximation, with gravito-inertial waves composing a substantial part of the energy budget cascading energy forward (12–15). Thus, an inverse cascade in planetary atmospheres caused either by two-dimensionality or quasi-geostrophy remains conjectural. Could atmospheric dynamics display an inverse cascade away from these limits? In recent years it has been demonstrated that a hybrid state can be reached such that larger scales cascade energy inversely, whereas smaller scales cascade energy forward in what is now known as a bidirectional cascade (16). Bidirectional cascades were observed early on with direct numerical simulations (DNS) (17–22). In ro- p F low structures thousands of kilometers wide are not uncommon in the atmosphere of Earth and that of other planets. The energy of these structures could originate from processes associated with the global atmospheric circulation but could also originate from smaller-scale convective turbulence. In the latter case, small-scale eddies conspire to self-organize into larger structures. Such a process goes against our daily life experience, where turbulence generates smaller-scale erratic structures, such as those observed when pouring milk into a cup of coffee. It is therefore necessary to come up with convincing mechanisms for how such large-scale organization can take place in planetary atmospheres. One of the most important theoretical discoveries in the 20th century in the field of nonequilibrium physics is the phenomenon of self-organization, which spontaneously creates large-scale order out of small-scale disorder. One of the first examples of this process was given by Onsager with the statistical mechanics of a gas of point vortices (1) that was later generalized to two-dimensional (2D) turbulent flows (2–5). A 2D flow conserves an additional invariant, the enstrophy, given by the mean squared vorticity. The relation between energy and enstrophy leads to an incompatibility for the simultaneous bulk transfer of both quantities to the small scales. As a result, vortices self-interact, trans- tating and stratified flows, simulations also indicate the presence of bidirectional cascades (23–25), though in a regime where rotation and stratification are comparable in strength, which is typical for the ocean but not for the atmosphere. Nonetheless, the existence of self-organization processes through a bidirectional cascade in planetary atmospheres has become a compelling possibility as recent research using satellite images with cloud tracking analysis and in situ aircraft measurements has estimated the flux (and thus also the direction) of the energy cascades in planetary flows in Earth’s atmosphere (26, 27), the ocean (28), and the Jovian atmosphere (11, 29). These studies have affirmed the presence of both inverse and forward energy cascades depending on the scale examined or on the altitude. However, satellite images constrain the measurements to 2D slices, thus ignoring any processes occurring in the third direction. Up to now, there is no definite evidence of whether planetary atmospheric flows satisfy the necessary conditions for a bidirectional cascade to establish itself. The difficulty in answering such questions lies, on the one hand, in the fact that information from satellite images is limited and, on the other hand, in the extreme parameter values that are met in planetary atmospheres, which are hard to obtain in DNS. However, not only has the technology to perform high-cadence high-resolution observations of the atmosphere just started to come along, but the computational power to perform DNS of stratified atmospheres in a realistic parameter space has also become available. In this work, with the use of DNS in a large grid using 40,000,000 central processing unit (CPU) hours, we establish that the fluid model of a rotating and stably stratified dry atmosphere described by the nonhydrostatic Boussinesq equations can generate a bidirectional cascade leading to largescale organization of the flow.
RES EARCH | R E S E A R C H A R T I C L E 2 of 5 , 1 March 2024 y Alexakis et al., Science 383, 1005–1009 (2024) y g Fig. 1. Visualization of density fluctuations ϕ and of the velocity field in the computational domain. Structures at scales much larger than the forcing (i.e., at the scale of the domain height, with wave number kF = 2p/H) are abundant in the visible horizontal plane (left), indicative of an efficient transfer of the energy toward the lowest modes along the perpendicular direction in Fourier space. The large-scale patterns are visible in the flow visualization, shown by arrows in a zoomed-in view (top right). At the same time, 3D instability patterns and small-scale features are detectable in both horizontal and vertical cuts of the zoomed-in simulation domain (bottom right), which suggests the action of a forward turbulent cascade. See the supplementary materials for a movie of the density fluctuations in the entire domain. Visualizations were done with VAPOR (35). y Figure 1 shows visualizations of the flow and the density field made using VAPOR (35). Structures with horizontal widths 10 times as large as them by their argument—i.e., Ei(k), Ei(k⊥), and Ei(k‖) where i is T, K, P, GW, or QG, which stand for total, kinetic, potential, gravito-inertial wave, and quasi-geostrophic, respectively. In addition, we define Ei(k⊥, k‖) that shows the spectral energy density for a given pair k⊥, k‖. The left panels in Fig. 2 show the energy spectra Ei(k), Ei(k⊥), and Ei(k‖) with the energy component i as indicated in the legend. The inset also shows the ratios RGW = EGW/ET and RQG = EQG/ET. In the top panel, for k > kH, the spectra have been averaged over shells of width kH because otherwise large peaks of period kH are observed due to the strong domain anisotropy, shown by the light gray lines for the total energy spectrum. For wave numbers larger than kH and smaller than the viscous wave number kn, the spherically averaged spectrum displays a power-law behavior with an exponent very close to Kolmogorov’s prediction k−5/3 for homogeneous isotropic turbulence. This power-law behavior, composed 70% by gravito-inertial waves, is indicative of a forward energy cascade. At k smaller than kH, a similar power law is observed (albeit with a smaller prefactor). This indicates the presence of an inverse cascade. This energy at small k is almost exclusively kinetic, dominated by 2D quasi-geostrophic modes. For Ei(k⊥), three different power laws can be observed. First, in the range kL < k⊥ < kH, a k⊥−5/3 law is observed, where kL = 2p/L. This is consistent with Earth’s atmospheric spectrum between ≈10 and 500 km (36). Second, in the range kH < k⊥ < kB = N/U, a steeper power law close to k⊥−3 is observed, where kB is the buoyancy wave number. Finally, at larger k⊥, a shallower power-law slope starts to appear with exponent close to −5/3. Finally, the last panel of Fig. 2 shows Ei(k‖) with k−5/3 and k−3 power laws indicated as references, the latter observed in the atmosphere at vertical scales near 1 km caused by gravity waves (37). The right panels of Fig. 2 show the energy fluxes across different surfaces in wave number space: across constant k spheres P i(k), constant k⊥ cylinders P i(k⊥), and constant k‖ planes P i(k‖). As with the spectra, we distinguish between fluxes based on their arguments. Here, i is T, K, or P, which stand for total, kinetic, and potential energies, respectively. Positive values imply a flux of energy toward larger wave numbers, whereas negative values indicate a flux toward smaller wave numbers. P T(k) flux is positive for k > kH, which indicates a forward cascade. However, a small fraction, corresponding to 5% of the total energy injection rate, cascades toward larger scales. This is seen in the negative flux observed at k < kH. This flux is also constant for more than a decade of wave numbers almost up to kL. The inset in Fig. 2 shows the amplitude of this negative flux measured from different simulations varying only Re. The flux g Results that of H can be seen by visual inspection. At the same time, looking at the zoomed-in cross sections, it is obvious that these structures are far from being 2D. In the larger scales, pancake structures of alternating sign of f along the vertical and the emergence of macroscopic cyclones and anticyclones are visible in Fig. 1 (top right). These features are observed in weather maps and are a landmark of larger-scale, energycontaining structures in Earth’s atmosphere. At the same time, smaller-scale overturning events can be seen in the zoomed-in section that are one-tenth the size of H (Fig. 1, bottom right) and are also detectable sometimes in the sky as Kelvin-Helmholtz billows. Thus, even at this qualitative level, the presence of a bidirectional cascade is evident. To become more quantitative, we note that the inviscid Boussinesq equations conserve the total energy ET given by the sum of kinetic energy EK and potential energy EP. Alternatively we decomposed it into the energy of gravitoinertial modes EGW and the energy of quasigeostrophic modes EQG, where ET = EGW + EQG. Gravito-inertial modes are dispersive wave modes due to the combined restoring force of gravity and Coriolis, whereas quasi-geostrophic modes balance Coriolis and gravity forces with pressure (see materials and methods for their exact definitions). These energies are distributed differently in the Fourier space, among vertical wave numbers k‖ and horizontal wave numbers k⊥. We define three different energy spectra averaged over fixed k ‖ , k ⊥ , and qffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi ffi k ¼ k2∥ þ k2⊥ . We do not define a new symbol for each spectrum but distinguish between p ‘F ∼ H injecting energy at a rate D. Although this model has some strong simplifications, like periodicity or a simplified forcing mechanism, it is the most elementary model capturing the necessary physics to reproduce atmospheric dynamics. This system has four independent nondimensional control parameters: (i) the Reynolds 4=3 number ReD ¼ D1=3 kH =n; (ii) the Prandtl number Pr ¼ n=k, that here is set to unity; (iii) 2=3 =W ; and the Rossby number RoD ¼ D1=3 kH 1=3 2=3 (iv) the Froude number FrD ¼ D kH =N (with kH = 2p/H). We can also define dimensionless parameters based on the domain size L and the flow root mean square velocity U as, for example, Re ¼ UL=n,Ro ¼ U =ðHWÞ, and Fr ¼ U =ðNH Þ, which are closer to the definitions used in atmospheric measurements. Simulations were performed at resolutions of 122882 × 384 grid points (30, 33). As a reference, a domain height H = 15 km (equal to twice the pressure scale height in Earth’s atmosphere) corresponds to a domain length of 480 km (corresponding to atmospheric mesoscales) and a vertical and horizontal resolution of 39 m. Our simulations are characterized by ReD ¼ 2000, RoD ¼ 1, and FrD ¼ 0:025, or alternatively Re ≈ 2 × 106, Ro ≈ 0.4, and Fr ≈ 0.01. These values are also compatible, for example, with that of the mesosphere–lower thermosphere (MLT) (34).
RES EARCH | R E S E A R C H A R T I C L E p g y Fig. 2. Energy spectra and fluxes. (Left) Spherically (top), cylindrically (middle), and plane (bottom) averaged energy spectra, for all energy components. Insets show the ratios of energy components RGW = EGW/ET (pink) and RQG = EQG/ET (green). (Right) Energy fluxes across spheres (top), cylinders (middle), and planes (bottom) in spectral space. Total energy flux (black line), energy flux of kinetic energy (blue line), and energy flux of potential energy (red line) are shown. The forcing wave number kF ≈ kH (where energy is injected), the buoyancy wave number kB = N/U, and the dissipation wave number kn (where energy is dissipated) are indicated by vertical dashed lines. y g Conclusions We have shown that dry turbulent atmospheres modeled by the nonhydrostatic Boussinesq equations can lead to a bidirectional energy cascade. The results showed that there is a flux of energy directed to the small wave numbers k, corresponding to 5% of the total energy injection rate at the largest Reynolds number. This flux, albeit small, is shown to per- 1 March 2024 sist up to the largest scales of the system and is Re-independent as large values of Re are reached. Our analysis provides a detailed description of how energy is transferred across scales and between different modes. These transfers, indicated by the arrows sketched in Fig. 3, summarize the results in this work. Stratification, rotation, and the geometric constraint of finite H all play a role in the formation of this inverse cascade. In physical terms, at the scale of the forcing, stratification is dominant, constraining a large fraction of the energy to QG modes. This leads to the formation of pancake structures, known in stratified turbulence (38), that move energy to smaller k⊥ and larger k‖. This process ceases at wave numbers where stratification is comparable to rotation, Nk⊥ º 2Wk‖. Rotation, which tends to bidimensionalize the flow (39), prevents larger k‖ modes from appearing, and energy is converted to gravitoinertial mode energy that cascades back to 3 of 5 , Alexakis et al., Science 383, 1005–1009 (2024) k⊥ scaling at small k⊥ in Fig. 2. When rotationdominated scales are reached at 2Wk∥ ≃ Nk⊥ (black dotted line), QG modes transfer their energy to GW modes that cascade it back to small scales. Of the energy that has moved to smaller k⊥, a finite amount is transferred (cyan arrow) below the smallest dashed white line (k2⊥ þ k2∥ ¼ k2H ). The energy in these modes forms the E(k) º k−5/3 spectrum for k < kH. This component of the energy is the only one that escapes to the largest scales k → 0 and corresponds to a true inverse cascade. y increases with Re and saturates at the largest Re. P T (k⊥) is also positive for k⊥ > kH and negative for k⊥ < kH. However, in this case, the fraction of energy that cascades toward smaller k⊥ is five times as large as P T (k). P T (k‖) is positive everywhere. Although in 1D spectra and fluxes it is easier to identify power laws, the energy distribution depends on k‖ and k⊥ independently. In Fig. 3, we show color-shaded plots of ET (k⊥, k‖) and RGW ¼ EGW ðk⊥ ;k∥ Þ=ET ðk⊥ ;k∥ Þ. The arrows indicate the direction of the energy transfers based on the fluxes in Fig. 2. A part of the injected energy is transferred to larger k⊥ (purple arrows), producing the k⊥−3 spectrum observed in the kH < k⊥ < kB range. RGW (k⊥, k‖) indicates that this forward transfer takes place through GW modes (green arrow). The peak of E(k⊥, k‖) is observed at k⊥ ≃ 2kL and k∥ ≃ 2kH , formed by an inverse transfer indicated by the black arrow and dominated by QG modes. This energy is responsible for the formation of the
RES EARCH | R E S E A R C H A R T I C L E , 4 of 5 y 1 March 2024 1. L. Onsager, Nuovo Cim. 6, 279–287 (1949). 2. R. H. Kraichnan, Phys. Fluids 10, 1417–1423 (1967). 3. R. H. Kraichnan, D. Montgomery, Rep. Prog. Phys. 43, 547–619 (1980). 4. C. E. Leith, Phys. Fluids 11, 671–672 (1968). 5. G. K. Batchelor, Phys. Fluids 12, II-233–II-239 (1969). 6. J. G. Charney, J. Atmos. Sci. 28, 1087–1095 (1971). 7. P. H. Roberts, Philos. Trans. Royal Soc. A 263, 93–117 (1968). 8. F. H. Busse, J. Fluid Mech. 44, 441–460 (1970). 9. A. M. Rubio, K. Julien, E. Knobloch, J. B. Weiss, Phys. Rev. Lett. 112, 144501 (2014). 10. B. Favier, L. J. Silvers, M. R. E. Proctor, Phys. Fluids 26, 096605 (2014). 11. L. Siegelman et al., Nat. Phys. 18, 357–361 (2022). 12. J. Vanneste, I. Yavneh, J. Atmos. Sci. 61, 211–223 (2004). 13. J. Vanneste, Annu. Rev. Fluid Mech. 45, 147–172 (2013). 14. J. Thomas, D. Daniel, J. Fluid Mech. 911, A60 (2021). 15. J. Thomas, D. Daniel, J. Fluid Mech. 902, A7 (2020). 16. A. Alexakis, L. Biferale, Phys. Rep. 767–769, 1–101 (2018). 17. L. M. Smith, J. R. Chasnov, F. Waleffe, Phys. Rev. Lett. 77, 2467–2470 (1996). 18. A. Celani, S. Musacchio, D. Vincenzi, Phys. Rev. Lett. 104, 184506 (2010). 19. K. Seshasayanan, S. J. Benavides, A. Alexakis, Phys. Rev. E 90, 051003 (2014). 20. S. J. Benavides, A. Alexakis, J. Fluid Mech. 822, 364–385 (2017). 21. A. Sozza, G. Boffetta, P. Muratore-Ginanneschi, S. Musacchio, Phys. Fluids 27, 035112 (2015). 22. A. van Kan, A. Alexakis, J. Fluid Mech. 899, A33 (2020). 23. R. Marino, P. D. Mininni, D. Rosenberg, A. Pouquet, Europhys. Lett. 102, 44006 (2013). 24. A. Pouquet, R. Marino, Phys. Rev. Lett. 111, 234501 (2013). 25. R. Marino, A. Pouquet, D. Rosenberg, Phys. Rev. Lett. 114, 114504 (2015). 26. D. Byrne, J. A. Zhang, Geophys. Res. Lett. 40, 1439–1442 (2013). 27. G. P. King, J. Vogelzang, A. Stoffelen, J. Geophys. Res. Oceans 120, 346–361 (2015). 28. D. Balwada, J.-H. Xie, R. Marino, F. Feraco, Sci. Adv. 8, eabq2566 (2022). 29. R. Young, P. L. Read, Nat. Phys. 13, 1135–1140 (2017). 30. Materials and methods are available as supplementary materials. 31. J. Pedlosky, Geophysical Fluid Dynamics (Springer, 1987). 32. G. K. Vallis, Atmospheric and Oceanic Fluid Dynamics: Fundamentals and Large-Scale Circulation (Cambridge Univ. Press, 2017). 33. P. D. Mininni, D. Rosenberg, R. Reddy, A. Pouquet, Parallel Comput. 37, 316–326 (2011). 34. H.-L. Liu, P. B. Hays, R. G. Roble, J. Atmos. Sci. 56, 2152–2177 (1999). 35. J. Clyne, P. Mininni, A. Norton, M. Rast, New J. Phys. 9, 301 (2007). 36. G. Nastrom, K. Gage, W. Jasperson, Nature 310, 36–38 (1984). 37. T. VanZandt, Geophys. Res. Lett. 9, 575–578 (1982). 38. P. Billant, J.-M. Chomaz, Phys. Fluids 13, 1645–1651 (2001). 39. H. P. Greenspan, The Theory of Rotating Fluids (Cambridge Univ. Press, 1968). 40. W. C. Skamarock, S.-H. Park, J. B. Klemp, C. Snyder, J. Atmos. Sci. 71, 4369–4381 (2014). 41. K. S. Gage, G. D. Nastrom, J. Atmos. Sci. 43, 729–740 (1986). 42. D. K. Lilly, J. Atmos. Sci. 40, 749–761 (1983). 43. U. Schumann, J. Atmos. Sci. 76, 3847–3862 (2019). 44. J. Callies, O. Bühler, R. Ferrari, J. Atmos. Sci. 73, 4853–4872 (2016). 45. P. D. Mininni et al., Dataset for large-scale self-organisation in dry turbulent atmospheres, version 1.0, Zenodo (2023); https://doi.org/10.5281/zenodo.8091949. 46. D. Rosenberg, P. Mininni, P. C. Di Leoni, pmininni/GHOST: GHOST master, version 2.0.0, Zenodo (2023); https://doi.org/ 10.5281/zenodo.8015308. 47. S. Pearse et al., NCAR/VAPOR: Vapor 3.8.1, version 3.8.1, Zenodo (2023); https://doi.org/10.5281/zenodo.7779648. y g Alexakis et al., Science 383, 1005–1009 (2024) REFERENCES AND NOTES y Fig. 3. 2D energy spectra in log-log scale. White dashed lines indicate isotropic contours (i.e., modes with constant wave number k). The solid white line indicates the maximum resolved wave numbers. (Left) Total energy spectrum. (Right) Gravity wave energy spectrum ratio. The black dotted lines marks 2Wk|| = Nk?, where inertial wave frequency matches gravity wave frequency. The arrows indicate the direction of the flux of energy (see text for a description). vides a link between theory and field observations that can help validate or discard theoretical explanations. g which are not part of our domain. At scales smaller than 500 km, which are considered in our model, and down to ≈10 km, the observed spectrum follows k−5/3 scaling, which agrees with our simulation. The dynamics producing this observed scaling, and whether it originates from a forward or an inverse cascade, have been long debated (40). An inverse cascade acting on those scales was proposed as an explanation (41, 42), but it was later discarded (23, 40) because purely stratified turbulence develops no inverse cascade. Our simulation shows that the combination of a realistic aspect ratio with realistic parameters gives rise to upscaling of energy with a k−5/3 spectrum even at scales as small as 15 km. Although weak, the persistence of the inverse cascade makes a few percent of the flux enough to account for the observed mesoscale energy (42). But unlike the transfer to gravity waves hypothesized by Lilly (42), the inverse transfer we observe feeds the QG modes. At even smaller scales (<10 km), model parameterizations and the lack of observations with simultaneous high spatial coverage and resolution, especially in the upper atmosphere, prevent us from drawing definitive conclusions about spectral slopes and their origins. The spectrum in this range is still anisotropic, displays variability, and is sensitive to atmospheric conditions and to the local energy dissipation rate (43). It is difficult to make direct comparisons with the simulation in this range, but some common features can be identified, such as the prevalence of gravity waves and the occurrence of two horizontal Kolmogorov subranges above 10 km and below 1 km with different amplitudes mediated by a steeper spectrum, as has sometimes been reported in observational campaigns (43, 44). Our work presents a spectral energy distribution from the mesoscales down to the smallest turbulent scales as a direct outcome of the physical mechanisms in the model and the parameter range examined. As such, it pro- p larger k. This is true for all k except for the k‖ = 0 modes that are unaffected by rotation. These modes, which follow 2D dynamics, cascade the energy to ever smaller k⊥. Their stability against 3D perturbations is assured by rotation and the finiteness of H that leads to the k‖ = 0 modes being isolated (16). As a result, they cascade energy to ever smaller k⊥ with no channel to return this energy back to the small scales. An important outcome from this picture is that energy fluxes obtained from horizontal averages can significantly overestimate the inverse energy flux. In the presently examined simulation, P T(k⊥) was five times as large as the true inverse flux P T(k). This result limits the observational estimates of P T(k). Most present estimates of the inverse flux are based on averages of 2D slices obtained by satellite images. They thus contain no information on the fields’ variations in the third direction, and as a result, it is P T(k⊥) that is measured and not P T(k), which represents the true inverse flux. As a reference, and for comparisons with observations, we provide as supplementary materials [fig. S1 (30)] spectra and third-order structure functions along horizontal tracks, such as those resulting from airplane or satellite measurements. The structure functions display a change in sign indicative of an inverse cascade but overestimate the inverse flux, just as horizontal averages do. Thus, these estimates of the inverse flux could be significantly larger than their true values. Although our model is not designed to capture the full complexity of Earth’s atmosphere, which also has energy sources at planetary scales larger than our computational domain, it reproduces some known features in the mesoscale range. Global models indicate that the atmospheric spectrum varies with altitude, with observations showing that planetary and synoptic scales follow a k−3 spectrum at scales larger than 500 km. This is attributed to a direct cascade originating at planetary scales,
RES EARCH | R E S E A R C H A R T I C L E ACKN OW LEDG MEN TS We thank an anonymous reviewer for the suggestion to calculate data along horizontal tracks, allowing for comparisons with observational data. The simulation output was analyzed on HPC facilities at the École Normale Superieure in Paris (France), at École Centrale de Lyon (PMCS2I) in Ecully (France), and at Departamento de Fisica (FCEN, UBA) in Argentina. Funding: Computer resources in Joliot-Curie at CEA were provided by PRACE (research project ID 2020235566) and by GENCI (allocation no. A0110506421). This work was supported by the projects “DYSTURB” (no. ANR-17-CE30-0004) and “EVENTFUL” (no. ANR-20-CE30-0011) funded by the French Agence Nationale de la Recherche (ANR), by the Studienstiftung des deutschen Volkes, by the National Science Foundation (grants DMS-2009563 and DMS-2308337), and by the German Research Foundation (no. 522026592). Author contributions: A.A., R.M., P.D.M., and A.v.K. conceived and planned the numerical experiments and wrote the manuscript with input from all authors. A.A. and P.D.M. performed necessary modifications to the GHOST code. A.A. and A.v.K. performed the computations. R.F. and F.F. performed visualizations. All authors analyzed the data and discussed the results. Competing interests: The authors declare that they have no competing interests. Data and materials availability: Data in all figures are available in the supplementary materials and on Zenodo (45). The GHOST code used for the simulations is available on Zenodo (46). 3D renderings were done with VAPOR, which is available on Zenodo (47). License information: Copyright © 2024 the authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original US government works. https://www.science.org/about/sciencelicenses-journal-article-reuse SUPPLEMENTARY MATERIALS science.org/doi/10.1126/science.adg8269 Materials and Methods Supplementary Text Fig. S1 References (48–56) Movie S1 Submitted 24 January 2023; accepted 12 January 2024 10.1126/science.adg8269 p g y y g y , Alexakis et al., Science 383, 1005–1009 (2024) 1 March 2024 5 of 5
RES EARCH RIVER FLOW Anthropogenic climate change has influenced global river flow seasonality Hong Wang1,2, Junguo Liu1,3,4*, Megan Klaar2, Aifang Chen1, Lukas Gudmundsson5, Joseph Holden2 Riverine ecosystems have adapted to natural discharge variations across seasons. However, evidence suggesting that climate change has already impacted magnitudes of river flow seasonality is limited to local studies, mainly focusing on changes of mean or extreme flows. This study introduces the use of apportionment entropy as a robust measure to assess flow-volume nonuniformity across seasons, enabling a global analysis. We found that ~21% of long-term river gauging stations exhibit significant alterations in seasonal flow distributions, but two-thirds of these are unrelated to trends in annual mean discharge. By combining a data-driven runoff reconstruction with state-of-the-art hydrological simulations, we identified a discernible weakening of river flow seasonality in northern high latitudes (above 50°N), a phenomenon directly linked to anthropogenic climate forcing. 1 March 2024 1 of 6 , Wang et al., Science 383, 1009–1014 (2024) For better interpretation of seasonal variations, AE trends were combined with annual mean river flow trends (fig. S3A) to divide stations into six types (Fig. 2). For each station, we define low-flow months as the three calendar months with the lowest long-term monthly mean river flow, whereas high-flow months are the three calendar months with greatest monthly mean flow. Therefore, trends in lowand high-flow months (TLH) contribute to annual mean and seasonal variations of river flow. We found seasonal variations in the northern high latitudes to be dominated by increasing low flows and decreasing high flows (L+H−; increasing trends of low flows and decreasing trends of high flows), accounting for ~46% of sites, and increasing low flows (L+H*; increasing trends of low flows and nonprominent changes in high flows) solely accounting for ~14%. These two patterns result in a significant decrease in RFS with no significant annual mean trends (L+H−) or significantly y *Corresponding author. Email: liujg@sustech.edu.cn The northern high latitudes (above 50°N) showed discernible weakening in the seasonal cycle of river flow [increasing AE (fig. S1)] (Fig. 1). In northern North America (N. NA), ~40% of stations showed significantly decreasing RFS (P < 0.05). In comparison, only ~2% showed significantly increasing trends of RFS. Similar re- y g Changes in the trend of river flow seasonality School of Environmental Science and Engineering, Southern University of Science and Technology, Shenzhen 518055, China. 2 water@leeds, School of Geography, University of Leeds, Leeds LS2 9JT, UK. 3North China University of Water Resources and Electric Power, Zhengzhou 450046, China. 4Henan Provincial Key Lab of Hydrosphere and Watershed Water Security, North China University of Water Resources and Electric Power, Zhengzhou 450046, China. 5Institute for Atmospheric and Climate Science, ETH Zürich, 8092 Zürich, Switzerland. y 1 Monthly high- and low-flow changes mediate seasonality g is growing evidence that ACC has influences on seasonal river flow, as indicated by climate and hydrological model simulations (14, 15). Moreover, human-induced seasonal changes were detected in the western United States (16). However, the question of whether ACC is detectable in the magnitude of RFS at global scales remains unanswered, and it is challenging to transfer the evidence across regions, as river flow may vary locally because of atmospheric, oceanic, and terrestrial modulation (17). In this study, we used in situ observations of monthly average river flow (18) from 10,120 gauging stations with either a minimum data length of 35 years or uncertainty-controlled shorter records from 1965 to 2014. In addition, we used recently published datasets of observation-based global gridded runoff (GRUN) reconstructed from data-driven models calibrated with observations to achieve global-scale coverage (19). Multimodel results from the InterSectoral Impact Model Intercomparison Project phase 2b (ISIMIP2b) are presented for detecting and attributing observed changes to human influences on the climate system (20). To inform our global analysis of seasonal flow regimes, a generalized seasonality index was developed by using apportionment entropy (AE) (21). AE nonparametrically quantifies how evenly flow rates are distributed across months; high AE indicates a uniform distribution (low RFS), and low AE points to large month-to-month differences (high RFS). AE can be used to characterize changes in a hydroclimatological context because it is statistically well suited to the characteristics of highly variable flow regimes (21, 22). p A nthropogenic climate warming, which could drive changes in the hydrological cycle, has received increasing attention (1). Water availability, a key concern, is directly related to ecosystem functions and societal interactions (2, 3). However, human activities are altering river flow patterns worldwide, both directly through flow regulations and indirectly through land-use change and the impacts of anthropogenic climate change (ACC) on air temperature, precipitation, soil moisture, and snowmelt regimes (4–6). Consequently, more than two-thirds of the world’s rivers have been altered even without considering the indirect impacts from ACC, which is characterized by human-induced alterations in greenhouse gases and aerosols (7). River flow seasonality (RFS) plays a critical role in floods and droughts, threatening water security and freshwater biodiversity (4, 8). For example, a substantial portion of the early meltwater from snowpack depletion may ultimately flow into oceans without being available for human use (9). In addition, weakening RFS (e.g., flood frequency reduction) can greatly simplify community-wide riparian plant networks (10, 11). Riparian vegetation subsequently influences freshwater biota to make seasonal use of riparian areas and floodplains for feeding or breeding purposes (12). Recent studies have shown a tendency for changes in RFS from timing or magnitude perspectives (5, 6, 13). However, these studies either lack global representativeness or fail to consider the impact of ACC explicitly. Nonetheless, there sults were also observed in south Siberia (S. SI), with ~32% of stations showing significantly decreasing seasonality and only ~1% of stations showing significantly increasing seasonality. We further found a comparable pattern in Europe (EU), with ~19% of the stations experiencing significantly decreasing RFS, mainly located in northern Europe (N. EU), western Russia (W. RU), and the European Alps, whereas ~4% showed significantly increasing RFS, mainly concentrated downstream of the Alps (Fig. 1C). In addition, regions in the contiguous United States (CONUS) present predominantly decreasing trends of RFS overall, except for rivers in the Rocky Mountains and Florida in the western and eastern CONUS, respectively. In central North America (C. NA), significantly decreasing RFS trends account for ~18% of stations, in contrast with 4% that show significantly increasing RFS trends (Fig. 1D). W. RU, upper Midwest (U. Midwest), and S. SI display greater changes in magnitude for RFS trends. Although more than half of the stations in the northern high latitudes showed no statistically significant (P > 0.05) trends, both the significant and nonsignificant trends tell the same story, that is, RFS decreased in the northern high latitudes. Contrary to the above results, increasing RFS was observed in ~25% of the stations in southeast Brazil (S. BR) versus ~4% with decreasing RFS. Global patterns in seasonality trends during the more recent period of 1970 to 2019 generally agree with the trends computed for the 1965 to 2014 time frame (fig. S2). However, it should be noted that some spatial resolution was lost when we used the 1970 to 2019 time window, for example, in W. RU, because data are not available for a sufficient length of time.
RES EARCH | R E S E A R C H A R T I C L E p g To understand the change of RFS trends regionally, we focused on annual mean and monthly river flow trends and normalized flow regimes in nine hotspots (fig. S5). Increasing trends were most pronounced in low-flow months, except in S. BR, which was in agreement with a large proportion of L+H− and L+H* stations (Fig. 2). This suggests that the upper limit of the environmental flow envelopes is increasingly being exceeded during low-flow months in high latitudes (26). To interpret the potential mechanism of RFS trends, we chose subspaces of nine hotspots for a finer analysis (fig. S6). In snowmelt-dominated regions, decreasing snow fraction corresponding to snow-rain transition and snowpack depletion plays a more important role in shaping RFS than precipitation. Warmer temperatures can deplete snowpacks, contributing to greater frequency of high-flow events and lower frequency of low-flow events prior to the normal flood season, and hence reducing monthly differences in river flow (5, 23). Early spring greening, closely related to early spring snowmelt, 2 of 6 , 1 March 2024 Regional seasonality changes and potential mechanisms y Wang et al., Science 383, 1009–1014 (2024) flow variations (L*H+ and L*H−; ~9%), highlighting the key role that low-flow changes played in the AE shifts. Trends of annual low and high flows were analyzed separately (fig. S4), supporting our findings that increasing river flow in low-flow months is contributing to weakening RFS in the snowmelt-dominated areas. Our results are consistent with those of other studies that have explored seasonal trends at regional scales. For example, earlier timing and reduced flood magnitude have been observed in N. EU, W. RU, and the European Alps (5, 6). Previous studies also support findings of stations facing increasing RFS. For instance, the frequency of low-flow events increased in the low-flow season (23), corresponding to the spreading of L−H+ and L−H* categories. In the Rocky Mountains region (CONUS), early snowmelt can reduce river flow in lowflow months owing to less extensive spring snow cover (L−H*), which aligns with (11). Moreover, stations characterized by L−H+, such as those in S. BR, suggest a high risk of hazards from both drought and flood events, which aligns with (24, 25). y g increasing annual mean trends (L+H*). The distribution of the two patterns agrees with broad-scale climate trends in snowmelt-dominated regions (N. NA, N. EU, W. RU, S. SI, higher-elevation European Alps, U. Midwest, and northeast CONUS) (Fig. 2). Out of 1137 stations in the snowmelt-dominated areas (Fig. 2A, gray regions), 979 were experiencing significant weakening of RFS. Around 30% of river gauges displayed significantly increasing RFS and prominent low-flow decreases, herein represented as L−H* (~12%) and L−H+ (~18%), such as in Florida and the Rocky Mountains in the CONUS, lower catchments of the European Alps, and S. BR. A smaller number of sites experienced changes in high-flow months, including L*H+ (~2%) and L*H− (~8%), suggesting that high flows alone play a minor role in influencing RFS trends. Overall, most stations showed L+H− and L−H+ (~65%), indicating that low and high flows interact to affect seasonality and mask annual mean trends of river flow (fig. S3B). Moreover, the proportion of sites (L−H* and L+H*; ~26%) where low-flow variations are the predominant factor is double that of high- (P < 0.05, hatched) and nonsignificant (P > 0.05, solid) trends, corresponding to the direction of increasing (green) and decreasing (brown) RFS trends in five boxed regions. (C and D) Subareas in (C) EU and (D) C. NA that were dominated by the same AE change direction are delimited by dashed gray lines: N. EU, W. RU, the high-elevation European Alps, Pacific Northwest, upper Midwest, and northeast CONUS. Significance was estimated by the Mann-Kendal trend test. y Fig. 1. RFS trends represented by AE (% decade−1) over 50 years (1965 to 2014). (A) Map shows stations with significant RFS trends (P < 0.05); green represents increasing RFS and decreasing AE trends, and brown represents decreasing RFS and increasing AE trends. Stations with nonsignificant changes (P > 0.05) are represented by smaller gray dots. The five boxes mark the regions of interest: N. NA, EU, S. SI, C. NA, and S. BR. (B) Pie charts show the distribution of significant
RES EARCH | R E S E A R C H A R T I C L E p Fig. 2. Classification of potential reasons for changes in RFS. (A) Spatial distribution of TLH indicated by change directions of AE and annual mean river flow (NS, not significant). *, no predominant changes of low or high flows. Labels show illustrations of flow-regime changes from period t1 to t2, corresponding to six types of TLH. Regions where snow fraction in precipitation was >0.2 are shown in gray as snowmeltdominated areas. The five boxes mark the regions of interest: N. NA, EU, S. SI, C. NA, and S. BR. (B) Pie charts show the proportion of TLH in the five boxed regions in (A). (C and D) Subareas in (C) EU and (D) C. NA with the same AE change direction are delimited by dashed gray lines: N. EU, W. RU, the high-elevation European Alps, Pacific Northwest, upper Midwest, and northeast CONUS. g Climate change detection and attribution analysis of RFS trends 3 of 6 , 1 March 2024 y To investigate whether ACC has caused the consistent decreasing trends of RFS in northern high latitudes, we augmented the assessment of in situ observations with an analysis of the GRUN to obtain a comprehensive spatial and temporal representation of RFS trends (19). The reconstructed spatial trend patterns of AE were compared with the corresponding trend pattern estimated by a multimodel ensemble mean of 27 simulations from global hydrological models (GHMs) (20). These GHMs considering human water and land use (HWLU) are driven by atmospheric data from climate models that account for historical radiative forcing (HIST) (scenario abbreviated as HIST&HWLU) (20). The simulated trends were consistent with the reconstruction, highlighting that the GHM simulations generally capture the observed changes (Fig. 3, A, B, and D). Simulations from GHMs also showed a general agreement above 50°N that supports the spatial pattern of RFS changes (fig. S7). Some differences are expected between the multimodel mean and observations. For example, the magnitude of AE trends was weaker in the multimodel mean. This weaker magnitude is most likely due to the averaging across the ensemble that reduces the effects of internal variability in the climate forcing, whereas the GRUN reconstruction represents a single observed evolution of the system (32). GRUN does not account for the effects of HWLU, which possibly caused some differences in the magnitude of AE trends. In addition, the high uncertainties of GRUN reconstruction and multimodel simulations possibly contribute to the disagreement in the Arctic region of northern Canada. However, the simulated trends in AE that are derived from GHMs that account for HWLU and are driven with atmospheric variables from preindustrial control climate models simulations (Picontrol&HWLU) failed to capture the observed changes (Fig. 3, C and D), indicating that HWLU is not contributing to the weakening pattern of RFS. Analyses from 1970 to 2019 showed the same trends in RFS, indicating that simulations are consistent with observations only when ACC is considered (figs. S8 and S9). To quantitatively assess the influence of ACC on the observed spatial pattern and temporal evolution of RFS across northern high latitudes, correlation-based (17, 32, 33) and optimal fingerprinting methods (17, 33, 34) were used to test against the null hypothesis that there is no detectable pattern of AE trends in the observations resulting from ACC. The correlation approach uses all available AE trends and y g Wang et al., Science 383, 1009–1014 (2024) The reason for the difference between results may be due to varied El Niño Southern Oscillation (ENSO) impacts in different study periods (31). Temperature anomalies in ENSO phases strongly influence precipitation and snow accumulation and in turn affect spring and summer river flow. y can exacerbate soil moisture deficits in spring and summer [high-flow months in snowmeltdominated areas; e.g., the Alps (fig. S6)] (27). This can indirectly dampen river flow regimes by reducing runoff generation in high-flow months. However, decreasing RFS can also coincide with increasing soil moisture in highflow months [e.g., W. RU (fig. S6)]. More precipitation falling as rain when air temperatures are around freezing is associated with shallower snowpacks and likely increased infiltration resulting from less frozen upper soil layers and therefore leads to a rise in soil moisture and smaller floods in the spring flood season (5). Soil moisture initially decreased before increasing in N. NA, northeast CONUS, and S. SI, indicating a shift of primary driving factor (fig. S6). Additionally, permafrost mass loss may continue to generate runoff thereafter [e.g., S. SI (fig. S5E)] (28). Precipitation plays a more important role in RFS in non–snowmelt-dominated regions. For instance, seasonality of precipitation and river flow are positively correlated (table S1; Spearman rank correlation coefficients, r = 0.65) owing to the dominance of rain in the coast of the Pacific Northwest (fig. S6) (23). Similarly, increased RFS is associated with increased precipitation seasonality in S. BR (table S1; r = 0.93) (fig. S6), in agreement with (29). We noticed that most stations in the Pacific Northwest show increasing monthly river flow in the late spring and summer, contradicting the findings of previous studies (fig. S5F) (4, 30).
RES EARCH | R E S E A R C H A R T I C L E p g y y [corrtemporary(HIST, GRUN)] across 50°N to 90°N. Spearman correlations between the multimodel mean from HIST&HWLU simulations and 216 chunks of Picontrol simulations with 50-year segments are shown as an empirical probability density function in gray. Vertical blue lines mark the 95 and 99% cumulative probabilities of an assumed normal distribution for the correlations. (Inset) The confidence interval of the scaling factor plot from optimal fingerprinting method with an uncertainty range of 0.5 to 99.5%. A signal was detected if the lower confidence bound was >0 (the solid line). The amplitude of the mean response was consistent with the observations if the confidence interval included 1 (the dashed line). The RCT passed (P > 0.1), indicating the consistency between the regression residuals and the modelsimulated variability. y g Fig. 3. Comparison of AE trends from observation-based reconstructions and global hydrological models for 1965 to 2014 (% decade−1) in the northern high latitudes (above 50°N). (A) Reconstruction from GRUN. (B and C) Simulated changes based on the multimodel mean that account for HWLU under the effects of either HIST (B) or Picontrol (C). Areas with annual precipitation <100 mm and Greenland are masked in gray. (D) Multimodel (mdl) mean time series of annual AE anomalies for HIST&HWLU and Picontrol&HWLU responses and GRUN observations averaged for the northern high latitudes (above 50°N). The red spread is ensemble standard deviation of HIST&HWLU, and thin gray lines are 27-model results of Picontrol&HWLU. (E) Correlations of AE anomalies between simulations with and without ACC [corrtemporary(Picontrol, HIST)] or observation-based reconstruction , anomalies of simulations under HIST&HWLU and Picontrol (table S2). The spatial correlations between HIST simulations and a large ensemble of the Picontrol simulations were calculated from the multimodel simulation mean of AE trends forced with HIST and every chunk (216 estimates) of AE trends with Picontrol conditions (fig. S10). There was a 95% probability that the spatial Spearman correlations between multimodel mean of HIST simulations and GRUN [corrspatial(HIST, GRUN)] were greater than what was expected from Picontrol simulations [corrspatial(Picontrol, HIST]). This strongly suggests that ACC is the underlying cause for the spatial pattern of RFS. In addition, the temporal correlation of AE anomalies between Wang et al., Science 383, 1009–1014 (2024) multimodel mean of HIST simulations and GRUN [corrtemporary(HIST, GRUN)] was larger than for all correlations from Picontrol versus HIST [corrtemporary(Picontrol, HIST)] at 99% confidence level (Fig. 3E). These findings further confirm that human-induced emissions contribute to the decrease in RFS in the northern high latitudes. An additional test used regularized optimal fingerprinting (34). Observations (y) are regressed on the multimodel mean of the simulation forced with HIST&HWLU (x) while considering sampling error v and natural variability derived from Picontrol&1860soc (e): y = b (x–v) + e. The inset in Fig. 3E displays the scaling factor b above zero at 99% con- 1 March 2024 fidence level in the experiment of HIST, suggesting that the simulations capture the observed AE changes when human-influenced climate changes are considered. Furthermore, the confidence interval of scaling factor b under HIST includes one, which implies that the magnitude of the simulated trend is consistent with the observations. Moreover, a residual consistency test (RCT) did not indicate an inconsistency between the regression residuals and the model-simulated variability (P > 0.1). An overall climate change detection and attribution analysis for 1970 to 2019 provided further evidence that human-induced emissions continue to contribute to decreased RFS in the northern high latitudes (fig. S11). 4 of 6
RES EARCH | R E S E A R C H A R T I C L E 5 of 6 , Funding: This study was supported by the National Natural Science Foundation of China (grant no. 42361144001), the Strategic Priority Research Program of the Chinese Academy of Sciences (grant no. XDA20060402), the Shenzhen Science and Technology Program (KCXFZ20201221173601003), the Henan Provincial Key Laboratory of Hydrosphere and Watershed Water Security, and the School of Geography and water@leeds at the University of Leeds. Author contributions: J.L., H.W., M.K., and J.H. conceived and designed the study. H.W. conducted the analyses and drafted the paper under the supervision of J.L., M.K., and J.H. All authors contributed to data interpretation and provided substantive revisions on the manuscript. Competing interests: The authors declare no competing interests. Data availability: The river flow time series from GSIM can be downloaded from https://doi.org/10.1594/PANGAEA.887470 (46). The runoff reconstruction dataset GRUN is available from y 1 March 2024 AC KNOWLED GME NTS y g 1. P. Wu, N. Christidis, P. Stott, Nat. Clim. Chang. 3, 807–810 (2013). 2. C. J. Vörösmarty, P. Green, J. Salisbury, R. B. Lammers, Science 289, 284–288 (2000). 3. P. C. D. Milly, K. A. Dunne, A. V. Vecchia, Nature 438, 347–350 (2005). 4. N. K. Singh, N. B. Basu, Nat. Sustain. 5, 397–405 (2022). 5. G. Blöschl et al., Nature 573, 108–111 (2019). 6. G. Blöschl et al., Science 357, 588–590 (2017). 7. M. Dynesius, C. Nilsson, Science 266, 753–762 (1994). 8. M. Palmer, A. Ruhi, Science 365, eaaw2087 (2019). 9. T. P. Barnett, J. C. Adam, D. P. Lettenmaier, Nature 438, 303–309 (2005). 10. J. D. Tonkin, D. M. Merritt, J. D. Olden, L. V. Reynolds, D. A. Lytle, Nat. Ecol. Evol. 2, 86–93 (2018). 11. S. B. Rood et al., J. Hydrol. (Amst.) 349, 397–410 (2008). 12. H. L. Bateman, D. M. Merritt, Glob. Ecol. Conserv. 22, e00957 (2020). 13. C. Wasko, R. Nathan, M. C. Peel, Water Resour. Res. 56, e2020WR027233 (2020). 14. S. Eisner et al., Clim. Change 141, 401–417 (2017). 15. K. Marvel et al., Earths Futur. 9, e2021EF002019 (2021). 16. T. P. Barnett et al., Science 319, 1080–1083 (2008). 17. L. Gudmundsson, S. I. Seneviratne, X. Zhang, Nat. Clim. Chang. 7, 813–816 (2017). 18. H. X. Do, L. Gudmundsson, M. Leonard, S. Westra, Earth Syst. Sci. Data 10, 765–785 (2018). 19. G. Ghiggi, V. Humphrey, S. I. Seneviratne, L. Gudmundsson, Earth Syst. Sci. Data 11, 1655–1674 (2019). 20. K. Frieler et al., Geosci. Model Dev. 10, 4321–4345 (2017). 21. X. Feng, A. Porporato, I. Rodriguez-Iturbe, Nat. Clim. Chang. 3, 811–815 (2013). y RE FERENCES AND NOTES 22. G. Konapala, A. K. Mishra, Y. Wada, M. E. Mann, Nat. Commun. 11, 3044 (2020). 23. E. N. Dethier, S. L. Sartain, C. E. Renshaw, F. J. Magilligan, Sci. Adv. 6, eaba5939 (2020). 24. M. R. Viola, C. R. de Mello, S. C. Chou, S. N. Yanagi, J. L. Gomes, Int. J. Climatol. 35, 1054–1068 (2015). 25. D. Bartiko, D. Y. Oliveira, N. B. Bonumá, P. L. B. Chaffe, Hydrol. Sci. J. 64, 1071–1079 (2019). 26. V. Virkki et al., Hydrol. Earth Syst. Sci. 26, 3315–3336 (2022). 27. X. Lian et al., Sci. Adv. 6, eaax0255 (2020). 28. E. Gautier et al., J. Hydrol. (Amst.) 557, 475–488 (2018). 29. V. B. P. Chagas, P. L. B. Chaffe, G. Blöschl, Geophys. Res. Lett. 49, e2021GL096754 (2022). 30. P. W. Mote, S. Li, D. P. Lettenmaier, M. Xiao, R. Engel, NPJ Clim. Atmos. Sci. 1, 2 (2018). 31. D. Lee, P. J. Ward, P. Block, Environ. Res. Lett. 13, 044031 (2018). 32. R. S. Padrón et al., Nat. Geosci. 13, 477–481 (2020). 33. L. Grant et al., Nat. Geosci. 14, 849–854 (2021). 34. A. Ribes, S. Planton, L. Terray, Clim. Dyn. 41, 2817–2836 (2013). 35. B. Arheimer, C. Donnelly, G. Lindström, Nat. Commun. 8, 62 (2017). 36. L. Gudmundsson et al., Science 371, 1159–1162 (2021). 37. IPCC, in Climate Change 2013: The Physical Science Basis (Cambridge Univ. Press, 2013), pp. 659–740. 38. C. E. Iles, G. C. Hegerl, Nat. Geosci. 8, 838–842 (2015). 39. M. Huss, R. Hock, Nat. Clim. Chang. 8, 135–140 (2018). 40. L. Gudmundsson, J. Kirchner, A. Gädeke, J. Noetzli, B. K. Biskaborn, Environ. Res. Lett. 17, 095014 (2022). 41. W. R. Berghuijs, R. A. Woods, M. Hrachowitz, Nat. Clim. Chang. 4, 583–586 (2014). 42. M. G. Floriancic, W. R. Berghuijs, P. Molnar, J. W. Kirchner, Water Resour. Res. 57, e2019WR026928 (2021). 43. M. Mudelsee, M. Börngen, G. Tetzlaff, U. Grünewald, Nature 425, 166–169 (2003). 44. J. D. Hunt et al., Nat. Commun. 11, 947 (2020). 45. N. L. Poff, J. D. Olden, D. M. Merritt, D. M. Pepin, Proc. Natl. Acad. Sci. U.S.A. 104, 5732–5737 (2007). 46. L. Gudmundsson, H. X. Do, M. Leonard, S. Westra, The Global Streamflow Indices and Metadata Archive (GSIM) - Part 2: Time Series Indices and Homogeneity Assessment, PANGAEA (2018); https://doi.org/10.1594/PANGAEA.887470. 47. G. Ghiggi, L. Gudmundsson, V. Humphrey, G-RUN: Global Runoff Reconstruction, Figshare, version 2, (2019); https://doi.org/10.6084/m9.figshare.9228176.v2. 48. U. Schneider, S. Hänsel, P. Finger, E. Rustemeier, M. Ziese, GPCC Full Data Monthly Product Version, 2022 at 2.5°: Monthly Land-Surface Precipitation from Rain-Gauges built on GTS-based and Historical Data, Deutscher Wetterdienst, (2022); https://doi.org/10.5676/DWD_GPCC/ FD_M_V2022_250. 49. M. Cucchi et al., Near surface meteorological variables from 1979 to 2019 derived from bias-corrected reanalysis, Copernicus Climate Change Service (C3S) Climate Data Store (CDS), version 2.1, (2020); https://doi.org/ 10.24381/cds.20d54e34. 50. J. Muñoz Sabater, ERA5-Land hourly data from 1950 to present, Copernicus Climate Change Service (C3S) Climate Data Store (CDS), (2019); https://doi.org/10.24381/ cds.68d2bb30. g Wang et al., Science 383, 1009–1014 (2024) ACC is acknowledged to far surpass natural forcing in dominating a warming future (37). Our findings present changes in the seasonal cycles of river flow by adapting an AE perspective and clearly demonstrate that decreased RFS is attributable to ACC in the northern high latitudes. Possible climatic mechanisms that might drive flow-regime dampening under ACC include early snowpack depletion (23), loss of glacier extent (39), permafrost loss (40), increasing proportion of precipitation as rainfall (41), and shorter freezing periods (42, 43) interacting with ocean-atmosphere oscillations (31). Depending on the region, some of these drivers can be more important than others in explaining RFS changes. This study provides a standpoint for understanding changing seasonal patterns of river flow. There is an increasing need for accelerated climate adaptation efforts to safeguard freshwater ecosystems, achieved through, for example, use of managed environmental flows (8). Additionally, these efforts are essential for establishing sustainable water resource management by identifying and mitigating risks related to flood and drought, exploring seasonal storage opportunities, and optimizing allocations for irrigation or hydropower generation (4, 44). It should be noted that water management might synergistically contribute to RFS dampening (35, 45). Therefore, it is essential to develop mitigation strategies and adaptation planning to alleviate the future homogenization of seasonal river flow, particularly in locations such as European Russia, Scandinavia, and Canada. p The primary climate change detection and attribution assessment that focuses on the northern high latitudes to optimize the signalto-noise ratio is complemented with regional assessment (fig. S12). Changes of RFS were captured with 10 to 90% confidence intervals in Alaska, northern Europe, and northern Asia, defined by the Intergovernmental Panel on Climate Change Special Report on Extreme Events, only if ACC is considered. These results confirm the robustness of our conclusions regarding the influence of ACC on the temporal evolution of RFS in the northern high latitudes. Seasonality changes were also detected by model simulations that account for anthropogenic emissions in central America, southern Africa, and east Asia. This finding implies that human-induced emissions potentially exert an influence on the seasonality of monsoon precipitation and consequent runoff dynamics. We acknowledge that human interference, such as flow regulation through reservoirs, may also contribute to RFS changes (35). Notably, however, more than three-fifths of the in situ observations, which are free from reservoir flow regulation (located in the subbasins with zero degree of regulation), exhibited the same spatial pattern of RFS trends as identified in our global dataset (fig. S13). Moreover, an observational reconstruction runoff derived from GRUN, which is free from human interference (including reservoirs, human water management, and land-use change), demonstrated a similar trend to that observed at the stations, though with smaller magnitudes of RFS trends (fig. S14). Additionally, simulations replicating preindustrial climate conditions but considering historical human activities (Picontrol&HWLU) failed to reproduce the trend of RFS in the northern high latitudes. Combining the climate change detection and attribution analysis for grid cells where direct observation data are available robustly showed that ACC contributes to the weakening of RFS in the northern high latitudes (fig. S15). We note that historical natural climate forcing (i.e., solar and volcanic activity) was not excluded when using ISIMIP2b to undertake the climate change detection and attribution analysis (36). Nonetheless, natural climate forcing has a limited impact on river flow owing to much smaller solar changes compared with ACC (37) and the short-lived influence of volcanic eruptions (38). Furthermore, no significant trends of precipitation seasonality have been observed in the northern high latitudes, demonstrating that precipitation seasonality change cannot account for our results (fig. S16). It is likely that observed rain-snow transition and increasing snowmelt under global warming led to a weakening trend of RFS in the northern high latitudes (fig. S6 and table S1). The underlying physics behind this assertion is temperature driven rather than precipitation driven, and
RES EARCH | R E S E A R C H A R T I C L E https://doi.org/10.6084/m9.figshare.9228176.v2 (47). The model results are available from the ISIMIP2b project in Water (global) sector (https://www.isimip.org/outputdata/). Other data are presented in the supplementary materials. The streamflow time series from the GRDC are available at https://www.bafg.de/GRDC. The observed monthly GPCC precipitation is available at https:// doi.org/10.5676/DWD_GPCC/FD_M_V2022_250 (48). The CRUTEM5 dataset is available at https://www.metoffice.gov.uk/ hadobs/crutem5/data/CRUTEM.5.0.1.0/download.html. The CPC soil moisture data can be downloaded from https://www.esrl.noaa. gov/psd. The bias-corrected reanalysis of WFDE5 and ERA5 monthly land data can be downloaded from the CDS website [WFDE5, https://doi.org/10.24381/cds.20d54e34 (49); ERA5, https://doi. org/10.24381/cds.68d2bb30 (50)]. License information: Copyright © 2024 the authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original US government works. https://www.science.org/about/ science-licenses-journal-article-reuse SUPPLEMENTARY MATERIALS science.org/doi/10.1126/science.adi9501 Materials and Methods Figs. S1 to S18 Tables S1 to S3 References (51–68) Submitted 28 May 2023; accepted 17 January 2024 10.1126/science.adi9501 p g y y g y , Wang et al., Science 383, 1009–1014 (2024) 1 March 2024 6 of 6
RES EARCH FRAMEWORK MATERIALS Fast growth of single-crystal covalent organic frameworks for laboratory x-ray diffraction Jing Han1, Jie Feng1, Jia Kang1, Jie-Min Chen1, Xin-Yu Du1, San-Yuan Ding1, Lin Liang1,2*, Wei Wang1* The imine-exchange strategy makes single-crystal growth of covalent organic frameworks (COFs) with large size (>15 microns) possible but is a time-consuming process (15 to 80 days) that has had limited success (six examples) and restricts structural characterization to synchrotron-radiation sources for x-ray diffraction studies. We developed a CF3COOH/CF3CH2NH2 protocol to harvest single-crystal COFs within 1 to 2 days with crystal sizes of up to 150 microns. The generality was exemplified by the feasible growth of 16 high-quality single-crystal COFs that were structurally determined by laboratory singlecrystal x-ray diffraction with resolutions of up to 0.79 angstroms. The structures obtained included uncommon interpenetration of networks, and the details of the structural evolution of conformational isomers and host-guest interaction could be determined at the atomic level. 1 of 6 , 1 March 2024 y Han et al., Science 383, 1014–1019 (2024) y g *Corresponding author. Email: wang_wei@lzu.edu.cn (W.W.); lianglin@lzu.edu.cn (L.L.) Initially, we replaced CH3COOH, which has the negative logarithm of the acid dissociation constant (pKa) of 4.76 (23), with a stronger acid, CF3COOH, which has a pKa of 0.23 (23). This change accelerated the imine-exchange process (24–26) for the fast growth of single-crystal COF-300 from the condensation of benzene1,4-dicarboxaldehyde (BDA, 12 mg, 0.089 mmol) and tetrakis(4-aminophenyl)methane (TAM, 20 mg, 0.052 mmol) in 1,4-dioxane (Fig. 2A) (4). When we used CF3COOH (6 M, 0.1 ml) as the catalyst and C6H5NH2 (81 ml, 10 equiv.) as the modulator, COF-300 was rapidly crystallized as uniform rodlike crystals with the average size of 10 mm in 2 hours (Fig. 2D and scheme S1). However, the crystal size could not be further increased by prolonging the reaction time because C6H5NH2 (pKa C6H5NH3+ = 4.62) (23) was not a suitable nucleation inhibitor when CH3COOH was replaced by CF3COOH as a more acidic catalyst (table S1). Accordingly, we screened a series of organic bases as the compatible modulator (table S2) and optimized the concentration ratios of the acid and the modulator (table S3). We found that, in the presence of CF3COOH (6 M, 0.1 ml) as the catalyst and CF3CH2NH2 (pKa CF3CH2NH3+ = 5.66, 70 ml, 10 equiv.) (23) as the modulator, single-crystal COF-300 could be harvested within 2 days (Fig. 2A and scheme S2) with the uniform size of 60 mm by 30 mm by 30 mm (Fig. 1B and Fig. 2E). The growth rate of single-crystal COF-300 reached 1.25 mm/hour, which is 21 times as fast as the rate of 0.06 mm/hour previously reported (Fig. 2C). Using a laboratory single-crystal x-ray diffractometer, we could detect the nascent COF-300 and the hydrated COF-300 (COF-300-H2O), and the single-crystal structures could be directly solved as sevenfold-interpenetrated dia-c7 topology (13, 27) and anisotropically refined with resolutions of 0.83 and 0.81 Å (tables S4 and S5), respectively. y State Key Laboratory of Applied Organic Chemistry, Lanzhou Magnetic Resonance Center, College of Chemistry and Chemical Engineering, Lanzhou University, Lanzhou, Gansu 730000, China. 2Institute of Nanoscience and Nanotechnology, School of Materials and Energy, Lanzhou University, Lanzhou, Gansu 730000, China. Fast synthesis of known COF single crystals g 1 and dynamic nature of COFs at the atomic level. p C ovalent organic frameworks (COFs) are extended porous crystals formed by the reaction of organic precursors as building blocks, which form two-dimensional (2D) or 3D arrays (1–10). Under typical conditions, the reaction products are small crystallites (powders). The growth of high-quality COF single crystals (11–22) must avoid misassembly of the building blocks. Specifically, the growth of large-sized (>15-mm) single-crystal COFs amenable for x-ray diffraction (XRD) analysis usually requires slow crystallization (at least 15 days) (13). In our previous studies, to construct imine-linked single-crystal COFs from covalent polymerization of amines and aldehydes (13, 16), we employed acetic acid (CH3COOH) as the catalyst and aniline (C6H5NH2) as the modulator. The use of aniline has efficiently converted COF crystallization from imine formation to imine-exchange reactions (Fig. 1A). This approach yielded single-crystal COFs suitable for XRD studies with sizes of 15 to 100 mm but required growth times of 15 to 80 days. In this study, we report the fast synthesis of large-sized single-crystal COFs. In the presence of 2,2,2-trifluoroacetic acid (CF3COOH) as the catalyst and 2,2,2- trifluoroethylamine (CF3CH2NH2) as the modulator, 16 different COFs with crystal sizes ranging from 50 to 150 mm were synthesized in 1 to 2 days (Fig. 1B). The quality of these single crystals was enough for their single-crystal structures to be directly determined by laboratory XRD with resolutions up to 0.79 Å. These high-resolution XRD data revealed the indeterminate topology, conformational evolution, host-guest interaction, Using the CF3COOH/CF3CH2NH2 protocol, we successfully synthesized the previously reported single-crystal COFs (13, 16)—LZU-111, LZU-79, COF-303, and LZU-306—as high-quality single crystals within 2 days (Fig. 1B and schemes S3 to S6). The sizes of LZU-111 (~50 mm) and LZU-79 (~100 mm) obtained were comparable to those achieved previously but required 25 to 40 days for synthesis. The sizes of COF-303 (~100 mm) and LZU-306 (~150 mm) were larger than those previously reported (~15 mm in 15 days for COF-303 and ~50 mm in 25 days for LZU-306). Taking the noninterpenetrated pts-structured LZU-306 (Fig. 2B) as the example, similar to the case of COF-300, the crystallization of LZU-306 occurred rapidly with the CF3COOH/C6H5NH2 protocol (Fig. 2F) but resulted in irregular crystals of poor quality. Using the CF3COOH/ CF3CH2NH2 protocol, after 4 hours, crystallization led to the appearance of uniform microcrystals with the size of ~10 mm that could be observed with optical microscopy. After 12 hours, the crystal size reached ~30 mm (Fig. 2F and fig. S85). After 36 hours, large single crystals (150 mm by 100 mm by 100 mm) had grown (Fig. 2F and fig. S87). The growth rate reached 4.17 mm/hour, which is 52 times as fast as that previously reported for the CH3COOH/C6H5NH2 protocol (0.08 mm/hour) (Fig. 2C). We obtained XRD data with a resolution of 1.15 Å with the laboratory light source. The noninterpenetrated single-crystal structure of LZU-306 was directly solved, and all of the nonhydrogen atoms could be anisotropically refined. In the previous work, the resolution for the XRD data reached 1.80 Å (16) with a synchrotronradiation light source, and the direct determination of the single-crystal structures was unattainable. We further verified the generality of this CF3COOH/CF3CH2NH2 protocol by rapidly growing COF structures as high-quality single crystals. The increase in the growth rate enabled us to optimize the experimental conditions efficiently. As a result, 10 different single-crystal COFs were harvested by simple screening of the suitable solvents and the equivalent of CF3CH2NH2 (Fig. 1B, scheme S5, and schemes S8 to S12). The single crystals reached sizes of 60 to 150 mm in 1 to 2 days. Structures from laboratory XRD were directly solved and refined with resolution of up to 0.79 Å (tables S8 to S19). Among these structures, we found an uncommon 3D framework with the complicated fourfold [2+2]–interpenetrated pts structure (Fig. 3). We also followed the structural evolution among a series of conformational COF isomers that directly correlated with the subtle changes in the local conformation of the linkages (Fig. 4 and fig. S31). Lastly, we accurately located guest molecules within the pores and further evaluated host-guest interactions in COFs (Fig. 5 and fig. S31).
RES EARCH | R E S E A R C H A R T I C L E p g y y g y , Fig. 1. Fast growth of large-sized single-crystal COFs. (A) Imine-exchange strategy that used CH3COOH/C6H5NH2 in the previous work for the growth of single-crystal COFs in 15 to 80 days. (B) Protocol developed using CF3COOH/ CF3CH2NH2 in this work for fast growth of single-crystal COFs in 1 to 2 days. The optical microscopic images for 16 kinds of single-crystal COFs obtained in 1 to 2 days with sizes of 50 to 150 mm are shown. Diversified monomers used in this study for the growth of single-crystal COFs are as follows: TAM, Unknown COF structures revealed by CF3COOH/CF3CH2NH2 protocol The CF3COOH/CF3CH2NH2 protocol revealed three previously unknown single-crystal COFs with the isoreticular pts topology that were Han et al., Science 383, 1014–1019 (2024) 1 March 2024 tetrakis(4-aminophenyl)methane; ADA-CHO, adamantane-1,3,5,7tetracarbaldehyde; ADAT-CHO, 1,3,5,7-tetrakis(4-formylphenyl)adamantane; TFM, tetrakis(4-formylphenyl)methane; TFS, tetrakis(4-formylphenyl)silane; BDA, benzene-1,4-dicarboxaldehyde; DABP, 4,4′-diaminobiphenyl; PDA, phenylenediamine; BFBZ, 4,7-bis(4-formylbenzyl)-1H-benzimidazole; TPE-NH2, tetrakis(4-aminophenyl)ethene; TPB-NH2, 1,2,4,5-tetrakis(4-aminophenyl) benzene; and TPE-CHO, tetrakis(4-formylphenyl)ethene. synthesized in 1 day (Fig. 1B and Fig. 3A). LZU-308, constructed from adamantane1,3,5,7-tetracarbaldehyde (ADA-CHO) and 1,2,4,5-tetrakis(4-aminophenyl)benzene (TPBNH2), was crystallized with the size of ~60 mm in 1 day (scheme S8). LZU-309, formed by TAM and tetrakis(4-formylphenyl)ethylene (TPE-CHO), was crystallized with the size reaching ~80 mm in 1 day (scheme S9). LZU-307, produced by 1,3,5,7-tetrakis(4-formylphenyl) 2 of 6
RES EARCH | R E S E A R C H A R T I C L E p g ~10 mm–sized COF-300 obtained with the CF3COOH/C6H5NH2 protocol. (E) The SEM image of ~60 mm–sized COF-300 obtained with the CF3COOH/CF3CH2NH2 protocol. (F) Average sizes of single-crystal LZU-306 along with the reaction time obtained by using the CF3COOH/CF3CH2NH2 (red dots, figs. S85 to S87), CH3COOH/ C6H5NH2 (black filled dots), and CF3COOH/C6H5NH2 (black empty dots, fig. S84) protocols. y Fig. 2. Fast growth of single-crystal COF-300 and LZU-306. (A and B) Fast growth of single-crystal COF-300 in 2 days and LZU-306 in 1.5 days with the CF3COOH/CF3CH2NH2 protocol. (C) Comparison of the data for the crystallization time, crystal size, growth rate, and resolution of XRD for COF-300 and LZU-306 reported in the previous work (13, 16) and in this work. (D) The SEM image of y g y , Fig. 3. Fast growth of pts-structured single-crystal LZU-308, LZU-309, and LZU-307 with the CF3COOH/CF3CH2NH2 protocol. (A) Growth of single crystals of noninterpenetrated LZU-308, twofold-interpenetrated LZU-309, and fourfold [2+2]–interpenetrated LZU-307 in 1 day. (B) Crystal structures and topological structures of LZU-307 viewed along the c axis and b axis. Han et al., Science 383, 1014–1019 (2024) 1 March 2024 3 of 6
RES EARCH | R E S E A R C H A R T I C L E p g y y g y , Fig. 4. Synthesis and structural analysis of conformational isomers of single-crystal COFs. (A) Fast growth of single-crystal LZU-311, COF-303, and LZU-310 within 2 days. (B) The space groups, unit-cell parameters, unit-cell volumes, and linkage conformations of the single-crystal isomers. (C) Single-crystal structures and skeleton geometries of COF-303, COF-303-p, COF-303-a, and COF-303-BnOH. The bottom illustrations show the angle of the tetrahedral node and the length of the linker in each structure. adamantane (ADAT-CHO) and tetrakis(4aminophenyl)ethene (TPE-NH2), was crystallized with the size of ~80 mm in 1 day (scheme S10). We used tetrahydrofuran as the universal solvent for the growth of single-crystal COFs with high quality. Laboratory XRD analysis directly identified the structures of LZU-308, Han et al., Science 383, 1014–1019 (2024) 1 March 2024 LZU-309, and LZU-307 as non-, twofold-, and fourfold-interpenetrated pts frameworks (Fig. 3A and figs. S10, S12, and S14), respectively. These results served as the experimental evidence that the degree of interpenetration in COFs could be progressively increased with the elongation of the linkers (28). Crystallized with a rhombohedral morphology, LZU-307 had an uncommon fourfold [2+2]–interpenetrated structure. The space group of LZU-307 was determined as Cmma, with unit-cell parameters of a = 21.947(3) Å, b = 33.671(6) Å, and c = 23.432(3) Å (numbers in parenthesis are the error in the last digit) and a large unit-cell volume 4 of 6
RES EARCH | R E S E A R C H A R T I C L E Fig. 5. Host-guest structure of single-crystal COF-303-BnOH. (A) Singlecrystal structure of COF-303-BnOH, viewed from the c axis. (B) Arrangement of BnOH molecules in the COF-303 channels. The dashed lines in red and blue represent the O–H‧‧‧O and C–H‧‧‧p distances between the adjacent BnOH 5 of 6 , It has been acknowledged that the nucleation barrier for crystallization could be reduced by adding catalysts into the system (32, 33). The formation of single-crystal COFs in our work was based on covalent polymerization through imine-exchange reactions that can be effectively catalyzed by acids (25). When CH3COOH was replaced with the stronger acid, CF3COOH, the growth rates of single-crystal COFs were significantly enhanced (83 and 57 times for COF-300 and LZU-306, respectively, table S1). Its synergy with CF3CH2NH2 as the compatible modulator ensured the universal harvest of large-sized (50- to 150-mm) single crystals of 3D COFs with high quality in 1 to 2 days. We further found that the CF3COOH/CF3CH2NH2 protocol also enabled the growth of a 2D single-crystal COF (34), LZU-115, reaching a size of ~10 mm within 2 days (scheme S13 and figs. S124 and S125). Accordingly, the fast growth of single-crystal COFs for laboratory XRD analysis would probably renew the research paradigm for precise assembly across the length scale through covalent bonding. This finding challenges the traditional belief y 1 March 2024 Discussion y g Han et al., Science 383, 1014–1019 (2024) y The high-resolution XRD data provided key information on the linkage conformation and guest location at the atomic level, through which the structural evolution and dynamic nature of COFs have been clarified. For example, the pores of COF-303 were fully occupied with 1,4-dioxane. The structure was identified as the space group of I41/a with unit-cell parameters of a = b = 25.8651(15) Å and c = 7.7001(6) Å (Fig. 4B and table S12). The adjacent –C=N– and –C=N– linkages exhibited a trans conformation. Upon evaporation at 300 K for 10 min, 1,4-dioxane as the guest molecule was partially removed, resulting in the formation of COF-303-p. The crystal structure changed to the space group of I42d with unit-cell parameters of a = b = host-guest interaction that has been demonstrated in Fig. 5. The conformational transformation triggered by guest molecules was also observed for the ninefold interpenetrated single-crystal COF, LZU-310 (Fig. 4B, fig. S31, and tables S17 to S19). Unlike the case of BnOH as the guest molecule, a dynamic contraction occurred upon the aggregation of water guests within the LZU310 channels. This contraction was caused by the stronger interaction between water molecules and nitrogen atoms of the LZU-310 framework, as visualized by the shorter distance of 1.99 Å (fig. S31, D and E). Accordingly, the XRD information, with high accuracy, not only rendered single-crystal COFs as candidates for crystalline sponge (30, 31) but also provided in-depth understanding of the structural adaptability and responsiveness of dynamic COFs. g Structural transformations and host-guest interactions 23.6776(10) Å and c = 7.9219(4) Å (Fig. 4B and table S13). In this case, the adjacent –C=N– and – C=N– linkages changed to a semi-cis conformation. Upon the complete removal of 1,4-dioxane, the activated COF-303 (COF-303-a) underwent an extensive structural transformation in which adjacent linkages were converted to the cis form [a = b = 20.177(5) Å and c = 8.783(2) Å] (Fig. 4B and table S14). Analysis on the skeleton geometries indicated that, as the angles of the tetrahedral nodes were decreased from 87.6° (COF-303) to 81.0° (COF-303-p) and 66.6° (COF-303-a), the unit-cell volumes decreased from 5151.4(7) to 4441.2(4) and 3576(2) Å3 (Fig. 4, B and C), whereas the lengths of the organic linkers remained almost unchanged (from 18.68 to 18.23 and 18.39 Å, Fig. 4C). Further experiments indicated that the structural transformation among these conformational isomers was reversible (table S16 and fig. S46). Thus, the emergence effect (29) exemplified here showed that changes in the global frameworks were governed by subtle but oriented alternation on the conformation of imine linkages. The laboratory XRD data had sufficient resolution to accurately locate guest molecules within the COF frameworks. For example, COF-303 with BnOH as bulky guests (named COF-303-BnOH) reached an XRD resolution of 0.79 Å that enabled the explicit determination of all of the nonhydrogen atoms in the host-guest structure (table S15). BnOH molecules were arranged into four columns with an interlaced manner through hydrogen bonding (with the O–H‧‧‧O distance of 1.88 Å, red line) and C–H‧‧‧p interactions (with the C–H‧‧‧p distance of 3.04 Å, blue line) (Fig. 5, A and B). In addition, the T-shaped p interaction in the host-guest structure was identified in four types with the C–H‧‧‧p distances of 2.96, 3.25, 3.27, and 3.47 Å, respectively (Fig. 5C). Compared with the COF-303-a structure, COF-303-BnOH was expanded with a 50% increase in the unit-cell volume (Fig. 4, B and C). Accordingly, this dynamic expansion was induced by the aggregation of bulky BnOH guests within the COF-303 channels through the p of 17316(5) Å3 (table S10). The interpenetration pattern introduced the structural complexity of LZU-307 and led to the low crystallographic symmetry. Specifically, every two of the four independent networks were interlocked with each other along the three different axes through the interpenetration vectors of [0,1/ 2,1/3], [1/2,0,1/3], and [1/2,1/2,0] (Fig. 3B). The translation vectors along the crystallographic a axis (10.97 Å) and b axis (16.84 Å) exhibited a common shift of 1/2, while the translation vectors along the c-axis (7.81 Å) displayed a distinct shift of 1/3. The COFs that we synthesized (Fig. 4A) exhibited excellent crystallinity. For example, the laboratory XRD data for LZU-311 (table S11), with a sixfold-interpenetrated dia structure, reached a resolution of 0.84 Å. The data for COF-303, COF-303-p, COF-303-a, and COF-303-BnOH (tables S12 to S15) as sevenfold-interpenetrated conformational isomers reached resolutions of 0.81, 0.79, 0.88, and 0.79 Å, respectively (BnOH, benzyl alcohol); those for LZU-310, LZU-310-H2O, and LZU-310-BnOH (tables S17 to S19) as ninefoldinterpenetrated conformational isomers reached resolutions of 0.81, 0.79, and 0.84 Å, respectively. molecules, respectively. (C) Local structure of COF-303-BnOH, highlighting the C–H‧‧‧p distances between the COF-303 framework as the host and BnOH as the guest molecule. C atoms of BnOH (light blue); C atoms of COF-303 skeleton (gray); N atoms (blue); O atoms (red); H atoms (white).
RES EARCH | R E S E A R C H A R T I C L E (35) that the growth of high-quality single crystals requires slow crystallization with the cost of time consumption. RE FE RENCES AND N OT ES A. P. Côté et al., Science 310, 1166–1170 (2005). H. M. El-Kaderi et al., Science 316, 268–272 (2007). C. S. Diercks, O. M. Yaghi, Science 355, eaal1585 (2017). F. J. Uribe-Romo et al., J. Am. Chem. Soc. 131, 4570–4571 (2009). S. Y. Ding et al., J. Am. Chem. Soc. 133, 19816–19822 (2011). S. Kandambeth et al., J. Am. Chem. Soc. 134, 19524–19527 (2012). S.-Y. Ding, W. Wang, Chem. Soc. Rev. 42, 548–568 (2013). E. Jin et al., Science 357, 673–676 (2017). X. Wang et al., Nat. Chem. 10, 1180–1189 (2018). W. Zhang et al., Nature 604, 72–79 (2022). Y.-B. Zhang et al., J. Am. Chem. Soc. 135, 16336–16339 (2013). D. Beaudoin, T. Maris, J. D. Wuest, Nat. Chem. 5, 830–834 (2013). T. Ma et al., Science 361, 48–52 (2018). J. A. R. Navarro, Science 361, 35–35 (2018). A. M. Evans et al., Science 361, 52–57 (2018). L. Liang et al., Angew. Chem. Int. Ed. 59, 17991–17995 (2020). H.-S. Xu et al., Nat. Commun. 11, 1434 (2020). L. Peng et al., Nat. Commun. 12, 5077 (2021). C. Kang et al., Nat. Commun. 13, 1370 (2022). A. Natraj et al., J. Am. Chem. Soc. 144, 19813–19824 (2022). S. Wang et al., J. Am. Chem. Soc. 145, 12155–12163 (2023). Z. Zhou et al., Nat. Chem. 15, 841–847 (2023). J.-D. Yang, X.-S. Xue, P. Ji, X. Li, J.-P. Cheng, Internet Bond-energy Databank (pKa and BDE): iBonD Home Page (2024); http://ibond.nankai.edu.cn. ACKN OWLED GMEN TS J.H., L.L., and W.W. thank Y.-L. Shao, H. Wang, and G.-H. Xi for assisting with the XRD data collection and S. Chen and S. Guo for assisting with CO2 adsorption-desorption experiments. Insightful discussions with T. Ma and W. Yu, Y. Li, O. M. Yaghi, and J.-L. Sun are much appreciated. Funding: This work was financially supported by the National Key R&D Program of China (no. 2022YFA1503300), the National Natural Science Foundation of China (no. 92056202), the China Postdoctoral Science Foundation (no. 2021M691373), and the China Postdoctoral Innovation Talents Support Program (no. BX2021116). Author contributions: W.W. led the project. J.F., J.H., L.L., and W.W. conceived the idea. J.H., L.L., J.K., and J.-M.C. conducted the synthesis and crystal growth of 3D COFs. X.-Y.D. conducted the growth of 2D single-crystal COFs. L.L. and J.H. carried out the crystallographic studies. J.H., L.L., J.-M.C., and J.K. carried out the characterizations. J.H., L.L., J.K., and X.-Y.D. took the crystal images and photos. J.H., L.L., J.F., J.-M.C., S.-Y.D., and W.W. discussed the results. L.L., J.H., and W.W. interpreted the results and wrote the manuscript. Competing interests: The authors declare that they have no competing interests. Data and materials availability: Crystallographic data reported in this paper are tabulated in the supplementary materials and archived at the Cambridge Crystallographic Data Centre (CCDC) under reference nos. CCDC 2294453 to 2294464 and 2294641 to 2294643. All other data needed to evaluate the conclusions in the paper are present in the paper or the supplementary materials. License information: Copyright © 2024 the authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original US government works. https://www. science.org/about/science-licenses-journal-article-reuse SUPPLEMENTARY MATERIALS science.org/doi/10.1126/science.adk8680 Materials and Methods Supplementary Text Figs. S1 to S125 Tables S1 to S19 References (36–42) Data S1 to S27 Checkcif files for Data S1 to S15 p 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. S. J. Rowan, S. J. Cantrill, G. R. L. Cousins, J. K. M. Sanders, J. F. Stoddart, Angew. Chem. Int. Ed. 41, 898–952 (2002). 25. M. Ciaccia, S. Di Stefano, Org. Biomol. Chem. 13, 646–654 (2015). 26. N. Giuseppone, J.-L. Schmitt, E. Schwartz, J.-M. Lehn, J. Am. Chem. Soc. 127, 5528–5539 (2005). 27. T. Ma et al., J. Am. Chem. Soc. 140, 6763–6766 (2018). 28. H.-L. Jiang, T. A. Makal, H.-C. Zhou, Coord. Chem. Rev. 257, 2232–2249 (2013). 29. P. L. Luisi, Found. Chem. 4, 183–200 (2002). 30. Y. Inokuma et al., Nature 495, 461–466 (2013). 31. S. Lee, E. A. Kapustin, O. M. Yaghi, Science 353, 808–811 (2016). 32. E. Borisenko, Ed., Crystallization and Materials Science of Modern Artificial and Natural Crystals, (InTech, 2012), p. 253. 33. L. Li et al., New J. Chem. 47, 20703–20707 (2023). 34. L. Wang, J. Liu, J. Wang, J. Huang, Chem. Eng. J. 473, 145405 (2023). 35. B. R. Pamplin, Crystal Growth (Pergamon Press, 1980). Submitted 15 September 2023; accepted 17 January 2024 10.1126/science.adk8680 g y y g y , Han et al., Science 383, 1014–1019 (2024) 1 March 2024 6 of 6
RES EARCH ORGANIC CHEMISTRY Aminative Suzuki–Miyaura coupling Polpum Onnuch, Kranthikumar Ramagonolla, Richard Y. Liu* The Suzuki–Miyaura and Buchwald–Hartwig coupling reactions are widely used to form carbon-carbon (C–C) and carbon-nitrogen (C–N) bonds, respectively. We report the incorporation of a formal nitrene insertion process into the Suzuki–Miyaura reaction, altering the products from C–C–linked biaryls to C–N–C–linked diaryl amines and thereby joining the Suzuki–Miyaura and Buchwald–Hartwig coupling pathways to the same starting-material classes. A combination of a bulky ancillary phosphine ligand on palladium and a commercially available amination reagent enables efficient reactivity across aryl halides and pseudohalides, boronic acids and esters, and many functional groups and heterocycles. Mechanistic insights reveal flexibility on the order of bond-forming events, suggesting potential for expansion of the aminative cross-coupling concept to encompass diverse nucleophiles and electrophiles as well as four-component variants. 1 of 6 , At the outset of our investigations, we examined the reaction between 4-methoxyphenyl triflate (1a) and 4-(trifluoromethyl)phenylboronic acid (3a) in the presence of a variety of electrophilic amination reagents as formal precursors of parent nitrene (“NH”). Using catalysts supported by typical phosphine ligands (such as RuPhos) (Fig. 1C, entry 2), complete conversion to Suzuki–Miyaura coupling products was observed after 12 hours, with no apparent participation of the amine reagent O-diphenylphosphinyl hydroxylamine (DPPH, 2a) (29). By contrast, when a t-BuBrettPhos-modified Pd catalyst was used under optimized conditions (Fig. 1C, entry 1), the desired aminative coupling product (4a) was obtained in 96% after 12 hours with only trace Suzuki–Miyaura product (5a). The use of tBuXPhos, a ligand with similar steric properties and scaffold to t-BuBrettPhos, was found to be nearly equally effective (Fig. 1C entry 3). However, BrettPhos, a ligand typically used in Buchwald–Hartwig cross-coupling between (het)aryl (pseudo)halides and anilines y 1 March 2024 Reaction development y g Onnuch et al., Science 383, 1019–1024 (2024) y *Corresponding author. Email: richardliu@chemistry.harvard.edu g Department of Chemistry and Chemical Biology, Harvard University, Cambridge, MA 02138, USA. by means of diverted pathways that generate alternative, high-value products. In the past decade, late-stage insertion and deletion reactions have attracted tremendous attention as a strategy to generate structural diversity (27). By analogy, we asked whether the insertion of a bridging atom between the nucleophilic and electrophilic components could be a universal modification to cross-coupling reactions that generates new products from existing partners. The well-established carbonylative Stille cross-coupling (28) represents an example of this approach, but the generalization of the concept to insertions of other ambiphilic components, especially heteroatomic ones, appears to have escaped systematic consideration. To demonstrate the proposed concept, we pursued the introduction of a formal nitrene insertion into the Pd-catalyzed Suzuki–Miyaura cross-coupling pathway, rerouting its endpoint from biaryl products (C–C linkage) toward diaryl amines (C–N–C linkage), a privileged substructure class among bioactive compounds (Fig. 1B). Many industrial research operations maintain extensive libraries of custom aryl halides (or pseudohalides) and boronic acids (or esters), and we envisioned that through the addition of a simple reagent, these building blocks could be conveniently repurposed to furnish amines. This type of scaffold change from biaryl to diaryl amine, previously inaccessible in a single operation, could be useful for fine tuning the geometry, polarity, and Hbonding ability of many candidates. Achieving this goal would effectively unite the two most prominent metal-catalyzed coupling manifolds (Suzuki–Miyaura and Buchwald–Hartwig) by connecting their products to common precursor pools. Without requiring the separate synthesis and purification of new reagents, the chemical space accessible from existing functionalized intermediates could be multiplicatively increased. We anticipated that realization of the intended three-component coupling might be met with several distinct challenges. First, p T ransition metal–catalyzed cross-coupling reactions have become indispensable tools for the synthesis of important organic compounds, such as therapeutics (1–3), agrichemicals (3, 4), energy-storage materials (5, 6), and functional polymers (7, 8). Over the past half century in medicinal chemistry, three of the 20 most frequently practiced transformations are palladium (Pd)–catalyzed cross-couplings (Suzuki–Miyaura, Sonogashira, and Buchwald–Hartwig) (9). Over time, the popularization of cross-coupling has considerably influenced which sectors of chemical space are heavily emphasized during drug discovery and, therefore, the structures of recently approved small-molecule pharmaceuticals. For example, there has been a proliferation of (hetero) biaryl and aryl amine motifs because of the reliability and generality of Suzuki–Miyaura (10–13) and Buchwald–Hartwig catalysis (Fig. 1A) (14–16). These examples suggest that new, general strategies to expand the product space of essential cross-coupling schemes can enhance structural diversity during candidate generation and improve the speed and success rate of pharmaceutical development. Traditionally, research aimed at broadening the synthetic utility of cross-coupling methodology has focused on the development of catalysts and reaction conditions that engage distinct reactive partners (electrophiles or nucleophiles), a campaign punctuated by major recent achievements such as the fluorination (17, 18) and trifluoromethylation of aryl electrophiles (19–21), carbon-carbon (C–C) coupling from alkyl electrophiles (22, 23), reductive crosselectrophile couplings (24, 25), and activation of carbon-hydrogen (C–H) bonds for crosscoupling (26). An attractive but rarely explored research strategy involves the repurposing of classical, widely available coupling partners modern Pd-based catalysts perform Suzuki– Miyaura coupling so efficiently that for an amine insertion to intercede, the original process would likely need to be decelerated, either through deactivation of the catalyst toward reductive elimination or inhibition of transmetallation with the aryl boron nucleophile. However, any attenuation of reactivity must be carefully balanced; after N-insertion, the metal center must still be capable of achieving the second C–N bond formation. Likewise, the reactivity of the nitrene reagent must be precisely adjusted: It must be electrophilic enough to efficiently insert, yet it should avoid reacting prematurely with Pd(0) before oxidative addition of the aryl halide. Last, there remains the task of avoiding homocoupling processes that install two of the same aryl group on the product rather than one derived from each coupling partner. We report that the combination of a bulky catalyst and commercially available amination reagent affords a convenient and highly general solution. Our protocol is effective for all common classes of electrophiles (aryl chlorides, bromides, triflates, and tosylates) and compatible with an exceptionally broad scope of polar functional groups, substitution patterns, and heterocyclic partners relevant to medicinal chemistry. The strategy is easily used on latestage intermediates to prepare amine-inserted variants of drug candidates, and preliminary results suggest that the insertion concept can be extended to other reaction classes (allylic substitution) and even four-component variants (ArX + CO + NH + Ar’M). The cross-selectivity of this reaction is notable because mechanistic experiments indicate that multiple competing mechanisms likely operate simultaneously.
RES EARCH | R E S E A R C H A R T I C L E A Me SO2Me SMC O N Me N O OCF3 Me SMC Cl SMC N Sonidegib B OMe MeO Me N i-Pr N N SMC BHC HN N BHC i-Pr N N H Et N N X N CONMe2 N N HN Fenofibrate Etoricoxib N CO2i-Pr O CO-SMC Me F F H BHC N N N N N H O Cl Ribociclib (HO)2B SMC + Me N N • repurpose SMC partners to make BHC products SMC N H N NH2 X N “NH” BHC + Erdafitinib Abemaciclib C OTf 1a entry (HO)2B + CF3 2a 1.5 equiv CF3 H N t-BuBrettPhos Pd G3 (3 mol%) + K3PO4 (4.0 equiv), 2-MeTHF (0.2 M), 80 °C CF3 MeO 3a 2.0 equiv MeO 4a variation from standard conditions 1 p + MeO O P H2 N O Ph Ph NO2 None 96 RuPhos Pd G3 (3 mol%) 3 t-BuXPhos Pd G3 (3 mol%) 4 BrettPhos Pd G3 (3 mol%) 70 5* K3PO4 (3.5 equiv) 71 6* KOH (3.5 equiv) 7 Reagent 2d (1.5 equiv) 8* KOH (3.5 equiv), ArBpin instead of ArB(OH)2 H2 N 107 93 MsO L Pd H2 N O g 2 3 5a NO2 13 2d 36 L Pd G3 R2 y 21 79 5 40 20 PR12 i-Pr PCy2 Oi-Pr i-PrO 63 79 0 R2 i-Pr 40 60 Yield (%) 5 80 i-Pr R1 = t-Bu, R2 = OMe: t-BuBrettPhos R1 = Cy, R2 = OMe: BrettPhos 100 R1 = t-Bu, R2 = H: t-BuXPhos RuPhos Substrate scope The generality of this optimized protocol is notable because the method is not only effective across a diverse set of (hetero)aryl triflates (Fig. 2) but also—with only slight modifications to the conditions (optimization data is provided in table S3)—is compatible with (hetero)aryl bromides and chlorides (Fig. 3). Empirically, we found that bases other than potassium phosphate are necessary: The reaction can proceed with a weak, soluble, organic base such as 1,8diazabicyclo(5.4.0)undec-7-ene (DBU), but the use of KOH is more broadly applicable. Because of the relatively mild reaction conditions, the cross-coupling exhibits substantial functional group compatibility. Electron-deficient and electron-rich examples of both aryl triflates 1 March 2024 and aryl boronic acids were coupled in high yields (4a to 4d). Other electron-withdrawing substituents that were well tolerated include nitro (4x) and nitrile (4ab). A variety of ortho substituents—including methyl (4e, 4f, 4g, 4aj, and 4al), alkoxy (4 g, 4h, 4l, 4q, 4y, 4z, 4af, and 4ak), and halides (4i, 4r, and 4s)— on either or both coupling partners did not adversely affect the reactivity, resulting in moderate to high yields. A substrate containing a primary alcohol was coupled in 36% yield (4j). The potential for side reactions such as O-arylation and oxidation of the alcohol through b-hydride elimination of a Pd(II) alkoxide could be responsible for the low yield in this case. Substrates containing carboxylic acid derivatives such as amide (4k); a-acidic aryl ketones (4k and 4aa) and alkyl ketones (4l); and esters including ethyl (4d), methyl (4 g, 4h, 4k, and 4q), and isopropyl (4am) all reacted 2 of 6 , Onnuch et al., Science 383, 1019–1024 (2024) provided that KOH was used as the base (Fig. 1C, entry 8). y (30), could only catalyze the reaction with diminished yield (70%) (Fig. 1C, entry 4) and selectivity (36% 5a was formed). Relative to the optimized conditions, decreasing equivalents of 2a and 3a were associated with incomplete conversion and lower yield of 4a (Fig. 1C, entry 5). A stronger base, such as potassium hydroxide (KOH), could be used to restore high yield and full conversion, but in polar solvents—such as N,N′-dimethylformamide (DMF) (table S1, entry 4), acetonitrile (MeCN) (table S1, entry 3), and 2-methyltetrahydrofuran (2-MeTHF) (Fig. 1C, entry 6)—triflate decomposition to phenol was a competing side reaction. Other ambiphilic aminating agents such as 2d (Fig. 1C, entry 7), which have been previously reported (31) to effect amination of aryl boronic acids, were ineffective in this context (table S2, entries 10 to 13). Instead of boronic acid 3a, its pinacol ester displayed equally efficient reactivity y g Fig. 1. Background and concept. (A) Suzuki–Miyaura (SMC) and Buchwald–Hartwig (BHC) cross-coupling in drug development. (B) This work: SMC with NH insertion to access BHC products. (C) Challenges for single-heteroatom insertion. (D) Selected results from reaction optimization (yields shown as determined with gas chromatography analysis). Asterisk indicates 2a (1.1 equiv), 3a (1.5 equiv).
RES EARCH | R E S E A R C H A R T I C L E O P O Ph Ph OTf R1 H 2N + H N t-BuBrettPhos Pd G3 (1 to 3 mol%), K 3PO 4 (4.0 equiv) (HO)2B R2 + R2 R1 2-MeTHF (0.2 M), 80 °C 1.5 to 2.0 equiv 2a 1.1 to 2.0 equiv (Het)ArOTf H N R2 R1 Me H N Me MeO 4a: R1 = 4-OMe, R2 = 4-CF3, 81% 4b: R1 = 4-OMe, R2 = 4-F, 93% 4c: R1 = 4-OMe, R2 = 4-OTBS, 81% 4d: R1 = 4-CO2Et, R2 = 4-CF3, 70% 4e: R1 = 4-OMe, R2 = 2-Me, 75% O 4f: 36% using ArBpin O S N O Boc N MeO2C Me 4h: 68%, 91% ee from L-Boc-tyrosine-OMe O Me H N N OH 4j: 36% N H 4l: 44%, from estrone H N H N N N N Me Me S N Me N N S 4o: 84% F O F MeO F 4p: 56% H N F O Ph H N Oi-Pr N EtO2C Me 4s: 45% using ArBpin 9% using ArB(OH)2 4r: 79% using ArBpin 0% using ArB(OH)2 F 4t: 44% y 4q: 42% F N g H N OMe F3C N 4n: 45% 4m: 76% H N Me H N N Me N p H N OMe Me O 4k: 86% Me 4i: 56% MeO2C H CO2Me O N H O Ph OMe H N H N O OBn H N NH MeO2C 4g: 67% O Cl H N OMe H N Fig. 2. Scope of coupling with aryl triflates. Asterisk indicates 2a (2.0 equiv), ArB(OH)2 (2.0 equiv), DBU (3.0 equiv), PhMe (0.2 M), 80°C. “†” indicates 2a (1.5 equiv), ArB(OH)2 (1.5 equiv), DBU (3.0 equiv), PhMe (0.2 M), 60°C. “‡” indicates 2a (1.1 equiv), ArBPin instead of ArB(OH)2 (1.5 equiv), KOH (3.5 equiv). “§” indicates KOH (3.0 equiv), 2a (1.1 equiv), ArB(OH)2 (1.5 equiv), PhMe (0.2 M). “¶” indicates ArOTs instead of ArOTf, DBU (4.0 equiv), MeCN (0.2 M). X + X = Br or Cl O P O Ph Ph R2 + H N t-BuBrettPhos Pd G3 (1 to 3 mol%), t-BuBrettPhos (0 to 1 mol%) (HO)2B R2 R1 KOH (3.0 to 4.0 equiv), MeCN (0.2 M), 80 °C y g R1 H 2N 1.2 to 2.0 equiv 2a 1.1 to 2.0 equiv (Het)ArBr H N F H N PhO H N Me 4z: 84% 4aa: 67% H N O N N H N OMe O N N Me O 4ae: 42% S O 4af: 63% NO2 N O H N H N CN 4ac: 51% H N H N 4ad: 82% O F 4ag: 70% O MeO S 4ab: 56% N N 4y: 72% 4x: 68% H N MeO N S 4w: 69% 4v: 45% OBn H N H N Me F F3C 4u: 62% N , O H N H N y O N F3C 4ah: 60% Me H N N O 4ai: 78% Fig. 3. Scope of coupling with aryl halides. Asterisk indicates 2a (1.5 equiv), ArB(OH)2 (1.5 equiv), DBU (3.0 equiv). “†” indicates 2a (2.0 equiv), ArB(OH)2 (2.0 equiv), DBU (3.0 equiv). Onnuch et al., Science 383, 1019–1024 (2024) 1 March 2024 3 of 6
RES EARCH | R E S E A R C H A R T I C L E successfully, as did those containing strained cyclopropane rings (4k and 4ad) and carbamates (4h and 4al). Nitrogen-containing heterocycles such as pyridines activated at the 2 (4p), 3 (4 g, 4n, 4o, 4p, and 4q), and 4 positions (4s) and pyrimidine (4l) were compatible with the reaction conditions. 6-(Morpholinyl) pyridine, a common moiety in small-molecule drug development, was also tolerated (4y and 4ae). Fused six- (4n, 4ah, and 4ai) and fivemembered (4m, 4ab, 4ac, 4af, 4ag, and 4am) heterocycles were coupled in moderate to excellent yields. The N–N bond in 4o was left intact under our conditions; however, substrates with the (pseudo)halide directly attached to a five-membered ring proved difficult to couple (fig. S7), which is consistent with prior observations that had been attributed to catalyst deactivation, slow reductive elimination, and instability toward base-promoted ring fragmentations (32). Last, several examples of sulfurcontaining five-membered heterocycles reacted successfully (4q, 4ab, and 4ac). Prior studies have shown that highly electrondeficient boronic acids with ortho heteroatoms and polyfluorinated systems are particularly challenging to couple under Suzuki–Miyaura conditions owing to rapid competing protodeboronation (33, 34). We found that examples 4r and 4s were difficult to prepare from boronic acids, resulting in poor or undetectable yield of product and substantial formation of protodeboronation side products. However, if instead the pinacol esters of the requisite boronic acids were used, the desired products were obtained in considerably improved yields of 79% (4r) and 45% (4s). Showcasing the mild and versatile conditions, the reaction was used to derivatize some simple natural products: We obtained 4h from L-tyrosine (with 91% retention of enantiopurity), 4l from estrone, and 4i and 4s from flavone. Compounds 4aa and 4ad were synthesized in excellent yields from an aryl bromide intermediate from the synthesis of adapalene, a topical treatment for acne vulgaris. The reaction conditions can be effective for aryl tosylates as well (4t), although further optimization may be needed to increase the yield. A Applications and extensions Fig. 4. Applications of aminative Suzuki–Miyaura coupling. (A) NH insertion into drugs synthesized by means of SMC. (B) Late-stage modification of ArCl-containing drugs. (C) Four-component coupling involving sequential NH and CO insertion. (D) Aminative Tsuji-Trost allylation. Asterisk indicates 0.4 mmol scale, [Pd] (3 mol %), 2a (1.1 equiv), ArB(OH)2 (1.5 equiv), KOH (3.5 equiv), 2-MeTHF (0.2 M), 80°C. “†” indicates 1.0 mmol scale, [Pd] (3 mol %), 2a (1.1 equiv), ArB(OH)2 (1.2 equiv), KOH (3.5 equiv), MeCN (0.2 M), 80°C, yield reported is an average between 2 runs. “‡” indicates [Pd] (2 mol %), t-BuBrettPhos (1 mol %), 2a (1.1 equiv), ArB(OH)2 (1.2 equiv), KOH (3.0 equiv), MeCN (0.2 M), 80°C. “§” indicates [Pd] (2 mol %), dppf (0.6 equiv), DBU (3.0 equiv), MeCN (0.2 M), 80°C. “¶” indicates [Pd] (2 mol %), DBU (3.0 equiv), MeCN (0.2 M), 80°C. Me Me O SMC O N N Me N Me N O OCF3 Me Me O N H Br N H Sonidegib 1aj + H 2N (HO)2B OCF3 O P Ph Ph 2a Me O O “NH” Insertion N Me N O Me 3aj N H H N OCF3 4aj: 33% SO2Me Cl SMC N OBn Etoricoxib Intermediate Cl (HO)2B Br p + N SO2Me OBn 1ak H2N 3ak O P Ph Ph 2a O H N Cl “NH” Insertion N OBn SO2Me B Cl H N (HO)2B + Drug “NH” insertion O Me O O P Ph Ph N i-PrO Me Me O O EtO Drug 4al: 58%, from Loratadine Br + Fe(CO)5 F3C 0.5 equiv 1w N N Me N H N C H N O y H2N g 4ak : 50% + O H2 N P O Ph Ph 4am: 75%, from Fenofibrate 4-Component Coupling (HO)2B + F N H F3C 6ao: 55% 3b 1.5 equiv 2a 1.2 equiv F O y g D OAc F 7ap OAc + O H 2N P O Ph Ph Allylation + F 3b 1.2 equiv N H 9ap from 7ap: 54% from 8ap: 36% , 8ap Because of its broad reliability and functionalgroup compatibility, this method allows for the convenient reuse of complex Suzuki–Miyaura partners to access NH-inserted variants of druglike molecules through inclusion of the DPPH reagent during the coupling reaction (Fig. 4A). For example, synthesis of Sonidegib, a Smoothened (SMO) inhibitor used for the treatment of basal cell carcinoma, relies on Suzuki–Miyaura coupling of 1aj and 3aj (35). Following our protocol, these same reagents can be repurposed to afford analog 4aj in modest yield (33%) (Fig. 4A, top). Similarly, Etoricoxib, a cyclooxygenase-2 (COX-2) inhibitor used to treat arthritis pain, Onnuch et al., Science 383, 1019–1024 (2024) y 2a 1.1 equiv (HO)2B can be synthesized by means of Suzuki–Miyaura coupling reactions from 1ak (Fig. 4B, bottom) (36). We subjected 1ak and 3ak to aminative coupling conditions to afford the product 4ak, a modified Etoricoxib intermediate, in 50% yield on a 1-mmol scale. The haloselectivity 1 March 2024 under these conditions completely favors aryl bromides and triflates over chlorides (for example, 4i). Last, we demonstrated several examples of functionalization of pharmaceutical intermediates and small-molecule drugs containing aryl chlorides, which can be less reactive 4 of 6
RES EARCH | R E S E A R C H A R T I C L E A Ar H N Ar X Ar´ H N Ar Ar´ HN LPd X Ar H 2N Ar O O P Ph Ph LPd HN Base Ar´ NH LPd0 LPd0 LPd B(OH)2 Ar X Ar´ Base-H+ Ar LPd X Ar´ O H P N B Ph O Ph HO OH Ar´ Ar Ar´ NH2 Base Base O Ar´ B(OH)2 LPd HN P Ph Ph O LPd O HN P O Ph Ph Ar Base Ar Ar LPd O HN Ar´ B OH P O Ph Ph OH Electrophile First B Ar´ B(OH)2 Nucleophile First CO2Et t-BuBrettPhos-Pd H 2N + O P O Ph Ph C + 2a 1.1 equiv OTf H2 N MeO 1a O O P Ph Ph 2-MeTHF (0.05 M), 80 °C, 15 min then HCl quench O + O B Coupling * F H N 3-Component F MeO F + F 3r 1.5 equiv F 4r No [Pd] CO2Et 7d 25% 6d 3% F F 2a 1.1 equiv H2N F F 6r 55 0.5 mol% 4 Pd loading EtO2C EtO2C 66 62 87 2 mol% 0 22 44 66 26 88 110 Yield (%) Mechanistic insights 1 March 2024 REFERENCES AND NOTES 1. J. Rayadurgam, S. Sana, M. Sasikumar, Q. Gu, Org. Chem. Front. 8, 384–414 (2021). 2. J. Yin, in Applications of Transition Metal Catalysis in Drug Discovery and Development, M. L. Crawley, B. M. Trost, Eds. (John Wiley & Sons, 2012), pp. 97–163. 3. C. Torborg, M. Beller, Adv. Synth. Catal. 351, 3027–3043 (2009). 4. P. Devendar, R.-Y. Qu, W.-M. Kang, B. He, G.-F. Yang, J. Agric. Food Chem. 66, 8914–8934 (2018). 5. A. Omidvar, ACS Appl. Energy Mater. 3, 11463–11469 (2020). 6. M. Quant et al., Chem. Sci. 13, 834–841 (2021). 7. A. K. Leone, E. A. Mueller, A. J. McNeil, J. Am. Chem. Soc. 140, 15126–15139 (2018). 8. J. Zhu et al., Acc. Chem. Res. 51, 3191–3202 (2018). 5 of 6 , A plausible pathway for initial C–N bond formation to take place from the aryl electrophile (Fig. 5A, mechanism I, “electrophile-first”) could involve a 1,2-shift of the aryl ligand from Pd(II) to a coordinated and deprotonated 2a, which generates the amido complex LPd(NHAr)OPOPh2. This process resembles that proposed by Knochel and coworkers for the electrophilic amination of organozinc reagents with organic azides (38). The resulting Pd(II) phosphinate can undergo transmetallation with a boronic acid and reductive elimination to afford the desired product. The idea that amination of the aryl electrophile might precede C–N bond formation with the aryl nucleophile is consistent with observation of aniline derived from the former in some cases. For example, 8% of 1-aminonaphthalene was isolated in the reaction to produced 4j in Fig. 2. As further evidence, a stoichiometric reaction between Pd-1, a likely on-cycle postoxidative-addition complex, with reagent 2a in the presence of base resulted in 3% of aniline 6d and 25% diaryl amine 7d, showing that C–N y Onnuch et al., Science 383, 1019–1024 (2024) proceeds through a Pd p-allyl intermediate, 8ap was subjected to the same reaction conditions to afford the same product, although in a slightly diminished yield (36%). In the absence of a Pd catalyst, no product was observed. y g than aryl bromides in cross-coupling. Late-stage modification of Loratidine and Fenofibrate provided 4al and 4am, respectively, in good yields. These examples illustrate the power of this reaction in providing direct access to new drug candidates without introducing additional operations or intermediates on all stages of drug synthesis. Formal nitrogen insertion into cross-coupling reactions is a concept readily generalizable beyond the Suzuki–Miyaura couplings shown above. For example, by tandem insertion of NH and a carbonyl (C=O) group, Suzuki–Miyaura coupling partners can be used to make amides as an alternative to traditional amide-bond formation, which is one of the most frequently used reactions in medicinal chemistry (9). As an example, 1w and 3b were coupled in the presence of 2a and iron pentacarbonyl [Fe(CO)5] as the carbonyl source to produce 6ao in good yield (55%) (Fig. 4C; further optimization data is available in table S4). We also observed the successful application of this NH insertion concept in the context of Pd-catalyzed allylation (Tsuji–Trost) chemistry (Fig. 4D) (37). Under unoptimized conditions, substrate 7ap undergoes coupling with reagent 2a and boronic acid 3b to furnish the linear product 8ap in good yield (54%) and selectivity (only branched product observed). As evidence that the reaction y Fig. 5. Mechanistic insights. (A) Proposed mechanisms. (B) Stoichiometric reaction between Pd-1 and 2a. (C) Effects of Pd loading on total C–N bond formation from boronate ester 3r. Asterisk indicates t-BuBrettPhos Pd G3, KOH (1.5 equiv), 2-MeTHF (0.2 M), 80°C. g 16 1 mol% p + H N NH2 KOH (2.0 equiv) OTf Pd-1 O P H2N O Ph Ph + formation from (pseudo)halide is possible under the reaction conditions (Fig. 5B). The formation of 7d is expected from the reaction of 6d with Pd-1 in the absence of any other competitive nucleophile (a boronic acid was not included in these experiments). During the course of our studies, it became clear that initial C–N bond formation from the aryl nucleophile side could also viable (Fig. 5A, mechanism II, “nucleophile-first”). Electrophilic amination of boronic acids by reagents such as 2d has been reported (37), although such transformations are typically limited to electron-rich substrates, and many reagents competent for this process are not effective in our three-component coupling. Under our optimized conditions, for some substrate combinations, Pd-independent formation of aniline from arylboron can occur. In one possibility, this aniline could then be arylated through a typical Buchwald–Hartwig pathway to form the three-component coupling product. However, the total amount of C–N bond formation from the boronate (sum of yields for 4r and 6r) increases with catalyst loading, as does the relative ratio of 4r to 6r (Fig. 5C). The ability of the catalyst to affect total C–N bond formation from the boronate implies that there is also a Pd-dependent mechanism for creating this bond. A proposed explanation is illustrated in Fig. 5A, mechanism II, in which arylpalladium(II), boronic acid, and DPPH form a complex, in which the Lewis acidity of the metal increases the electrophilicity of the nitrogen atom and facilitates aryl migration from boron. Because of this pathway, yields obtained in aminative Suzuki reactions can exceed those of Buchwald–Hartwig amination from pregenerated anilines under the same conditions (supplementary materials, section 8.4). Work continues in our laboratory to achieve a more detailed characterization of available pathways and to elucidate the effect of substrate structure on which of the nucleophile-first or electrophile-first mechanisms is preferred. However, at this point, our studies have definitively established the possibility of forming insertive cross-coupling products through either order of events. Looking forward, we argue that this mechanistic flexibility portends favorably for the extension of the aminative cross-coupling concept to diverse classes of both nucleophiles and electrophiles.
RES EARCH | R E S E A R C H A R T I C L E 9. D. G. Brown, J. Boström, 59, 4443–4458 (2016). 10. J. Almond-Thynne, D. C. Blakemore, D. C. Pryde, A. C. Spivey, Chem. Sci. 8, 40–62 (2017). 11. M. A. Düfert, K. L. Billingsley, S. L. Buchwald, J. Am. Chem. Soc. 135, 12877–12885 (2013). 12. K. Billingsley, S. L. Buchwald, J. Am. Chem. Soc. 129, 3358–3366 (2007). 13. M. J. Buskes, M.-J. Blanco, Molecules 25, 3493 (2020). 14. H. H. Nguyen et al., ACS Med. Chem. Lett. 12, 1605–1612 (2021). 15. A. T. Garrison et al., J. Med. Chem. 61, 3962–3983 (2018). 16. C. Fischer, B. Koenig, Beilstein J. Org. Chem. 7, 59–74 (2011). 17. H. G. Lee, P. J. Milner, S. L. Buchwald, J. Am. Chem. Soc. 136, 3792–3795 (2014). 18. D. A. Watson et al., Science 325, 1661–1664 (2009). 19. R. J. Lundgren, M. Stradiotto, Angew. Chem. Int. Ed. 49, 9322–9324 (2010). 20. E. J. Cho et al., Science 328, 1679–1681 (2010). 21. Y. Ye, M. S. Sanford, J. Am. Chem. Soc. 134, 9034–9037 (2012). 22. A. W. Dombrowski et al., ACS Med. Chem. Lett. 11, 597–604 (2020). 23. J. Choi, G. C. Fu, Science 356, eaaf7230 (2017). 24. D. A. Everson, D. J. Weix, J. Org. Chem. 79, 4793–4798 (2014). 25. D. J. Weix, Acc. Chem. Res. 48, 1767–1775 (2015). 26. N. Y. S. Lam, K. Wu, J.-Q. Yu, Angew. Chem. Int. Ed. 60, 15767–15790 (2021). 27. J. Jurczyk et al., Nat. Synth. 1, 352–364 (2022). 28. A. M. Echavarren, J. K. Stille, J. Am. Chem. Soc. 110, 1557–1565 (1988). 29. W. Klötzer, J. Stadlwieser, J. Raneburger, Org. Synth. 64, 96 (1986). 30. B. T. Ingoglia, C. C. Wagen, S. L. Buchwald, Tetrahedron 75, 4199–4211 (2019). 31. S. Voth, J. W. Hollett, J. A. McCubbin, J. Org. Chem. 80, 2545–2553 (2015). 32. E. C. Reichert, K. Feng, A. C. Sather, S. L. Buchwald, J. Am. Chem. Soc. 145, 3323–3329 (2023). 33. H. L. D. Hayes et al., J. Am. Chem. Soc. 143, 14814–14826 (2021). 34. P. A. Cox et al., J. Am. Chem. Soc. 139, 13156–13165 (2017). 35. S. Pan et al., ACS Med. Chem. Lett. 1, 130–134 (2010). 36. J. J. F. Caturla, G. Warrellow, 2,3′-Bipyridines derivatives as selective COX-2 inhibitors. World Intellectual Property Organization (WIPO) patent application no. WO 2004/072037 A1 (2004). 37. B. M. Trost, D. L. Van Vranken, Chem. Rev. 96, 395–422 (1996). 38. S. Graßl, J. Singer, P. Knochel, Angew. Chem. Int. Ed. 59, 335–338 (2020). ACKN OWLED GMEN TS We acknowledge N. Faialaga for helpful discussions. We thank I. Leibler, N. Faialaga, S. Li, and N. Naito for advice on the preparation of the manuscript and the supplementary materials. Funding: This work was supported by the William F. Milton Fund and the Corning Fund for Faculty Development at Harvard University. Author contributions: R.Y.L. conceived and directed the execution of the study. P.O. and K.R. performed all experiments. All authors contributed to the preparation of this manuscript. Competing interests: The authors declare no competing interests. Data and materials availability: All data are available in the main text or the supplementary materials. License information: Copyright © 2024 the authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original US government works. https://www.science.org/about/science-licenses-journalarticle-reuse SUPPLEMENTARY MATERIALS science.org/doi/10.1126/science.adl5359 Materials and Methods Figs. S1 to S9 Tables S1 to S4 References (39–65) Submitted 24 October 2023; accepted 5 January 2024 10.1126/science.adl5359 p g y y g y , Onnuch et al., Science 383, 1019–1024 (2024) 1 March 2024 6 of 6
WORKING LIFE By Tae Seok Moon From anxiety to action “T science.org SCIENCE , 1 MARCH 2024 • VOL 383 ISSUE 6686 y 1026 Tae Seok Moon is a professor at Washington University in St. Louis. Send your career story to SciCareerEditor@aaas.org. y g “I told myself I would stop fearing career repercussions and would push ahead with my ambitions.” y search. But I had never felt ready or that I was a “big” enough name to pull it off. Now, I told myself I would stop fearing career repercussions and would push ahead with my ambitions, focusing on the good I could do rather than the ways it might go wrong. It wasn’t always easy, and my anxiety didn’t immediately disappear. My colleagues and university leadership did not show much interest in the project, and I worried that my planned format— which gave the big-name speakers short presentation slots while leaving more time for those earlier in their careers—might be taken as an insult. But I learned to spend more time trying than worrying. I realized there are two types of problems: ones that can be solved, and others that cannot. If it is solvable, my job is to try hard to solve it. If not, my task is to find alternative options. Either way, worrying does not help. I’ve been running my weekly seminar series for 2.5 years now. It requires a tremendous amount of time, commitment, and effort. Nonetheless, I have been energized by the excitement and passion I have seen from the young people involved. That is all the reward I have been looking for. My regrets over the incident with my student helped me realize that my goal in life should be fulfillment, not just career success. I am now the happiest I have ever been because I have reconnected with my purpose: nurturing future generations. j g By many measures, my career was flourishing. I had secured grant funding, published highimpact journal articles, and given conference talks. I was popular among students. Even so, I was consumed with anxiety. During faculty meetings, I never spoke up unless I was asked. I focused only on research and education, not campus politics. I thought this was the way to success. This was my mindset 5 years into my faculty career, when the incident with my student occurred. I refused to kick him out, but I did make it quiet. I persuaded him to rescind his complaint, put his head down, and focus on his research and job search. (Editor’s note: Washington University in St. Louis declined to comment on the events in this story.) Within the next year, the situation seemed resolved: I was awarded tenure and my student found a job at a different company. But I was overcome with guilt about my role. I felt like a coward. My anxiety worsened. I lost an unhealthy amount of weight and went to the emergency room multiple times with severe pain. I call these my dying years. A turning point came when my student ultimately landed a job at the company he had been interviewing with in the hallway and contributed to developing the first COVID-19 vaccine. His perseverance inspired me. My goal when I became a professor was to educate future leaders, and I resolved not to let my anxious personality hold me back any longer. For years, I had wanted to start a seminar series that covered both cutting-edge science and the personal and professional challenges scientists face as we pursue our re- p ae Seok, you know what to do: Make it quiet and kick him out.” “Him” was one of my best graduate students, who published four papers in 5 years while sending money home from the United States to his family in Africa. But he had run afoul of another professor when he took a phone call for a job interview in the hallway, where his cell signal was strongest. Based on his skin color, the professor assumed he was not a student and called the police, who escorted him away. Beyond the insult, it cost my student a dream job at his dream company. He filed a complaint with the university’s discrimination office—and now my institution’s leadership was telling me to make it go away. I was outraged, but I felt powerless. My tenure package was about to go up for evaluation. I didn’t feel I was in a position to fight back.